ID: 1184253119

View in Genome Browser
Species Human (GRCh38)
Location 22:43272080-43272102
Sequence CTGGTACCCACTTGGCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 171}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184253107_1184253119 30 Left 1184253107 22:43272027-43272049 CCCAAAGGGGTTCTAGCCCCTCC 0: 1
1: 0
2: 0
3: 4
4: 96
Right 1184253119 22:43272080-43272102 CTGGTACCCACTTGGCAGCCTGG 0: 1
1: 0
2: 0
3: 11
4: 171
1184253111_1184253119 12 Left 1184253111 22:43272045-43272067 CCTCCATTAAGTGCTCACCTCAC 0: 1
1: 0
2: 0
3: 7
4: 133
Right 1184253119 22:43272080-43272102 CTGGTACCCACTTGGCAGCCTGG 0: 1
1: 0
2: 0
3: 11
4: 171
1184253112_1184253119 9 Left 1184253112 22:43272048-43272070 CCATTAAGTGCTCACCTCACACC 0: 1
1: 0
2: 1
3: 8
4: 142
Right 1184253119 22:43272080-43272102 CTGGTACCCACTTGGCAGCCTGG 0: 1
1: 0
2: 0
3: 11
4: 171
1184253110_1184253119 13 Left 1184253110 22:43272044-43272066 CCCTCCATTAAGTGCTCACCTCA 0: 1
1: 0
2: 0
3: 13
4: 123
Right 1184253119 22:43272080-43272102 CTGGTACCCACTTGGCAGCCTGG 0: 1
1: 0
2: 0
3: 11
4: 171
1184253108_1184253119 29 Left 1184253108 22:43272028-43272050 CCAAAGGGGTTCTAGCCCCTCCA No data
Right 1184253119 22:43272080-43272102 CTGGTACCCACTTGGCAGCCTGG 0: 1
1: 0
2: 0
3: 11
4: 171
1184253109_1184253119 14 Left 1184253109 22:43272043-43272065 CCCCTCCATTAAGTGCTCACCTC 0: 1
1: 0
2: 0
3: 17
4: 120
Right 1184253119 22:43272080-43272102 CTGGTACCCACTTGGCAGCCTGG 0: 1
1: 0
2: 0
3: 11
4: 171
1184253114_1184253119 -5 Left 1184253114 22:43272062-43272084 CCTCACACCTCATCAGCCCTGGT 0: 1
1: 0
2: 2
3: 38
4: 482
Right 1184253119 22:43272080-43272102 CTGGTACCCACTTGGCAGCCTGG 0: 1
1: 0
2: 0
3: 11
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184253119 Original CRISPR CTGGTACCCACTTGGCAGCC TGG Intronic
900124527 1:1063527-1063549 CTGGTACCCGCTGGGCTGCCAGG + Intergenic
902361084 1:15943003-15943025 CTGCTCCCCACCTGGCAGCAGGG + Intronic
902622148 1:17656744-17656766 CTGGCACCCAGCTGGCATCCAGG - Intronic
904091750 1:27949778-27949800 CAGGCGCCCAGTTGGCAGCCTGG - Intronic
904383313 1:30125686-30125708 ATGGCACCAACTTAGCAGCCTGG - Intergenic
904500265 1:30908928-30908950 CGGGTGCCCACTCGGCAGCGCGG - Intergenic
905422971 1:37860585-37860607 CTGGTACCCACCAGACTGCCAGG + Intergenic
905775212 1:40663934-40663956 CTGCTACCCACATAGCAGCTGGG + Intronic
905840136 1:41169675-41169697 CTGGTGACTACTTGCCAGCCTGG - Intronic
907420134 1:54341730-54341752 CATGTACCCACTTGGCTCCCAGG - Intronic
912100067 1:106193042-106193064 CAGGTACCCACATAGCAGTCAGG - Intergenic
917666731 1:177232256-177232278 CTGGTAGCCACTTAGCACCTGGG + Intronic
918044966 1:180936064-180936086 CTGGGACCCCAGTGGCAGCCTGG + Exonic
919797804 1:201331869-201331891 CAGGGACCCACGTGGGAGCCTGG + Exonic
920373332 1:205493122-205493144 CTGGGACCCACAGAGCAGCCAGG - Intergenic
920565183 1:206967402-206967424 TGGGCACCCACTTGCCAGCCTGG + Intronic
922368419 1:224887162-224887184 CTGGTGCCCTCTTGGAGGCCTGG - Intergenic
923265099 1:232306578-232306600 TTTGCTCCCACTTGGCAGCCAGG + Intergenic
1063219236 10:3950818-3950840 CTGGAACACAGTTGGCAGCAAGG - Intergenic
1064904028 10:20325814-20325836 CAAGTACCCACGTGGCACCCAGG + Intergenic
1069988447 10:72299402-72299424 TTGGTATTCACTTTGCAGCCTGG - Intergenic
1071333734 10:84585292-84585314 CATGAACCCACTCGGCAGCCCGG - Intergenic
1072944206 10:99795140-99795162 CAGGGACCCATTTGGCAGGCTGG + Intronic
1073060752 10:100732119-100732141 CTGGTACCCACTCCCCAGCATGG + Intergenic
1074699183 10:116078463-116078485 CCTGGAACCACTTGGCAGCCTGG + Intronic
1075582728 10:123634331-123634353 CAGGTGCCCCCTTGCCAGCCCGG - Intergenic
1076815153 10:132910978-132911000 CCAGCACCGACTTGGCAGCCCGG - Intronic
1076889858 10:133278098-133278120 CTGGGAGCCTCTCGGCAGCCTGG - Intergenic
1076943466 10:133626140-133626162 CTGGGAGCTCCTTGGCAGCCAGG - Intronic
1077068665 11:657114-657136 CTGGCACCCACCTGGCACCCAGG + Intronic
1077371891 11:2186180-2186202 CTGGCTCCCACCTGGCACCCAGG + Intergenic
1083645440 11:64169771-64169793 CTGGTACACAGTAGGCATCCAGG - Intergenic
1084448629 11:69218965-69218987 CGGGTACCCACTAGTCAGACAGG - Intergenic
1084448638 11:69219007-69219029 TTGGTACCCACTAGCCAGACAGG - Intergenic
1089213721 11:116822994-116823016 CTGTGAGCCACTTGGCAGCCAGG + Intronic
1091217330 11:133910513-133910535 CTGGTACCCACTGGGGTGTCAGG - Intronic
1091701365 12:2665503-2665525 CTGGAACCCCCTTGCCAGCTGGG - Intronic
1092106673 12:5926340-5926362 CTGTTCCCCACAAGGCAGCCAGG + Intronic
1096569945 12:52516714-52516736 CTGGTACTCACGCAGCAGCCGGG + Exonic
1101818127 12:108161664-108161686 GTGGTACTCTGTTGGCAGCCCGG + Intronic
1102020625 12:109679861-109679883 CTGGTGCCCACTGGGCAGGTGGG - Intergenic
1103317069 12:120064669-120064691 CTAGTTCCTACTTGTCAGCCCGG + Intronic
1103931701 12:124454034-124454056 CTGGCACCCAGTTGGTAGACAGG + Intronic
1110429464 13:75407115-75407137 CTGGTACCCACTTACCAGTATGG - Intronic
1114457470 14:22865541-22865563 CTAGTTCCCACTGGGTAGCCTGG - Intergenic
1117740761 14:58816905-58816927 CTGGTGGCCCCTTGGCAGACAGG - Intergenic
1119620105 14:76125514-76125536 TTGGGACCCACATGTCAGCCTGG + Intergenic
1119854619 14:77890253-77890275 CTAGCACCAACTTGCCAGCCAGG - Intronic
1120246830 14:82016712-82016734 CTGCAACCAAATTGGCAGCCAGG + Intergenic
1122759685 14:104013773-104013795 GTGGTAACCTCTTGGGAGCCAGG + Intronic
1124583781 15:30986725-30986747 CTGGTACCCAGATTCCAGCCAGG - Intronic
1126042707 15:44608150-44608172 CTGGTTCCCATTAGGCAGCCTGG + Intronic
1128062313 15:64742805-64742827 CAGTTACCCACTTGGCTGCTGGG + Intronic
1130444740 15:83990302-83990324 CTGGCATCCACATGTCAGCCTGG + Intronic
1133271524 16:4613006-4613028 CTGGCACCCAGCTGGCACCCAGG - Intronic
1133296910 16:4758393-4758415 CACGTAACCACTTGGGAGCCGGG + Intronic
1134573962 16:15316148-15316170 CTGGTACACAGTTGGTTGCCAGG - Intergenic
1135040186 16:19112463-19112485 CTGGTTCCCAGGTGGCAGCTGGG + Intergenic
1135752839 16:25070683-25070705 CTGGTACTCATTTGGAGGCCCGG + Intergenic
1136100083 16:27987601-27987623 CAAGTACCCACGTGGCACCCAGG - Intronic
1140928052 16:79601208-79601230 CTGGTACCCAGGTGTCTGCCGGG + Intergenic
1141560811 16:84866636-84866658 CTGCTAACCTCTGGGCAGCCTGG + Intronic
1142402746 16:89869459-89869481 CTGGGACCTGCGTGGCAGCCAGG - Intronic
1142712743 17:1732321-1732343 CTGGGCCCCACTTGGGAACCTGG - Exonic
1142902039 17:3018216-3018238 CTGGGACCCACTTGCCGCCCCGG - Intronic
1143014222 17:3883131-3883153 CTGGTCCTCCCTGGGCAGCCTGG + Exonic
1144201972 17:12949719-12949741 GGGGTACTCACTTGGAAGCCTGG - Exonic
1148895826 17:50838473-50838495 ATCGTACCCACTTGGCAGGCAGG - Intronic
1151190082 17:72391966-72391988 CTGGACCCCAGTTGGCATCCTGG - Intergenic
1151219058 17:72598401-72598423 CTGGTATCCACAGGGCATCCTGG + Intergenic
1151332078 17:73415959-73415981 CTGGTACCCCACGGGCAGCCCGG + Exonic
1152555481 17:81050958-81050980 CTGGTGCGCTCTCGGCAGCCTGG - Intronic
1156401237 18:36742271-36742293 CGGCTAGCCACCTGGCAGCCTGG - Intronic
1156481131 18:37437110-37437132 CTGCCACCCACTGGGGAGCCTGG - Intronic
1157441131 18:47712534-47712556 CTGCTACCCAGATGACAGCCTGG + Intergenic
1157782347 18:50450714-50450736 CTGGTACCCTCTTGGGATCAAGG - Intergenic
1159878924 18:73839681-73839703 CTGGCACGCTCTTTGCAGCCTGG + Intergenic
1160799893 19:962941-962963 CTGAAACCCACTTTACAGCCTGG - Intronic
1161000880 19:1910185-1910207 CTGGAACCCAGGTGTCAGCCAGG + Intronic
1161809709 19:6464772-6464794 CTGGTACCTACTTTGCCCCCAGG - Exonic
1162286595 19:9743548-9743570 CTGGTGCCCTCTTGGAGGCCTGG - Intergenic
1162571997 19:11479594-11479616 CGGATTCCCACTCGGCAGCCCGG - Intronic
1163363093 19:16860301-16860323 CTGGCAGCCGCGTGGCAGCCAGG + Intronic
1163683457 19:18696892-18696914 CTGGTTCCCACGCTGCAGCCTGG - Intronic
1163847386 19:19645389-19645411 CTGGTACCCACTGCCCACCCTGG - Exonic
1164882719 19:31748482-31748504 CTTGTCCCCACTTGGCAACATGG + Intergenic
925149414 2:1605045-1605067 CTGGTACCCCCCTGGCAGACAGG + Intergenic
926067097 2:9850866-9850888 CTGGCACACACTTGGCACCTAGG + Intronic
927131812 2:20066428-20066450 CTCCTCACCACTTGGCAGCCTGG - Intergenic
930030445 2:47055419-47055441 ATGGTACCCACTTGAGAGACGGG + Intronic
931341974 2:61410485-61410507 CTGGTACCCAATTAGGAACCAGG - Intronic
932718501 2:74120652-74120674 GTGGGACCCACTTGCCTGCCTGG + Intergenic
932988255 2:76754560-76754582 CAGGAAGCCATTTGGCAGCCAGG - Intronic
934526965 2:95057989-95058011 CTGGTACCCTCTAGAGAGCCTGG - Intergenic
936589598 2:113790613-113790635 ATGGTACTCACTTGGCAGATGGG + Intergenic
937042948 2:118835470-118835492 CTGGTCCCCACGTGTCGGCCGGG + Intergenic
937288857 2:120769943-120769965 CAGGCACCTACTTGTCAGCCAGG - Intronic
947152487 2:227129710-227129732 CTGGTACACTTTTTGCAGCCAGG + Intronic
1172176100 20:32972779-32972801 CTGGTGCCCACCTGGCATCCCGG + Intergenic
1174568884 20:51487030-51487052 CGGGTAAACACTTGGCAGCAGGG - Intronic
1178360534 21:31945629-31945651 CTTTTCCCCACTTGGCAGCTTGG + Intronic
1178624233 21:34202164-34202186 CTGGTGGCCACTCGGCGGCCGGG - Intergenic
1180292785 22:10860056-10860078 CTGGTATCCACCTGGGATCCAGG - Intergenic
1180762573 22:18221142-18221164 CTGGATCCCACCTGGCTGCCAGG - Intergenic
1180773094 22:18403466-18403488 CTGGATCCCACCTGGCTGCCAGG + Intergenic
1180804450 22:18653015-18653037 CTGGATCCCACCTGGCTGCCAGG + Intergenic
1180806301 22:18716395-18716417 CTGGATCCCACCTGGCTGCCAGG - Intergenic
1181217247 22:21342176-21342198 CTGGATCCCACCTGGCTGCCAGG - Intergenic
1181773957 22:25146495-25146517 ATGGTAACAACTTGGCAGCAAGG - Intronic
1184253119 22:43272080-43272102 CTGGTACCCACTTGGCAGCCTGG + Intronic
1184433511 22:44455758-44455780 CTGGTCTCCACTTGACACCCAGG + Intergenic
1184678529 22:46056333-46056355 CTGCTGCCTACCTGGCAGCCTGG + Intronic
1184726563 22:46350754-46350776 CTGGCACTCACCTGGCAGGCAGG - Intronic
1184742697 22:46438260-46438282 CCGGAGCCCACTTGGGAGCCTGG + Intronic
1185068364 22:48643161-48643183 CTGAGATCCACATGGCAGCCGGG - Intronic
1203234927 22_KI270731v1_random:144448-144470 CTGGATCCCACCTGGCTGCCAGG + Intergenic
949473222 3:4418314-4418336 CTGTAACCCATTTGGGAGCCTGG - Intronic
952838737 3:37626769-37626791 CTGGAACACATTTGGTAGCCAGG + Intronic
954003703 3:47577103-47577125 CTAGTGCCCACTGGGAAGCCTGG - Exonic
957084167 3:75664963-75664985 CTGGGAGCTCCTTGGCAGCCAGG + Intronic
958755454 3:98245705-98245727 CTGGTGCCCTCTTGGAGGCCTGG - Intergenic
961652103 3:128421777-128421799 CTGGTGCCCACAGGTCAGCCAGG - Intergenic
962358701 3:134716978-134717000 CTGGCACAGATTTGGCAGCCAGG - Intronic
963051008 3:141143629-141143651 TTGGGACCCACTTGCTAGCCAGG + Intronic
966259416 3:177957044-177957066 CTGTTATCCTCTTTGCAGCCAGG - Intergenic
967106500 3:186258883-186258905 CAGGAACCCCCTTGGCAGTCTGG - Intronic
968356381 3:198110799-198110821 CTGGGAGCTCCTTGGCAGCCAGG + Intergenic
969138675 4:5051143-5051165 CTGGGACTCCCTTCGCAGCCGGG + Intergenic
980714341 4:136612003-136612025 CTGGTGCCCTCTTGGAGGCCTGG - Intergenic
981251712 4:142611057-142611079 CTGGTATCCACCTGGCTTCCAGG + Intronic
984171177 4:176361189-176361211 GTGGTACCCACTGTGCAACCTGG + Intergenic
985446822 4:190026602-190026624 CTGGGAGCTCCTTGGCAGCCAGG - Intronic
986748405 5:10763360-10763382 CTGGCACCCACTTGGAAGTTTGG - Intergenic
995696479 5:114883778-114883800 CCCGGACCCACTAGGCAGCCAGG + Intergenic
997157213 5:131573584-131573606 CTGGTGCCCTCTTGGAAGCCTGG - Intronic
997234566 5:132265398-132265420 AGGGTACCCACTTGGGAGCCTGG + Intronic
1001617469 5:173054707-173054729 CTGGTACTCACTTTGCAGTAGGG + Intergenic
1003292460 6:4791583-4791605 CTGACATCCACTTGGCAGACAGG + Intronic
1006452595 6:34113766-34113788 CTGGTCCTCACATGGCAGCCAGG + Intronic
1007476788 6:42124517-42124539 CCCCTACCCACTGGGCAGCCTGG + Intronic
1010955447 6:82085959-82085981 CTGTGACACACTTGGCAGACTGG + Intergenic
1011041779 6:83037267-83037289 TTGGAACACACTTGGCAGCCTGG - Intronic
1011340516 6:86308095-86308117 CTGTTACCAACATGGCAGCAGGG + Intergenic
1017809586 6:157975260-157975282 CTGGCACCTGCTAGGCAGCCAGG - Intergenic
1018170344 6:161139219-161139241 CTGGGACCCCCTCCGCAGCCTGG - Intronic
1019137295 6:169918258-169918280 CTGGAACCCTCTGGACAGCCTGG - Intergenic
1020472629 7:8556402-8556424 CCGGAACCAACTTGACAGCCAGG - Intronic
1023834834 7:44062026-44062048 CTGGCACCCACTGAGCATCCGGG + Intronic
1024318860 7:48045583-48045605 TTGGTGCCCACTTTGCAGCTGGG + Intronic
1026011819 7:66642278-66642300 ATGGTAAGCACTGGGCAGCCTGG - Exonic
1026141857 7:67713327-67713349 CAGGTACCCACTGCTCAGCCAGG + Intergenic
1026381093 7:69800183-69800205 CTGATACCCACAAGGCAGCTGGG - Intronic
1027929347 7:84510889-84510911 CTGGTGCCCAGTTGCCTGCCTGG - Intergenic
1028201403 7:87966596-87966618 CAGGGACCACCTTGGCAGCCAGG + Intronic
1029660574 7:101958327-101958349 CTGGGCCCTACTTGGGAGCCAGG + Intronic
1029695562 7:102210945-102210967 CTGGTTCCCACCAGACAGCCAGG + Intronic
1031915652 7:127560380-127560402 CTGGCACTCACTTGGCAGGGAGG + Intergenic
1032468528 7:132161830-132161852 TGGGTACCCACGTGGGAGCCTGG - Intronic
1034908276 7:154970706-154970728 CTGGTGCCCACCAGGCAGGCAGG - Intronic
1035018535 7:155787316-155787338 CTGGGACCCTCGGGGCAGCCAGG - Intergenic
1035710290 8:1708592-1708614 CTGGAACCCACTTGTCCTCCTGG - Intergenic
1042330797 8:67578526-67578548 ATGCTGCCCACTTGGCTGCCAGG - Intronic
1043993859 8:86788665-86788687 CTGGTCCCCACCCTGCAGCCAGG - Intergenic
1045297613 8:100885775-100885797 ATGGTAGCCACCTGCCAGCCAGG + Intergenic
1045597717 8:103675270-103675292 CAGGTAGCCACATGGCATCCTGG + Intronic
1047327901 8:123857688-123857710 CTGGTACCCACTTCAGAGGCCGG - Intronic
1048580221 8:135724390-135724412 CTGGGACCCACGCTGCAGCCTGG + Intergenic
1049100473 8:140575238-140575260 CTGGCACCTCCCTGGCAGCCAGG + Intronic
1049100482 8:140575273-140575295 CTGGCACCTCCCTGGCAGCCAGG + Intronic
1049100491 8:140575308-140575330 CTGGCACCTCCCTGGCAGCCAGG + Intronic
1049347811 8:142148058-142148080 CTGGGAACCACTTGCCAGGCAGG + Intergenic
1055688355 9:78802683-78802705 CTGGTACACACCTGCCATCCTGG - Intergenic
1057056514 9:91965797-91965819 CTGGTCTCAACGTGGCAGCCGGG + Intergenic
1057495706 9:95559487-95559509 GTGTTGCCCACTTAGCAGCCTGG - Intergenic
1060880794 9:127116687-127116709 CTGGTGCCAACTTCTCAGCCTGG - Intronic
1061782670 9:133004973-133004995 CTGGGAGCCACTTGTCAGCAGGG + Intergenic
1062231628 9:135485102-135485124 CTGGATCCCACCTGGCTGCCGGG - Exonic
1203655286 Un_KI270752v1:18153-18175 TTGGTACCCAAGAGGCAGCCAGG + Intergenic
1190997431 X:55623969-55623991 CCTGTGCCCCCTTGGCAGCCAGG + Exonic
1195157596 X:102139816-102139838 CTGGTCCCCACTAGGCACTCAGG - Intergenic
1197651658 X:129072027-129072049 CAGGTCCCCACCTGGTAGCCAGG + Intergenic
1198017494 X:132625900-132625922 CTTTTATCCTCTTGGCAGCCAGG - Intergenic
1199027436 X:142956596-142956618 CAGGAACCCACTAGGAAGCCTGG - Intergenic