ID: 1184253762

View in Genome Browser
Species Human (GRCh38)
Location 22:43275768-43275790
Sequence CAGGGAGAACAACAGGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 586
Summary {0: 1, 1: 0, 2: 5, 3: 45, 4: 535}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184253756_1184253762 14 Left 1184253756 22:43275731-43275753 CCGAGGTTGTAATCAGTAAAGGG 0: 1
1: 0
2: 0
3: 6
4: 79
Right 1184253762 22:43275768-43275790 CAGGGAGAACAACAGGCAGATGG 0: 1
1: 0
2: 5
3: 45
4: 535

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184253762 Original CRISPR CAGGGAGAACAACAGGCAGA TGG Intronic
900152203 1:1183591-1183613 GAGGGAGCACAGCAGGCAGAGGG - Intronic
900266515 1:1759922-1759944 CAGGGAGGGCACCAGGCAGCGGG + Intronic
900357093 1:2270261-2270283 CAGGGAGGATAACACGCAGCAGG - Intronic
900575479 1:3380313-3380335 CAGGGGGCCCACCAGGCAGAGGG + Intronic
901031252 1:6308197-6308219 AAGGAACAGCAACAGGCAGAGGG + Intronic
901031297 1:6308423-6308445 AAGGAACAGCAACAGGCAGAGGG + Intronic
901031339 1:6308634-6308656 AAGGAACAGCAACAGGCAGAAGG + Intronic
901031342 1:6308653-6308675 AAGGAACAGCAACAGGCAGAGGG + Intronic
901102022 1:6726374-6726396 CAGCGTGGACAACAGGGAGAGGG - Intergenic
902094343 1:13930342-13930364 CAGGGTGAACCACCAGCAGAGGG + Intergenic
902169977 1:14602073-14602095 CAGGGATGACAACGGGCAGTAGG + Intronic
902800519 1:18826777-18826799 GATGGAGATCAGCAGGCAGATGG + Intergenic
903164666 1:21511737-21511759 GAGGCACAAGAACAGGCAGAGGG - Intronic
903216420 1:21846029-21846051 CAGGGGGCAGAACTGGCAGAAGG - Intronic
903552320 1:24166514-24166536 AAGGCAGAAGAAAAGGCAGATGG - Intronic
903577019 1:24345360-24345382 CAGGGAGAAAAGCAGGCTGGGGG - Intronic
903862663 1:26374287-26374309 GAGGGAGCACAGCTGGCAGATGG - Intronic
904365283 1:30007217-30007239 CAGGGAGAAAAGCAGGCATCTGG - Intergenic
904849055 1:33443486-33443508 CAGGGAGAACAGCAGGTAGAGGG + Intergenic
904942137 1:34171272-34171294 CAGAGAGAACAAAACACAGAAGG - Intronic
905875905 1:41432009-41432031 CAGGGAGAACACCAGGAATGGGG - Intergenic
906035354 1:42747293-42747315 CAGGGTGAACCACAGGGCGATGG + Exonic
907242898 1:53090486-53090508 CTCGGAGCACAGCAGGCAGAGGG - Intronic
907421880 1:54353143-54353165 CAGGGAGGACAACTCTCAGAGGG + Intronic
907745177 1:57206225-57206247 CAGGGAGAAAAGGAGGGAGAGGG + Intronic
909813658 1:79962805-79962827 GATGGAGAGCAAGAGGCAGAAGG + Intergenic
909970265 1:81975818-81975840 AAATGAGAACAAGAGGCAGAGGG - Intronic
911091353 1:94019708-94019730 CATGGAGAAAATCACGCAGATGG + Exonic
911875157 1:103152479-103152501 AAGGGAGATCAACACACAGATGG + Intergenic
911972897 1:104460134-104460156 AAGTGAGATCAACAGCCAGATGG - Intergenic
913148210 1:116013217-116013239 CTTGGGGAACAACAGGGAGAAGG - Intronic
914775524 1:150730542-150730564 TGGGGAGAACAGCAGGCAGAAGG + Exonic
915162470 1:153930145-153930167 AAGCGAGGACAACAGGAAGAGGG - Exonic
915319173 1:155046907-155046929 AGGGGAAAAGAACAGGCAGAAGG - Intronic
915949847 1:160181877-160181899 GAGGGAGAAGAAAAGGCAGGGGG - Intronic
916547973 1:165824592-165824614 CAGGGAGTACAGAATGCAGATGG + Intronic
917001712 1:170367930-170367952 CAAGGAGAACAAGAGGAGGATGG - Intergenic
917173738 1:172207561-172207583 CAGGGAGAGCAACAGGAGAAAGG + Intronic
919846659 1:201647252-201647274 GAGGGGGAACAAGAGCCAGATGG - Intronic
920063262 1:203244044-203244066 TAGGGAGAAGAAGAGGTAGAAGG + Intronic
920198804 1:204246646-204246668 CTGGGTGAAGAAAAGGCAGAGGG + Intronic
920398333 1:205662065-205662087 CAGAGAGAAGACCAGGGAGATGG + Exonic
921747644 1:218755369-218755391 AAGTGAGAGCAATAGGCAGATGG - Intergenic
922412728 1:225391712-225391734 CAGGGAGAGGAGCAGGCTGATGG + Intronic
922547941 1:226472656-226472678 CACTGAGAACTACAGGCAGGAGG + Intergenic
923079462 1:230640119-230640141 TAGGGAGGACAGCAGGCAGCAGG + Intergenic
923554664 1:234991209-234991231 CATGGAGAGTGACAGGCAGAGGG - Intergenic
924151383 1:241133916-241133938 CAGGGAGAGAGAGAGGCAGAGGG + Intronic
924643756 1:245857971-245857993 CAGGGAGGACAGCAGGGAGACGG - Intronic
924775689 1:247113273-247113295 CAGTGGGAAAAACAGGCACAGGG + Intergenic
1062851074 10:743987-744009 CAGTGGCAACAACAGCCAGAAGG + Intergenic
1063281885 10:4638385-4638407 GAGGCAGAACAACATTCAGAAGG - Intergenic
1063625811 10:7689019-7689041 CCGGGAGAACAACACACACACGG + Intergenic
1063890655 10:10624866-10624888 CAGGGACACAAAGAGGCAGATGG + Intergenic
1064804762 10:19118418-19118440 AAGGCAGAACAACTGGAAGAGGG + Intronic
1065432822 10:25676648-25676670 CAAAGAGCACAAAAGGCAGAGGG - Intergenic
1065512074 10:26489286-26489308 CAGGGAGCAGAACATTCAGATGG + Intronic
1065643326 10:27807159-27807181 TAGAGAGAAAAAGAGGCAGAAGG - Intergenic
1066632401 10:37469895-37469917 CATGGAGGACCACAGGCAGCTGG - Intergenic
1067292778 10:44956477-44956499 CAGGGAGAAGGAGAGGCAGTAGG + Intergenic
1067471619 10:46542149-46542171 CAGAGAGAAGGCCAGGCAGAAGG + Intergenic
1067663411 10:48253435-48253457 CATGGAGACCAAAAGGCAGTTGG + Intronic
1068077245 10:52271550-52271572 CAGTGAGCACAAGTGGCAGAGGG - Intronic
1069083189 10:64110301-64110323 CAGGGAGAAAAACAGAGACAAGG + Intergenic
1069705064 10:70453851-70453873 GAGGGATAACAAAGGGCAGAAGG + Intergenic
1069918903 10:71804220-71804242 CAGCAGGAACAACAGACAGATGG - Intronic
1069926182 10:71852316-71852338 CAGGGGCAGCCACAGGCAGAGGG - Intergenic
1070959311 10:80487775-80487797 TGGGGAGAATGACAGGCAGACGG - Intronic
1071000875 10:80828885-80828907 CAGGGAATACAACAGTCAGTTGG + Intergenic
1071183439 10:83013493-83013515 CAGAGAGCACCACGGGCAGAGGG + Intergenic
1072238494 10:93473561-93473583 CAGGGAGAAGCAGAGGCAGGAGG + Intronic
1072487597 10:95870947-95870969 CAAGGAGAACAAGAGGTATATGG - Exonic
1072742066 10:97915485-97915507 CTGGGAGGAAAGCAGGCAGAAGG - Intronic
1073070976 10:100793138-100793160 CGGGGACAGCACCAGGCAGAGGG + Intronic
1073096311 10:100982210-100982232 CAGAGGGAGCAGCAGGCAGAGGG + Intronic
1073165603 10:101446907-101446929 CAGAGAGCACAATAGGGAGAAGG + Intronic
1073262817 10:102203463-102203485 CAGGGAGATCAAGGGGCAGCAGG - Intergenic
1073770670 10:106731905-106731927 CAGGGAGGACAAGAGGAAGGAGG + Intronic
1074427918 10:113368517-113368539 CAGAAAGAACCACAGTCAGAGGG - Intergenic
1074924676 10:118055470-118055492 CAGGGAGAAGGATAGGGAGATGG + Intergenic
1075337614 10:121619657-121619679 CAGGGAGACCAACAACCTGAGGG + Intergenic
1078040774 11:7860936-7860958 CAGAGGGAACAGCAGGCTGAGGG + Intergenic
1078531919 11:12143184-12143206 CAGGCAGAAAAGGAGGCAGACGG + Intronic
1079567933 11:21905698-21905720 CAAGGAGAACATCAGAAAGAGGG - Intergenic
1081623983 11:44635690-44635712 CAGGGAGATCAGAAGGCAGCAGG + Intergenic
1081942809 11:46958869-46958891 CACGCAGAACAAAAGGCAGAGGG - Intronic
1082609745 11:55282454-55282476 CAGGGAGAGAAGAAGGCAGAGGG - Intergenic
1082656938 11:55868071-55868093 CAGGGAGAGAAGAAGGCAGAGGG + Intergenic
1082894303 11:58173765-58173787 CAGGAAGAACGGCAGGCACATGG - Intronic
1083048034 11:59754180-59754202 CAGCGAGCACAGCGGGCAGAAGG + Intronic
1083065038 11:59915572-59915594 CAAGGAGAATTCCAGGCAGAAGG - Intergenic
1083118703 11:60490858-60490880 CAGGGAGAGGGACAGGGAGAGGG - Intergenic
1083759188 11:64806519-64806541 CAGGGAGGAGACCAGGTAGAAGG - Intronic
1084323866 11:68388060-68388082 GCGGGAGCACAGCAGGCAGAGGG + Intronic
1084972532 11:72779744-72779766 CAGAGGGAAAAACAGTCAGATGG + Intronic
1084977954 11:72813751-72813773 CTGGGAGGACAGGAGGCAGAAGG - Intergenic
1085040530 11:73323959-73323981 CAGGGAGGAGAACAGGGAGAAGG - Intronic
1085046527 11:73356827-73356849 CAGGGAGACCTGCAGGTAGAGGG - Intronic
1085955941 11:81395177-81395199 CAGGGAGAAACAAAGGCAAATGG + Intergenic
1085959998 11:81450503-81450525 CAGGAGGAACAAGAGGGAGAGGG + Intergenic
1087663253 11:101012215-101012237 AAAGGAGAACAACTGGCATAGGG - Intergenic
1087788758 11:102384936-102384958 CAGGCAGACAAACAGGCAGCTGG - Intergenic
1088582741 11:111331348-111331370 AAGGGAGAAGAAGAGGGAGAGGG - Intergenic
1088728995 11:112664217-112664239 CAGGGAGAGGAAGAGGGAGAGGG + Intergenic
1088923094 11:114276072-114276094 CAGGGAGAAAACGAGGCAGTCGG - Intronic
1089178966 11:116567766-116567788 GAGGGAGAAGACCAGGCAGCTGG + Intergenic
1089535529 11:119158660-119158682 CATGGAGAAGAAGAGGCAGCCGG - Exonic
1089566613 11:119375123-119375145 CAGCGAGAGAAACAGGCAGTGGG + Intronic
1089658000 11:119965737-119965759 CATGGAGAAAAACAGTCATATGG + Intergenic
1089680762 11:120117699-120117721 CTGGGAGCACCACAGGCAGGCGG + Intronic
1090029718 11:123196114-123196136 CAGAAAGAACATAAGGCAGAGGG + Intergenic
1090037724 11:123263440-123263462 CAGGGGGAACAGCTGTCAGAGGG - Intergenic
1090827450 11:130397728-130397750 TAGGGATAACAAGAGGGAGAGGG + Intergenic
1091254518 11:134172167-134172189 CAGAGAGCGCAAGAGGCAGATGG - Intronic
1202806684 11_KI270721v1_random:9340-9362 GAGGGAGAACAACACGCGGGCGG - Intergenic
1091563864 12:1633711-1633733 CTGGGAGAATGTCAGGCAGAAGG - Intronic
1091590257 12:1838490-1838512 CAGGGAGAGGAAGTGGCAGAAGG + Intronic
1091631761 12:2166834-2166856 CAGGGAGAAGACTAGGCAGCAGG + Intronic
1091769563 12:3142210-3142232 GAGGGAGGACAGCAGGCAGCGGG - Intronic
1092055174 12:5502966-5502988 CAGGGATTACAACAGGAAGAAGG + Intronic
1092171090 12:6374550-6374572 CTGGGAGCACACCAGGCGGATGG + Exonic
1093434651 12:19122625-19122647 CATGGAGAATAAAAGGAAGAAGG - Intergenic
1095391208 12:41708768-41708790 CAGGAATAAAAACATGCAGAAGG + Intergenic
1096446661 12:51699208-51699230 CAGGGAGCATTCCAGGCAGAGGG + Intronic
1097987255 12:65797147-65797169 AAGGGAAAAAAACATGCAGATGG - Intergenic
1097996785 12:65896547-65896569 CAGGGAGAAGAGGAGGAAGAAGG - Intronic
1098149609 12:67532958-67532980 CAAGTAGAAGAACAGCCAGAAGG + Intergenic
1098192866 12:67968628-67968650 CTGGTAGAATAACAGGCAGTAGG - Intergenic
1098484703 12:71007051-71007073 CAGGGAAAACAGCAGGCACCAGG + Intergenic
1098635944 12:72783678-72783700 CATGGACAACAACAGAAAGAAGG + Intergenic
1099245255 12:80186436-80186458 CAGGGAGACCAAAGAGCAGAGGG - Intergenic
1099354817 12:81621072-81621094 CAGGGAGAAAATCAGAGAGAAGG + Intronic
1099791618 12:87342672-87342694 CATCAACAACAACAGGCAGAAGG - Intergenic
1100122240 12:91382300-91382322 CAGGTAGAACAAAAGGGAGTGGG + Intergenic
1100194307 12:92226949-92226971 CAGGGACAACACCAGGGAGATGG - Intergenic
1100684146 12:96967271-96967293 CAGGGTGAACTAGAGGTAGAAGG - Intergenic
1101150920 12:101881627-101881649 CAGGGAGAACACCTGGCAGAGGG - Intronic
1101955716 12:109211087-109211109 CAGGAAGGCAAACAGGCAGAGGG - Intronic
1102108723 12:110348076-110348098 CAGCCAGACCAACAGGCTGAAGG + Intronic
1102238581 12:111309953-111309975 CAGGGAGAAAAAGAACCAGAGGG - Intronic
1102919435 12:116780707-116780729 GAGGGAAAACAACAGGCCTAGGG + Intronic
1103204317 12:119116457-119116479 AAGGGAGAACAGCAGACAGAAGG + Intronic
1103244695 12:119446586-119446608 CAGGAAGAAAAAAAGGGAGAGGG + Intronic
1103410187 12:120705922-120705944 CAGGGAGGAAAACAGCCAGCGGG + Intergenic
1103462536 12:121116545-121116567 CAGAGAAAACCAGAGGCAGAGGG - Intergenic
1103955723 12:124575778-124575800 GAGAAAGCACAACAGGCAGAGGG + Intergenic
1104030988 12:125065650-125065672 CAGTAAGAAGAACACGCAGATGG + Exonic
1104246322 12:127045440-127045462 CAAGGAGACCCACAGTCAGATGG + Intergenic
1104276828 12:127336728-127336750 CAGGGAGAGCAACAGGAAGGTGG + Intergenic
1104854055 12:131894174-131894196 GAGGGAGGAGAACAGGCAGTGGG + Intergenic
1104969411 12:132524419-132524441 CAGGGTGCACACAAGGCAGACGG - Intronic
1105977008 13:25481193-25481215 CAGGGAGAGGAACAGGGACAGGG + Intronic
1106896657 13:34310121-34310143 CAGTGGGAAGAACAGGTAGAAGG + Intergenic
1107394243 13:39998793-39998815 CAGGCAGAACAACTGGGAGAGGG - Intergenic
1107827499 13:44342026-44342048 CAGAGAGAACAAAAAGCAGGAGG + Intergenic
1107858314 13:44636689-44636711 CAGGGAGCACAACTGACTGATGG - Intergenic
1110413545 13:75228441-75228463 CTGGGAGAACTACACTCAGAGGG - Intergenic
1112060005 13:95729362-95729384 GAGGGAGAAGGATAGGCAGAGGG - Intronic
1112433120 13:99370476-99370498 AGGGAAAAACAACAGGCAGAGGG - Intronic
1112561722 13:100521280-100521302 CAAGGGGAGCACCAGGCAGACGG + Intronic
1112589326 13:100749261-100749283 CAGGGAGAGTGAGAGGCAGAAGG - Intergenic
1113368923 13:109705283-109705305 GAGAGAGAACAAGAGGCATAAGG + Intergenic
1113778758 13:112963781-112963803 CAGGGAGAGATACAGGGAGACGG + Intronic
1113937184 13:114000664-114000686 AAGGGAGAACCAGAAGCAGAGGG + Intronic
1115364685 14:32544560-32544582 TGGGGAGAAAAACATGCAGAGGG + Intronic
1115463269 14:33685531-33685553 CAGAAAAAGCAACAGGCAGAGGG - Intronic
1115736410 14:36335206-36335228 AGGGGAGAACAATTGGCAGAAGG - Intergenic
1116510376 14:45737917-45737939 GAGAGAGAGCAACAGACAGATGG + Intergenic
1117527129 14:56620106-56620128 GAGGGAGAACAACAGACACTGGG + Intronic
1118816958 14:69320669-69320691 CAGAGAGGACCACAGGCAGGAGG - Intronic
1121247306 14:92471277-92471299 CAAGGAGGACAAAGGGCAGAAGG + Intronic
1121629759 14:95413613-95413635 CAAGGAGAATGACAGGCAGAGGG - Intronic
1121677600 14:95766825-95766847 AAGGGAAAACAATGGGCAGAAGG - Intergenic
1122987867 14:105220930-105220952 CACACAGAGCAACAGGCAGAGGG - Intronic
1123028084 14:105438032-105438054 CAGGGACAGCAACAGGCAGCAGG - Intronic
1123680897 15:22762792-22762814 CAGGGAGAACAGCTGGAATACGG - Intergenic
1124435607 15:29646533-29646555 CAGGTAGAAGAGAAGGCAGAAGG - Intergenic
1124653281 15:31488154-31488176 AAGGGTAAACACCAGGCAGAAGG + Intronic
1125454252 15:39841512-39841534 CAGGAAGACCCACAGGAAGAAGG + Intronic
1125716550 15:41822913-41822935 CAGGGAGAACATGTGGGAGAAGG - Intronic
1126375632 15:47994160-47994182 CAGGGAGAAAAAGAAGGAGAAGG + Intergenic
1126603397 15:50451629-50451651 CAGGGAGAAAAACAGTGAAAAGG - Intronic
1127809248 15:62549172-62549194 CAGGGAGCCCTACAGGAAGAAGG - Intronic
1127851046 15:62911993-62912015 CAGCTAGCACCACAGGCAGATGG - Intergenic
1128142710 15:65313459-65313481 CAGGGAAAAGAACATGAAGATGG - Intergenic
1128478918 15:68020583-68020605 CAGGCAGAGCAGAAGGCAGAAGG - Intergenic
1128534639 15:68481406-68481428 CATAGAGAAAGACAGGCAGAAGG - Intergenic
1128729158 15:70009155-70009177 CAGGGGGAAGAAGAGGCAGAAGG - Intergenic
1129903244 15:79167889-79167911 CAGGGAGCATAACTGACAGAAGG + Intergenic
1130322414 15:82852207-82852229 CAGTGAGATCAACAGAGAGAAGG - Exonic
1130669252 15:85895974-85895996 CAGAGAGAAGAAGGGGCAGAGGG - Intergenic
1130987546 15:88854629-88854651 TAGGGAGAAAAGAAGGCAGAAGG - Intronic
1131513861 15:93064825-93064847 CATGGTGAGCAAGAGGCAGAGGG + Intronic
1131629488 15:94161329-94161351 CAAGGAACACAACAGCCAGAGGG - Intergenic
1132211543 15:100027073-100027095 CAGGGTGAACAACAGTCGGGAGG + Intronic
1132478557 16:154279-154301 CAGGGTGACCAGCAGGCAGTGGG - Exonic
1132480735 16:165035-165057 CAGGGTGACCAGCAGGCAGTGGG - Intronic
1132748483 16:1446760-1446782 CAGGGAGCTCCACAGGCAGGCGG - Intronic
1132847416 16:2006914-2006936 CAAGGAGAGCAAGAGGCAAATGG + Intronic
1133231707 16:4370031-4370053 GGGGGTGAACACCAGGCAGATGG + Intronic
1133485389 16:6214617-6214639 GAGGGAGAAAGACAGGGAGAGGG + Intronic
1134081025 16:11325083-11325105 CAGGGGGAAGAGCAGGCAGAAGG + Intronic
1135516661 16:23141295-23141317 CAGGAAGAATAAAATGCAGAAGG - Intronic
1136002400 16:27304842-27304864 AGGGGAGAGCAAGAGGCAGAAGG - Intergenic
1136296841 16:29308785-29308807 CAGGCAGAGGGACAGGCAGAGGG - Intergenic
1136375182 16:29861189-29861211 CAGGTTGACCAACAGGCACATGG + Exonic
1136912111 16:34152955-34152977 CAGTGAGAGAGACAGGCAGAGGG - Intergenic
1138153982 16:54685917-54685939 GAGGGAGAAGAAGAGGAAGAAGG - Intergenic
1138535761 16:57659544-57659566 CAGGGAGAAGTGCAGGAAGATGG - Exonic
1138779572 16:59766816-59766838 AAGGGAGACCTACAGGCAGAAGG - Intergenic
1138908865 16:61372051-61372073 GAGGAAGAACAACAGACAGTGGG - Intergenic
1139320067 16:66107121-66107143 CAGGGACTCCAACAGGCAGAGGG - Intergenic
1139654392 16:68378536-68378558 CAGGGAGGACTGCAGGGAGAAGG - Intronic
1140320645 16:73948424-73948446 CAGAGAGAACAATAGGAAAAAGG + Intergenic
1140629999 16:76840367-76840389 CAAAGGGAACAACAGGCACAGGG - Intergenic
1140890541 16:79281037-79281059 CAGGGAGAAAAAGAGACAGAAGG + Intergenic
1142024494 16:87805139-87805161 CTGGGTGAGCCACAGGCAGATGG - Intergenic
1142058454 16:88015103-88015125 CAGGCAGAGGGACAGGCAGAGGG - Intronic
1142058457 16:88015115-88015137 CAGGCAGAGGGACAGGCAGAGGG - Intronic
1142270377 16:89085938-89085960 CCGTGAGGACGACAGGCAGATGG - Intergenic
1142693640 17:1621524-1621546 CAGAGCAAACAACAGGCAGGAGG + Intronic
1142745625 17:1956184-1956206 CAGGCAGCTCAGCAGGCAGAGGG + Intronic
1143580700 17:7824086-7824108 CAGGTATAGCATCAGGCAGAAGG - Intronic
1143865357 17:9919148-9919170 AAGGGTGAACAACAGGCGGCAGG - Intronic
1144526526 17:15995087-15995109 CAGGCACAAAAACAGGCAGAAGG + Intronic
1145047472 17:19628895-19628917 CAGGGAGAGGGACAGGGAGAGGG + Intergenic
1145056650 17:19707658-19707680 CAGGGTGGTCAGCAGGCAGAGGG - Intronic
1145840431 17:27989697-27989719 CAGGGAGAACAGAAGGCAAGTGG - Intergenic
1147406764 17:40217999-40218021 CAGGGAACACAGCAGGCATAGGG - Intergenic
1147599979 17:41739461-41739483 CATGGAAGACAGCAGGCAGAGGG - Intergenic
1148749846 17:49939261-49939283 CATGAGGAACAACAGGCTGAGGG + Intergenic
1148773574 17:50080419-50080441 GGGGGAGAACAACAGGGAGAGGG + Intronic
1149278319 17:55071092-55071114 CAGGGAGAAGAAAAAGGAGATGG - Intronic
1149389277 17:56173281-56173303 CAGGGGGAACAGAAGGCAAAGGG - Intronic
1149393463 17:56215489-56215511 AAGGGACAAGAACAGGAAGATGG + Intronic
1149865050 17:60146945-60146967 CAGAGAGAATATCAGGCAGAGGG - Intergenic
1151305981 17:73262878-73262900 CACGGGGAACAACAGCCAGCAGG - Intergenic
1151725628 17:75882116-75882138 CAGGGAGGACAGCAGGCTGTGGG - Intronic
1151758520 17:76088089-76088111 CAAGGAGTACAACATGCCGAAGG - Exonic
1151873257 17:76850886-76850908 CAGTTAGAGGAACAGGCAGAGGG + Intergenic
1151924104 17:77181189-77181211 CAGGGAGAGCATCAGCAAGAGGG - Intronic
1151941069 17:77292284-77292306 GATGGAGACCAACAGGTAGAGGG - Intronic
1152222821 17:79078456-79078478 GAGGGAGCACAGCAGGCAGGGGG + Intronic
1152243067 17:79170239-79170261 CACGGAGAACAACAGGTTAACGG + Intronic
1152698834 17:81809208-81809230 CAGGCAGACAGACAGGCAGATGG - Intronic
1152698845 17:81809288-81809310 CAGGCAGACAGACAGGCAGACGG - Intronic
1152698866 17:81809427-81809449 CAGGCAGACGGACAGGCAGACGG - Intronic
1152698876 17:81809487-81809509 CAGGCAGACGGACAGGCAGACGG - Intronic
1152698885 17:81809539-81809561 CAGGCAGACAGACAGGCAGACGG - Intronic
1153055553 18:942593-942615 CAGTGAGAAGAACAGCCAGAAGG + Intergenic
1153448211 18:5197084-5197106 AAGAGAGAAAGACAGGCAGACGG + Exonic
1153451792 18:5238189-5238211 CAGGGAGAACAACGAGCTTACGG + Intergenic
1153660416 18:7320864-7320886 CAGGGAGACGAACACACAGATGG - Intergenic
1153780811 18:8493606-8493628 CAGTGAGAGCACCAGGCAAAGGG - Intergenic
1154519883 18:15215594-15215616 TATGGAGAACAAAAAGCAGAAGG - Intergenic
1155363509 18:25027832-25027854 TAGGGAAAACAAAAGGAAGAAGG + Intergenic
1155505592 18:26529512-26529534 CAGAGAGAGCAACAGAGAGAAGG - Intronic
1155688045 18:28579827-28579849 AAATGAGAAAAACAGGCAGAAGG - Intergenic
1158359176 18:56652035-56652057 AAGGGATAAGAACTGGCAGATGG - Intronic
1158674687 18:59507480-59507502 AAGGAAGAACATGAGGCAGAAGG - Intronic
1158744998 18:60189452-60189474 CAGAAAGAATCACAGGCAGATGG + Intergenic
1158900407 18:61957151-61957173 CAGGGTGGACAACTGGCAGAAGG - Intergenic
1160105862 18:75975585-75975607 CAGAGAGAAAAAGAGACAGAGGG + Intergenic
1160599981 18:80005155-80005177 CTGGGGGAACAGCATGCAGAGGG + Intronic
1163062583 19:14771173-14771195 CAGGGAGAACAGGAGGGACAGGG + Intronic
1163122729 19:15227683-15227705 CAGGCAGACAGACAGGCAGAAGG + Intronic
1163580343 19:18135059-18135081 CAGGGAGAGAAGCAGGAAGAGGG + Intronic
1164628514 19:29745541-29745563 CCCAGAGAACCACAGGCAGAGGG + Intergenic
1164881034 19:31732982-31733004 GTGGGAGAACACCAGGCACAGGG - Intergenic
1165649970 19:37477848-37477870 CATTCAGAAAAACAGGCAGAGGG - Intronic
1166140306 19:40801815-40801837 CAGGGACACAAACACGCAGAAGG - Intronic
1166550561 19:43663138-43663160 AAGGGGGAAACACAGGCAGAGGG - Intronic
1166852949 19:45769049-45769071 AAGGGAGAATCACAGACAGACGG - Exonic
1167080945 19:47275633-47275655 CAGGGAGGTGAAGAGGCAGATGG - Exonic
1167421657 19:49407465-49407487 AAGGGAGAGCACCGGGCAGAAGG - Intronic
1167685543 19:50953421-50953443 GAGGGAGAACCACAGAGAGATGG - Intergenic
1167706388 19:51083642-51083664 CAGGGAACAGAAGAGGCAGACGG + Intronic
1167749753 19:51372476-51372498 CAGGCAGAACATCAGGCCCAGGG + Exonic
1168613675 19:57820842-57820864 TGGGGAGAGCAACAGGCACAGGG + Intronic
925032292 2:660289-660311 CAGGAAGTACAACAGCAAGATGG + Intergenic
925081983 2:1077744-1077766 CAGAGAGATCAACAGTCACAGGG - Intronic
925178022 2:1798451-1798473 CAGAGAGAACATCAGGCCGTGGG + Intronic
926746378 2:16161796-16161818 CACGGGGAACTACAGACAGATGG - Intergenic
927374294 2:22395559-22395581 CAGGGTGAACAAAAGATAGAAGG + Intergenic
927436690 2:23072446-23072468 CAGATAGAAAAACAAGCAGATGG - Intergenic
927940950 2:27102476-27102498 CAGGGAGAAGACCAGGCCCAGGG - Intronic
929018535 2:37526687-37526709 CTGGGAGATGAACAGGGAGACGG + Intergenic
929598179 2:43189027-43189049 GAGGGAGAAACCCAGGCAGAAGG - Intergenic
929965880 2:46536425-46536447 CAGGGAGAAAAATAGGGATAGGG + Intronic
930745017 2:54873592-54873614 TATGGAGAACAAAAAGCAGAAGG - Intronic
931137250 2:59416801-59416823 AAAGGAGAACAAAAGGAAGAAGG + Intergenic
931291640 2:60879515-60879537 CTGGGGGAACAGCAGGCAGCAGG - Intergenic
931835408 2:66093825-66093847 TAGAAAGAACAAGAGGCAGAAGG + Intergenic
933082425 2:78007300-78007322 CAGGGAGCACATCAGCAAGATGG - Intergenic
933496239 2:83053596-83053618 GAGGAAGAAGAAGAGGCAGAAGG + Intergenic
933774708 2:85765135-85765157 CAGGGAGAGCAACAGAGAGTGGG + Intronic
933902708 2:86861313-86861335 CAGGGAGAACGGGAGCCAGAGGG + Intronic
935310506 2:101778459-101778481 CAGGGTGGACAGCATGCAGAAGG + Intronic
935320547 2:101884033-101884055 CAGGGGGAGCAAGAGGCAGACGG + Intronic
935705799 2:105856136-105856158 CTGGGAAAACAAGAGGCACATGG - Intronic
935777840 2:106487955-106487977 CAGGGAGAACGGGAGCCAGAGGG - Intergenic
935868245 2:107415924-107415946 CAGAGAGAAAACCAGGCAGATGG - Intergenic
936283137 2:111160109-111160131 CAGCAAGGCCAACAGGCAGAAGG - Intronic
936663333 2:114566727-114566749 CAGGAAGAACACCAGGCAGGTGG + Intronic
936877861 2:117213980-117214002 AAGGCAGAAAAACAGGCCGAGGG - Intergenic
937767595 2:125680015-125680037 TATGGAGAACAACTGGCAGTGGG + Intergenic
938561612 2:132477026-132477048 GAGGCAGAAGAGCAGGCAGAGGG - Intronic
938938701 2:136149700-136149722 CAGTGTGAACAACTGGCTGAGGG + Intergenic
940805993 2:158187057-158187079 CAAGGAGAACATCAAGCAGCTGG - Intronic
941416862 2:165231705-165231727 CAGAGAGAACAAAAAGAAGAGGG - Intergenic
944473413 2:200079819-200079841 CAAGGTGGACAAAAGGCAGAAGG + Intergenic
945797185 2:214379262-214379284 CAGGAAGAAAAAGAGACAGATGG + Intronic
945902668 2:215556491-215556513 TAGGTAGAACCACAGTCAGATGG - Intergenic
946430202 2:219622166-219622188 CTGGAAGAACAAAAGGCAGAAGG + Intergenic
946704346 2:222443577-222443599 CAGCGAGAAGAAATGGCAGAGGG - Intronic
947243108 2:228017832-228017854 CAGTGAGATCAAGAGGAAGACGG - Exonic
947856875 2:233330098-233330120 GTGTGGGAACAACAGGCAGAAGG - Intronic
948134807 2:235628495-235628517 CAGGCAGAAGAACAAGCAGGTGG + Intronic
948756990 2:240165695-240165717 CAAGGAGCACAGCAGGCAGCAGG + Intergenic
948814015 2:240500489-240500511 CAGGGAGAAAAGGAGGCAGTGGG - Exonic
948939123 2:241187500-241187522 GAGGGATTTCAACAGGCAGAAGG + Intergenic
1168978200 20:1983666-1983688 CAGGGAGGCCAGCAGGGAGAGGG - Intronic
1169428309 20:5513099-5513121 AAGGGAGAACAACAGGCAGGTGG + Intergenic
1169890554 20:10447252-10447274 CGGGCAGACAAACAGGCAGAGGG - Intronic
1170003995 20:11646471-11646493 CAGGGAGGACACCAGGGAGGAGG + Intergenic
1170731103 20:18975442-18975464 AAGGGAGAAAAAGAGGAAGAGGG - Intergenic
1170954721 20:20968637-20968659 CTGGGAGAACAACAGGGTGGGGG + Intergenic
1171318050 20:24212824-24212846 TAGGGAAAACAGCAGGCAGTAGG + Intergenic
1171769120 20:29308310-29308332 CAGTGAGAGAAACAGGCAGAGGG + Intergenic
1171812301 20:29754782-29754804 AAGTGAGAGAAACAGGCAGAAGG + Intergenic
1171907416 20:30911112-30911134 CAGTGAGAGAGACAGGCAGAGGG - Intergenic
1172184117 20:33020746-33020768 CAGGCAGAGTATCAGGCAGATGG - Intronic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1173503083 20:43567433-43567455 CAAGTTAAACAACAGGCAGAGGG - Intronic
1173579381 20:44136373-44136395 CAGGGAGCAGAATAGGCAAAGGG - Intronic
1174083164 20:47985124-47985146 TAGGGAGGTCAAGAGGCAGAGGG - Intergenic
1175206894 20:57317971-57317993 CAGGGGGCACAAGGGGCAGAAGG - Intergenic
1175206988 20:57318643-57318665 CAGAGAGAACAGCACGCACAAGG - Intergenic
1175520690 20:59600785-59600807 CAAGGAGATCAAGGGGCAGAAGG + Intronic
1175571525 20:60026424-60026446 GAGGGAGAAGAGGAGGCAGAAGG + Intronic
1175659696 20:60802027-60802049 CTGGGAGAGCAACAGCCAGCCGG - Intergenic
1175693461 20:61083209-61083231 CATGGAGGACAACAGGGAGGGGG - Intergenic
1175738880 20:61406620-61406642 CAGGCAGAACAGATGGCAGATGG - Intronic
1175948226 20:62568570-62568592 CAGGGAGATGAAAAGACAGATGG - Intronic
1176108316 20:63399755-63399777 CAGGGAGACAGACAAGCAGACGG + Intergenic
1176376704 21:6090360-6090382 CAGGGAGAGCCACATGGAGAGGG + Intergenic
1177357755 21:20031191-20031213 CAAGGAGAACAGAAGACAGATGG - Intergenic
1177544127 21:22534634-22534656 CAGAGAGAAAAAAAGGCTGAAGG - Intergenic
1178947548 21:36960501-36960523 CGGGCAGAGCATCAGGCAGATGG - Intronic
1179284112 21:39961932-39961954 CAAGGATCAGAACAGGCAGAGGG - Intergenic
1179309760 21:40185261-40185283 AAGGGAGGACTCCAGGCAGAGGG + Intronic
1179746771 21:43447884-43447906 CAGGGAGAGCCACATGGAGAGGG - Intergenic
1180340838 22:11617254-11617276 CAGTGAGAGAGACAGGCAGAGGG - Intergenic
1180597280 22:16986427-16986449 CAGGGAGAACCACAGGTAACAGG + Intronic
1180612122 22:17104841-17104863 CTGGGAGAACAAGTGGCTGAAGG + Intronic
1181009958 22:20034473-20034495 CAGAGAGAACTTCAGGCACAGGG + Intronic
1181182684 22:21078741-21078763 AAGGGAGGACAGCAGGCTGAGGG - Intergenic
1181477507 22:23177928-23177950 CAGGTAGAACTACAGGCACGAGG + Intergenic
1181744326 22:24945301-24945323 CTGGGTGGAGAACAGGCAGAAGG + Intronic
1182356752 22:29725635-29725657 CAGGGAGGGCACCAGGGAGATGG + Intronic
1183078857 22:35443610-35443632 GAGGGAGAAGTCCAGGCAGAAGG - Intergenic
1183086973 22:35492321-35492343 CAGGGAGCACACCAGACACAGGG - Intergenic
1183222696 22:36527109-36527131 CAGGCAGAAGAACTGCCAGAGGG + Intronic
1183278145 22:36914243-36914265 CAGAGAGACTAAGAGGCAGAGGG + Intronic
1183440907 22:37822614-37822636 CAAGGAGATCCACAGGCAGTAGG + Intergenic
1183933886 22:41250825-41250847 CAGGGAGAAGAGCAGCCAGCTGG + Intronic
1184253762 22:43275768-43275790 CAGGGAGAACAACAGGCAGATGG + Intronic
1184672991 22:46025384-46025406 GAGGGAGCACTACAGGGAGAGGG - Intergenic
949422881 3:3885057-3885079 CAGACAGAAGAACAGGAAGAAGG + Intronic
949511871 3:4773248-4773270 CCTCGAGAGCAACAGGCAGAGGG + Intronic
949812821 3:8025276-8025298 CATGGAGAACAAAACGCAGTAGG - Intergenic
949820725 3:8112634-8112656 CAGGCAGAAAAGCAGGCAGTTGG + Intergenic
950506877 3:13400476-13400498 CAGGGAGGATAACAGGAGGAAGG + Intronic
950590115 3:13930976-13930998 AAGGGAGGACAACAGGGACAAGG - Intergenic
950799570 3:15539236-15539258 GAGGGAGAAGTCCAGGCAGATGG + Intergenic
950811405 3:15652926-15652948 GAGGGAGAACAACAAAAAGAAGG + Intergenic
952255638 3:31693106-31693128 CAGGGAGAAGAACAGCTGGAGGG + Intronic
952519596 3:34143316-34143338 CAGGAAGAACAAGGGGGAGAAGG - Intergenic
954267220 3:49479204-49479226 AAAGGTGAACAACAGGCTGAGGG - Intronic
954385928 3:50243837-50243859 CAGGCAGGACAGCAGGCAGACGG + Intronic
954436691 3:50500052-50500074 CAGGGAGAGCCACAGGGAGATGG + Intronic
954805664 3:53218538-53218560 CAGGGAGATCAAGAGGCAACTGG + Intergenic
954923666 3:54213763-54213785 AATGCAGAACAACAGGAAGATGG + Intronic
954968131 3:54628801-54628823 CAGGGGGTACAACAGGCAGGAGG + Intronic
956091043 3:65667371-65667393 CTGGGAGAAAAGCAGCCAGAAGG + Intronic
956165226 3:66393244-66393266 CAGTGAGCACAAAAGGCAGGAGG + Intronic
957381764 3:79440012-79440034 CAGATAGAACAAAAGGTAGAGGG + Intronic
957572685 3:81968739-81968761 CAGGGACCACAACGGCCAGAGGG - Intergenic
957594497 3:82244768-82244790 CAGAGAGATCAACAGGAAAAGGG - Intergenic
957685863 3:83502726-83502748 GAGGGCGAACAACAGGCATGTGG + Intergenic
958888822 3:99760351-99760373 AATGGAGAAAAAGAGGCAGAGGG + Intronic
958991942 3:100856572-100856594 TTGGGAGAAGAACAGGCAGGAGG + Intronic
959571547 3:107889864-107889886 CAGTTAGAACAACAGCTAGATGG + Intergenic
959678159 3:109060810-109060832 CAGGGAGAAGAAACAGCAGAAGG + Intronic
960155975 3:114297568-114297590 GAGGGAGTTCATCAGGCAGAAGG + Intronic
960433041 3:117593388-117593410 CAGAGAGAGAAAGAGGCAGAGGG - Intergenic
961934305 3:130566925-130566947 CATTGAGAATATCAGGCAGATGG + Exonic
962264330 3:133934730-133934752 CAAGGAGTACAACGTGCAGAAGG - Exonic
962625643 3:137223363-137223385 CAGGGAGAAAAGAAAGCAGAAGG - Intergenic
963513813 3:146282377-146282399 CAGGGAGAAAAAGAGAGAGAGGG + Intergenic
963783675 3:149511638-149511660 GAGGTAGAAAAACAGGGAGAGGG + Intergenic
963817159 3:149844277-149844299 CAGTGAGAAGAAAAGGCACATGG + Intronic
963939169 3:151083576-151083598 AAGGGACAACAACAGGGAGAGGG + Intergenic
965504397 3:169496574-169496596 CAGGAAGAACAACTGGCACAAGG - Intronic
965827568 3:172746120-172746142 CAGGGAGACCAAGAGGAGGAAGG + Intergenic
966853368 3:184177815-184177837 GAGGAAGAAAAACAGGCAGCAGG - Intronic
968171029 3:196510668-196510690 CAAGGAGATCACCAGGTAGATGG - Intronic
968488025 4:873590-873612 CAGGCAGCACAAAGGGCAGAAGG - Intronic
969329832 4:6467925-6467947 TAGGGAGAACCACAGGTAGTTGG - Intronic
971138712 4:23899779-23899801 CAGGGAGAACCACAGTCAACCGG + Intronic
971246397 4:24932768-24932790 CAGGGAAAACATTAGTCAGAGGG + Intronic
971276857 4:25206548-25206570 CAGTGAGAACAAGAGAAAGATGG - Intronic
974933300 4:68384972-68384994 CAAGGAGAATAACAGACAGGGGG + Intergenic
974982672 4:68979343-68979365 GAGGGAGAAAAAGAGGCAGAAGG + Intergenic
975017886 4:69446673-69446695 GAGGGAGAAAAAGAGACAGAAGG - Intergenic
975184091 4:71380798-71380820 TAGAGAGAACAAGAAGCAGAGGG - Intronic
975240012 4:72046407-72046429 CAGAGAGAACAAAAGGCGGCTGG - Intronic
975563330 4:75727529-75727551 CAGGAAGTACAACAGGTAAAAGG + Intronic
976356267 4:84121025-84121047 CAGGGAGACCACAAGGTAGAAGG + Intergenic
976382671 4:84418117-84418139 TGGAGAGAACAACAGGCAGGTGG + Intergenic
977722974 4:100262453-100262475 GAAGGAGAACACCAGACAGAGGG + Intergenic
977874644 4:102134643-102134665 TAGGGAAAACAAAAGACAGAAGG - Intergenic
978133715 4:105232046-105232068 GAGGGGGAACAACAGACAGCAGG - Intronic
978476190 4:109133967-109133989 CTGGAAGAACTACAGGGAGAGGG + Intronic
978589087 4:110304562-110304584 CAGGGAGCATAACTGGCTGATGG - Intergenic
979024775 4:115555266-115555288 GAAGGAGTACACCAGGCAGAGGG - Intergenic
979746106 4:124215159-124215181 CAGGGAGAGAAAGAGACAGAGGG - Intergenic
979989459 4:127357172-127357194 CAGAGGGAAAAACAGTCAGAAGG - Intergenic
980224218 4:129960116-129960138 CAGGTAGAAAAACAGACACATGG - Intergenic
981142207 4:141282113-141282135 CAGGGTGAACTACAGTCAGAAGG + Intergenic
981728207 4:147870187-147870209 CAGGTGGGACTACAGGCAGAAGG - Intronic
984374622 4:178911834-178911856 CAGGCAGAACATCAGACAGGGGG + Intergenic
985306406 4:188546471-188546493 TAGAGAGACCAACAGACAGATGG - Intergenic
985563457 5:603539-603561 CAGGCTGGACACCAGGCAGACGG + Intergenic
985644058 5:1076816-1076838 CAGGGAGAAGGGCAGGAAGATGG + Intronic
986044320 5:4022800-4022822 CAGGGAGTCCAGCAGGGAGAAGG - Intergenic
986734047 5:10655163-10655185 CAGGGAGAGAAGCGGGCAGAGGG - Intergenic
987246504 5:16054382-16054404 AAGGGGGAACAAAAGGAAGAAGG + Intergenic
987393875 5:17402599-17402621 CAGGGATCAGAGCAGGCAGAGGG + Intergenic
988942927 5:36164095-36164117 CAGTGAGCACAATAGGGAGAGGG + Intronic
989180135 5:38568364-38568386 CTGGGGGACCAACAGGCACATGG + Intronic
990232771 5:53732653-53732675 ATGGGAGAAAAACATGCAGAAGG + Intergenic
991244673 5:64497638-64497660 CAGAGAGGAAAAAAGGCAGAGGG - Intergenic
994302569 5:98163084-98163106 CAGGGTGGAGAACAGGGAGATGG + Intergenic
995735075 5:115291820-115291842 CATGGACACCAAAAGGCAGAGGG - Intronic
996400012 5:123052287-123052309 CAGGGAGTACAAGAGGAAGATGG - Intergenic
996553592 5:124755053-124755075 CAGGAAGATCAAGAGGCAGCAGG + Intergenic
997655252 5:135549603-135549625 CAGGGAGCACTCCAGGCAGGAGG - Intergenic
997785976 5:136714325-136714347 AGAGGAGAACAACAGACAGAAGG - Intergenic
998509214 5:142697507-142697529 CAGGGAGGAGAACAGGAAGGCGG + Intronic
999377279 5:151095616-151095638 CTGGCAGCACAACAGGCAGATGG + Intergenic
999634365 5:153604936-153604958 CAAGTAGAAAAACAGGCAAAAGG + Intronic
1000124800 5:158233753-158233775 CAGGGAGGGCAAGAGGCACAAGG + Intergenic
1001182106 5:169530096-169530118 CAGGGAGAACATGAGGCTGTTGG - Intergenic
1002575749 5:180172779-180172801 CAGGGAGTACAGGAGGCAGGGGG - Intronic
1003849147 6:10204004-10204026 GTGGGAGGACAAGAGGCAGAGGG + Intronic
1004411600 6:15386248-15386270 GGGGGAGAAGAACAGGGAGAGGG - Intronic
1004723691 6:18291022-18291044 TAGGGAGAGGAAGAGGCAGAAGG - Intergenic
1005084122 6:21986608-21986630 CAGGGAGCAAAACAAGCAGGGGG - Intergenic
1005921528 6:30406213-30406235 CAGGGGAAAGAGCAGGCAGAAGG - Intergenic
1006383427 6:33714746-33714768 CAGGGACAACCACAGCCTGACGG - Intergenic
1006609762 6:35287308-35287330 CAGGCAGCACAACATCCAGAGGG - Intronic
1007251769 6:40500142-40500164 CTGTGAGAACACCAGGCTGATGG - Intronic
1007584408 6:42979938-42979960 CAGGCAGCAGAGCAGGCAGAAGG + Intergenic
1008008968 6:46443531-46443553 CAAGGAGAAGAAAAGGGAGATGG - Intronic
1008318765 6:50080641-50080663 CAGGGAGGACAACACACAGTGGG - Intergenic
1008802648 6:55388901-55388923 CTGGGGGAAGAACAGGAAGAGGG - Intronic
1009498567 6:64382157-64382179 CAGGCAGAAAAACAGGCAGAGGG - Intronic
1009594972 6:65723668-65723690 CAAGGACAACAACGGGGAGATGG - Intergenic
1009675538 6:66814952-66814974 CAGGAAGAATATCAGGCACAGGG - Intergenic
1010073875 6:71777884-71777906 CAGGAAGTACTTCAGGCAGAAGG - Intergenic
1011002917 6:82611238-82611260 CAGGAAGATCACAAGGCAGAAGG + Intergenic
1011026539 6:82875536-82875558 CAGGCAGAAAAACATGAAGAGGG - Intergenic
1011409685 6:87055082-87055104 CAGGGAGGAGAATGGGCAGAGGG - Intergenic
1011693409 6:89890429-89890451 CATGGAGAAAAAAATGCAGAAGG - Intergenic
1011903538 6:92332118-92332140 CAGGGAGAACATCATGGATAGGG + Intergenic
1014086561 6:117352735-117352757 CAGAGAGAACAACAGGACGCAGG + Intronic
1014334791 6:120119949-120119971 CTGGGATAAAAGCAGGCAGAGGG + Intergenic
1015382876 6:132589459-132589481 CAGGGAGAGCAGCAGGAAGTTGG + Exonic
1015712882 6:136161453-136161475 CAGAGAGTACACCATGCAGAAGG + Intronic
1016096688 6:140046015-140046037 AAGGGAGAAAGAAAGGCAGAAGG + Intergenic
1016540461 6:145158630-145158652 CAAGGAGAACAACGAGCAAAAGG - Intergenic
1016550112 6:145270037-145270059 CAGGGAAAACCTCAGGCAAAAGG - Intergenic
1018131658 6:160737659-160737681 GAGGAAGCAAAACAGGCAGACGG - Intronic
1018298640 6:162376808-162376830 GAAGGAGAAGAACAGGGAGAGGG + Intronic
1018337022 6:162803242-162803264 GAGGGAGAATTACAGGCTGATGG + Intronic
1018857204 6:167683302-167683324 CAGGGAAACCCACACGCAGACGG - Intergenic
1019546580 7:1580042-1580064 CATGGAGACAGACAGGCAGACGG - Intergenic
1019874964 7:3801817-3801839 CAGGGAGAACCACATGAAGACGG - Intronic
1020868712 7:13600325-13600347 GATGGAGAACAACATACAGATGG + Intergenic
1021215089 7:17906146-17906168 GAGGGAGAACGACAGCCAGATGG + Intronic
1021651104 7:22834259-22834281 CAGGGAGAAAAATAGGCAGCAGG - Intergenic
1021958226 7:25847753-25847775 CAGGGAGAAGAAGGGGTAGAGGG - Intergenic
1022467034 7:30658932-30658954 CCTCGAGGACAACAGGCAGATGG + Intronic
1023579364 7:41664713-41664735 GAGGGAGAATTCCAGGCAGAGGG - Intergenic
1023761254 7:43467335-43467357 CAGGAAGAAGTCCAGGCAGAGGG + Intronic
1023900076 7:44469227-44469249 CACAGAGAACAAAAAGCAGATGG - Intronic
1023927291 7:44678743-44678765 GAGTAAGAAGAACAGGCAGATGG - Intronic
1025250727 7:57349786-57349808 GAGGGCGAACACCAGGCAGAGGG + Intergenic
1025796193 7:64739568-64739590 GAGGGAGACCAAGAGGGAGAGGG + Intergenic
1026835347 7:73635440-73635462 CAGGTAGATGAACAGACAGATGG - Intergenic
1027457434 7:78410698-78410720 CAGGGAGAAAAAGAGTAAGATGG + Intronic
1027762112 7:82292250-82292272 CAAGGAAAACATGAGGCAGATGG - Intronic
1027866577 7:83655728-83655750 CATGGAGAAAACCTGGCAGAAGG + Intergenic
1029556908 7:101276707-101276729 CAGTGACACCCACAGGCAGAAGG + Intergenic
1030080887 7:105776741-105776763 CAGGTGGATAAACAGGCAGAAGG - Intronic
1031185873 7:118479713-118479735 AAGGGAGATCTTCAGGCAGAAGG - Intergenic
1031923183 7:127615866-127615888 CAGGGAGGACAACAGAGACAGGG - Intronic
1032763539 7:134967793-134967815 CAAGGAGAAAGACAGGAAGAGGG + Intronic
1033228278 7:139577709-139577731 CAGGTGGAAAGACAGGCAGATGG + Intronic
1033557504 7:142501630-142501652 GAGGGAGAATTGCAGGCAGAGGG + Intergenic
1033562028 7:142541590-142541612 CTGGGAGACCAAAAGGCACACGG - Intergenic
1033568441 7:142602398-142602420 CTGGGAGAAGAGCAGCCAGAGGG - Intergenic
1034461507 7:151200230-151200252 CTGGGAGAGAAAGAGGCAGAAGG - Intronic
1034692116 7:153022285-153022307 GAAAGAGAACAACAGGCAGAGGG - Intergenic
1034898088 7:154890370-154890392 CAGGGAGAGCTCCAGCCAGAAGG + Intronic
1035289880 7:157831138-157831160 AAGGGAGAAGCACAGGAAGAGGG + Intronic
1035355594 7:158274393-158274415 CAGGGGGAGCCACAGGCACAGGG + Intronic
1037831973 8:22195119-22195141 CAGGGAGGAAAAAAGGCAGTTGG + Intronic
1041483999 8:58353936-58353958 TAGGGAGAACATTTGGCAGATGG + Intergenic
1041635219 8:60134983-60135005 CAGGGAGAGCAGCAGGCAAGTGG - Intergenic
1041683611 8:60620734-60620756 CAGGGAGGACAGCAGGCTGGGGG + Exonic
1043682852 8:83052552-83052574 CAGGGAGACCAACAGGAAGTAGG - Intergenic
1044245482 8:89939719-89939741 CAGGGAAAACAACTGCCAGTGGG + Intronic
1046289329 8:112136367-112136389 CAGGGAGACCAACTGGGAGGTGG - Intergenic
1048289741 8:133171625-133171647 CAGGGAGAGCCAGAGACAGAAGG + Intergenic
1048648972 8:136453541-136453563 CATGGAGTGCAACAGGCAAATGG + Intergenic
1050379857 9:5016724-5016746 CATGGAGAATAACTGGCAGGAGG - Intronic
1051349402 9:16184930-16184952 CAGGGGTAACAGCAGGCAGTGGG + Intergenic
1051500217 9:17768584-17768606 CAGAGTGAACAAGAGGGAGAAGG - Intronic
1051818211 9:21134217-21134239 CAGGGTGAAGAACAGCCTGATGG - Intergenic
1051995074 9:23205290-23205312 CAGGGATATCAACAGGAAAAAGG + Intergenic
1052049585 9:23830208-23830230 CAGGGAGAAGAACGGGGGGAGGG - Intergenic
1052857905 9:33418399-33418421 CAGAGAGTACAGCAGGAAGAGGG + Intergenic
1053387584 9:37706910-37706932 CTGACAGAAGAACAGGCAGATGG - Intronic
1053725838 9:40999517-40999539 CAAGGAGAAAAAGACGCAGAAGG - Intergenic
1054546865 9:66343239-66343261 CAAGGAGAACCAGAGCCAGAGGG + Intergenic
1054846568 9:69805036-69805058 GAAGGAGAACAACATCCAGAAGG + Intergenic
1055120937 9:72660021-72660043 CAAGGAGAAGGACAGGCAGGAGG - Intronic
1055130685 9:72770867-72770889 GAGGAAGAACAAAAGGAAGAAGG - Intronic
1055610649 9:78020784-78020806 CAGGGAAAAGAACAGACATAGGG - Intronic
1055624948 9:78166836-78166858 CAGGGAAAAAAGCAGGAAGAAGG - Intergenic
1055783607 9:79847312-79847334 CAGAGAGAACAAAGGGCAAAGGG - Intergenic
1056417303 9:86389072-86389094 GAGGTAGAATCACAGGCAGATGG + Intergenic
1057857735 9:98614945-98614967 TTGAGAGAACAACAGGCAGAGGG - Intronic
1058031433 9:100202379-100202401 CAGAGAGAACTTCAGGCAGAGGG + Intronic
1058219777 9:102284206-102284228 CAAGGAGAAAAAAAGGCATAAGG - Intergenic
1059329595 9:113526523-113526545 GAGGGAGAACAACATGAATAGGG - Intronic
1059798879 9:117729632-117729654 CAGTGGTGACAACAGGCAGAAGG + Intergenic
1059953818 9:119495472-119495494 CAGGGAGCATACCAGGCTGAGGG + Exonic
1060106979 9:120878659-120878681 CAGGGGGATCAAGGGGCAGAAGG - Intronic
1060783166 9:126428720-126428742 AAAGGAGAACCACAGGCACATGG - Intronic
1061279632 9:129590030-129590052 GAGAGGGAACATCAGGCAGAAGG + Intergenic
1061427319 9:130507369-130507391 CAGGGAGAGGGACAGGGAGAGGG + Intergenic
1061619282 9:131800930-131800952 CAGGGTGCACAGCAGGCAGTGGG - Intergenic
1202804340 9_KI270720v1_random:37156-37178 CAAAGAGAAAAACATGCAGAAGG + Intergenic
1203362849 Un_KI270442v1:232638-232660 CAGTGAGAGACACAGGCAGAGGG + Intergenic
1187439165 X:19302416-19302438 CAGGGAAAACAGAAGACAGATGG - Intergenic
1189755879 X:44270873-44270895 CAAGGAGAACCACAGACAGAAGG - Intronic
1190934568 X:54985170-54985192 CAGAGAGAACAAGAGAGAGAGGG + Intronic
1191199717 X:57766718-57766740 CATGAAGAAAATCAGGCAGATGG - Intergenic
1191679521 X:63826323-63826345 GAGGGAGAAGGACAGGAAGAGGG + Intergenic
1192248766 X:69393745-69393767 CAGAGAGCAGAACAGTCAGAAGG - Intergenic
1192664689 X:73077609-73077631 CAGGGAAAAGGACAGGAAGAGGG + Exonic
1193014700 X:76719438-76719460 AAGAGAGAACAACAGGCACTGGG - Intergenic
1194810489 X:98381967-98381989 CAGATAGAACAACAGGCAGAGGG - Intergenic
1195242687 X:102968381-102968403 CAGGGAGGATTCCAGGCAGAGGG + Intergenic
1195490181 X:105459288-105459310 CAGACAGATAAACAGGCAGATGG - Intronic
1196891374 X:120293988-120294010 TATTGAGAACAAAAGGCAGATGG - Exonic
1196951602 X:120930925-120930947 CAAGGAAAAGAACAGGCAAATGG - Intronic
1196952286 X:120935786-120935808 CAAGGAAAAGAACAGGCAAATGG - Intronic
1196952971 X:120940647-120940669 CAAGGAAAAGAACAGGCAAATGG - Intronic
1196953656 X:120945507-120945529 CAAGGAAAAGAACAGGCAAATGG - Intronic
1196954341 X:120950368-120950390 CAAGGAAAAGAACAGGCAAATGG - Intronic
1196955024 X:120955228-120955250 CAAGGAAAAGAACAGGCAAATGG - Intronic
1196955712 X:120960111-120960133 CAAGGAAAAGAACAGGCAAATGG - Intronic
1196956393 X:120964972-120964994 CAAGGAAAAGAACAGGCAAATGG - Intronic
1196957075 X:120969832-120969854 CAAGGAAAAGAACAGGCAAATGG - Intronic
1196957757 X:120974692-120974714 CAAGGAAAAGAACAGGCAAATGG - Intronic
1196958439 X:120979552-120979574 CAAGGAAAAGAACAGGCAAATGG - Intronic
1196959120 X:120984412-120984434 CAAGGAAAAGAACAGGCAAATGG - Intronic
1197147781 X:123188168-123188190 CAGAGAAAGCAACAGGCAGCTGG - Intronic
1197415922 X:126172667-126172689 CAGAGAGAACAGCATGCAAAAGG - Intergenic
1199498207 X:148477934-148477956 CAGGGAGAAGAAAAGTAAGAAGG + Intergenic
1200072153 X:153534523-153534545 CAGGGAGAACAGCAGGCCCGAGG - Intronic
1201075414 Y:10183545-10183567 CAGTGAGAGAGACAGGCAGAGGG - Intergenic