ID: 1184254247

View in Genome Browser
Species Human (GRCh38)
Location 22:43278145-43278167
Sequence GTCCGGAATGGCCCTCAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 49}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184254247_1184254256 6 Left 1184254247 22:43278145-43278167 CCACCTTGAGGGCCATTCCGGAC 0: 1
1: 0
2: 0
3: 4
4: 49
Right 1184254256 22:43278174-43278196 GGGCCAGGACAGGCCTCCTCCGG 0: 1
1: 0
2: 5
3: 39
4: 354
1184254247_1184254252 -9 Left 1184254247 22:43278145-43278167 CCACCTTGAGGGCCATTCCGGAC 0: 1
1: 0
2: 0
3: 4
4: 49
Right 1184254252 22:43278159-43278181 ATTCCGGACCGCACAGGGCCAGG 0: 1
1: 0
2: 0
3: 5
4: 47
1184254247_1184254254 -4 Left 1184254247 22:43278145-43278167 CCACCTTGAGGGCCATTCCGGAC 0: 1
1: 0
2: 0
3: 4
4: 49
Right 1184254254 22:43278164-43278186 GGACCGCACAGGGCCAGGACAGG 0: 1
1: 0
2: 2
3: 29
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184254247 Original CRISPR GTCCGGAATGGCCCTCAAGG TGG (reversed) Intronic
902379163 1:16044617-16044639 GTCCTGAGTGGTCCTCCAGGGGG - Intronic
906769134 1:48468573-48468595 GTCTGGAATGGACCTGAAAGGGG + Intronic
1073763987 10:106662031-106662053 GTGCAGAATGTCCCTCCAGGTGG - Intronic
1078594437 11:12674547-12674569 GCGCGGAATGGCCCGCAGGGTGG - Intergenic
1078919592 11:15817160-15817182 GTCAGGCAAGGCCCTCAGGGAGG + Intergenic
1079096015 11:17510664-17510686 GTTCCAACTGGCCCTCAAGGAGG + Intronic
1090236663 11:125153283-125153305 GTCTGGAATGTCCGTCTAGGTGG - Intergenic
1090656359 11:128848918-128848940 GTGTGGAATGGCCATTAAGGCGG + Intronic
1091333730 11:134751349-134751371 GTCTGGAATGGGGCTCAGGGCGG + Intergenic
1096091876 12:48907509-48907531 TTCAGGAATGACCCTGAAGGTGG - Intronic
1125229442 15:37435297-37435319 CTGCGGAATGGCCCTGAAGAAGG + Intergenic
1129494945 15:75970550-75970572 GTTGGGAATGACCCTCAGGGAGG + Intronic
1130260721 15:82352332-82352354 GTGCGGAAGGGCCCACAAAGCGG + Intergenic
1131357090 15:91754976-91754998 GTCCAGAATTGCTTTCAAGGGGG + Intergenic
1136578265 16:31137013-31137035 GGCCAGAGTGGCCCTCAAGGAGG - Intergenic
1137433409 16:48436261-48436283 GGCGGGAATTGCCCTCCAGGTGG - Intronic
1137591656 16:49697464-49697486 ATCAGGAATGGCCTTCTAGGTGG - Intronic
1137967609 16:52952328-52952350 GTCTGAAATGGACCTCAATGAGG + Intergenic
1138458897 16:57136425-57136447 GTCCAGAATGGACCTCCAGATGG + Intronic
1152355586 17:79805440-79805462 GCCCGGAATTGCCCTGAAAGTGG - Intergenic
1153944790 18:10009154-10009176 GTCTGGACTGGCCTTTAAGGAGG + Intergenic
1157624870 18:49042777-49042799 GTCCCAACTGGCCCTCAATGTGG + Exonic
1163583734 19:18153299-18153321 GTCCTGACTGGCCCTCGTGGCGG + Intronic
1163862796 19:19750902-19750924 GTCAGGAAGGGGTCTCAAGGAGG - Intergenic
1166376195 19:42328516-42328538 GACAGGAATGGCCCCCAAGCTGG - Intronic
1167513658 19:49910313-49910335 GTCCAGAGAGGCCCTCAGGGTGG - Intronic
925066423 2:932017-932039 CTCCGCAATGGCCCCCAGGGCGG - Intergenic
934188161 2:89764043-89764065 GTCGGGAAGGGCCTTCTAGGAGG + Intergenic
938288995 2:130139754-130139776 GGCCTGCATGGCCCTCACGGGGG + Intronic
938467535 2:131533184-131533206 GGCCTGCATGGCCCTCACGGGGG - Intronic
1170182401 20:13546720-13546742 GTCAGGAAGTGCCCACAAGGGGG - Intronic
1177813031 21:25945245-25945267 TTCCTGAATGGGGCTCAAGGTGG + Intronic
1179566209 21:42250707-42250729 CTCAGGAATGGCCCACATGGAGG - Intronic
1183346990 22:37313388-37313410 GGCTGGACTGGCCGTCAAGGTGG - Intronic
1184254247 22:43278145-43278167 GTCCGGAATGGCCCTCAAGGTGG - Intronic
968394059 4:216936-216958 GTCCAGAATAGCCCTTCAGGTGG - Intergenic
969305804 4:6325710-6325732 GTGAGGAATGGCTCTCATGGTGG - Intronic
997340459 5:133140750-133140772 GTCAGGAGAGGCCCTGAAGGTGG + Intergenic
998034761 5:138905376-138905398 GTCACAAATGGCCCTCAAGGAGG - Intronic
999137553 5:149332587-149332609 GGCTGGAAGGGCCCTCTAGGAGG + Intronic
1001994881 5:176149082-176149104 GTCCAGATTGACCCTCAAGGAGG + Intergenic
1013605003 6:111739363-111739385 GTCTGGAATGGGGCTCAAGGAGG + Intronic
1015281067 6:131434333-131434355 GTGCAGAATGCCCCTAAAGGAGG + Intergenic
1019055773 6:169222268-169222290 CTCCGGCGTGTCCCTCAAGGTGG - Exonic
1019701771 7:2477664-2477686 GGCCGGGAGGGGCCTCAAGGTGG + Intergenic
1024055440 7:45657428-45657450 GTCAGGGAGGGCCCTCTAGGAGG + Intronic
1034437456 7:151069981-151070003 GCCCGGAGTGGCCCACCAGGTGG + Exonic
1035235246 7:157493599-157493621 CGCAGGAATGGCCCTCGAGGAGG - Intergenic
1035279405 7:157767919-157767941 GTCCTTAATGTCCCTCAAGCGGG - Intronic
1049472256 8:142781744-142781766 GTCCTGAGTGCCCCTGAAGGAGG - Intergenic
1049803534 8:144528888-144528910 GTCCGGAGCGTCCCGCAAGGCGG + Exonic
1058270998 9:102971351-102971373 GCCTGGGTTGGCCCTCAAGGTGG + Intergenic
1060608952 9:124942835-124942857 GTACTGAAGTGCCCTCAAGGTGG + Intronic
1187424687 X:19166534-19166556 TTCCGGAAGATCCCTCAAGGTGG - Intergenic