ID: 1184255063

View in Genome Browser
Species Human (GRCh38)
Location 22:43281827-43281849
Sequence GGACTGTGCCGTGACAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 95}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184255063_1184255072 27 Left 1184255063 22:43281827-43281849 CCTTCACTGTCACGGCACAGTCC 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1184255072 22:43281877-43281899 CTCTGAGTTCCGCCAGCTTTGGG 0: 1
1: 0
2: 0
3: 11
4: 113
1184255063_1184255071 26 Left 1184255063 22:43281827-43281849 CCTTCACTGTCACGGCACAGTCC 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1184255071 22:43281876-43281898 CCTCTGAGTTCCGCCAGCTTTGG 0: 1
1: 0
2: 0
3: 10
4: 119
1184255063_1184255065 -4 Left 1184255063 22:43281827-43281849 CCTTCACTGTCACGGCACAGTCC 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1184255065 22:43281846-43281868 GTCCAAATTCCTGCTAGACAGGG 0: 1
1: 0
2: 1
3: 8
4: 95
1184255063_1184255064 -5 Left 1184255063 22:43281827-43281849 CCTTCACTGTCACGGCACAGTCC 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1184255064 22:43281845-43281867 AGTCCAAATTCCTGCTAGACAGG 0: 1
1: 0
2: 0
3: 12
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184255063 Original CRISPR GGACTGTGCCGTGACAGTGA AGG (reversed) Intronic
901583667 1:10267687-10267709 TGACTGTGCTGTAACAGTGAGGG + Intronic
902819426 1:18934861-18934883 GGACTCTGCGCTGACAGTGGAGG - Intronic
903371996 1:22842432-22842454 GGACAGGGTGGTGACAGTGAGGG - Intronic
903817578 1:26076001-26076023 GGACTTTGCCCTGGCACTGAGGG - Intergenic
904907449 1:33908461-33908483 GGCCTGTGCCAGGACTGTGAAGG - Intronic
907491417 1:54811205-54811227 GAACAGTGCTGTGACAGGGAAGG - Intronic
907825518 1:58013098-58013120 AGACTGTGCCATGAGAGTCAGGG - Intronic
910016956 1:82536765-82536787 GGACTCTGCCATGAAAATGAAGG - Intergenic
913145177 1:115981801-115981823 GACTTGTGCCTTGACAGTGAAGG + Intronic
917795535 1:178530241-178530263 GGCCAGTGCTGTGGCAGTGATGG - Intronic
917962875 1:180158323-180158345 GGCCTGTGCCGTGGAAGAGAAGG - Intronic
918104922 1:181408609-181408631 CCACTGTGCCCTGACAGGGAAGG + Intergenic
920701232 1:208219341-208219363 GGACAGTACCATGATAGTGATGG - Intronic
921076107 1:211701325-211701347 GGACTGAGCCCTGAAAGTGTGGG + Intergenic
923873098 1:238017527-238017549 TGGCTGTGCTGTGGCAGTGATGG - Intergenic
1063385537 10:5614075-5614097 GGACTGTTCCATGACCGTCAAGG - Intergenic
1067927904 10:50529331-50529353 GGACTTTGCCGTTTCAGGGATGG - Intronic
1069867346 10:71511961-71511983 GGGCTGGGCGGTGGCAGTGAAGG + Intronic
1070670603 10:78374900-78374922 GGACTGGGGAGTTACAGTGAGGG - Intergenic
1071128857 10:82368931-82368953 GGACTCTGCCGAGGCAATGAGGG + Intronic
1072193549 10:93095536-93095558 TGACTGTTCAGTGACAGTGATGG + Intergenic
1075013261 10:118892620-118892642 GGACTCTGCTGTGACAGCAAAGG + Intergenic
1076142515 10:128091096-128091118 GGAATGTGGCGTCACAGTGCAGG + Intergenic
1076789090 10:132767393-132767415 GGTCTGAGCCTTGAAAGTGACGG + Intronic
1077543242 11:3157508-3157530 GGCCTGTGCCAAGACAGAGAGGG + Intronic
1077878500 11:6327988-6328010 AGACTGTGCTGTGAAAATGATGG + Intergenic
1081601016 11:44494279-44494301 GTACTGTGCCCTGATAGAGATGG + Intergenic
1081794656 11:45811149-45811171 GGCCTGTGCCCAGACAGTGCTGG + Exonic
1082202947 11:49395946-49395968 TGGCTGTGATGTGACAGTGAGGG + Intergenic
1094177207 12:27553276-27553298 GGACTGAGTGGTGACAGTGGTGG - Intronic
1096124202 12:49107707-49107729 GGACTGCCAAGTGACAGTGATGG + Intronic
1096608903 12:52788324-52788346 GGACTGTGCCAGGCCAGTCATGG - Intergenic
1097803953 12:63944956-63944978 TGACTGTGCAGTGACATGGATGG + Intronic
1104000621 12:124857611-124857633 GGACGCTGCAGTGACAGTGATGG + Intronic
1104667467 12:130657619-130657641 GGGCTGTGCGGGGGCAGTGAGGG + Intronic
1104782044 12:131428275-131428297 GGTCTGTGCCTAGACAGGGATGG - Intergenic
1105711345 13:23012161-23012183 GGACTGAGCAGTGAAAGGGATGG - Intergenic
1106463131 13:29990102-29990124 GGTGTTTGCAGTGACAGTGAGGG + Intergenic
1119320674 14:73728422-73728444 GGACCGTGCAGGGAGAGTGAGGG - Intronic
1119503390 14:75150441-75150463 GTACTGTGCTGTGACAATCAGGG - Intronic
1124511940 15:30335123-30335145 GGACTGTGCAGAGGGAGTGATGG + Intergenic
1124730974 15:32195628-32195650 GGACTGTGCAGAGGGAGTGATGG - Intergenic
1128168729 15:65491459-65491481 GGACTGGGCCTTGACTGGGAAGG - Intronic
1128431426 15:67598537-67598559 CGCCTGTGCCCTGACAGTGTTGG + Intronic
1133416326 16:5609857-5609879 GGACTGTGCAGAGACGGTGGGGG + Intergenic
1138102933 16:54268950-54268972 GGACTGAGCAGGGACAGTGGGGG - Intronic
1139836160 16:69840286-69840308 GGACTGTGCCGGGACAGGGTGGG + Intronic
1142181293 16:88672073-88672095 GGGCTGAGCCGTGACCATGAGGG + Intergenic
1143297964 17:5885427-5885449 GGACTGTGCCCTCAGAGTCATGG + Intronic
1148327844 17:46794193-46794215 GGACTGTGCCCTGAGAGAAAAGG + Intronic
1152537255 17:80957860-80957882 GGACAGTGCCGGGACAATGCTGG + Intronic
1152639180 17:81442585-81442607 GGCCTGTGCCGTGGCAGGGGAGG + Exonic
1157269890 18:46265258-46265280 GGCCTCTGCCCTGACAGTGGGGG - Exonic
1157529094 18:48407386-48407408 GGACTTTGCAGTGACAGTCCTGG + Intronic
1162805318 19:13135291-13135313 GTACTGTGACGTGTCAGTGGTGG + Exonic
929779480 2:44948652-44948674 GGGCTGTGCAGTGACTGAGATGG - Intergenic
936637258 2:114272884-114272906 GGTCAGTGACGTGACAGTGGAGG + Intergenic
937908103 2:127062117-127062139 GGGCTGGGCCTTGACCGTGAAGG + Exonic
942194079 2:173499617-173499639 GGTCTCTGCCGTGACATTGGTGG + Intergenic
942433625 2:175945220-175945242 CCACTGTGCCCTGCCAGTGATGG - Intronic
948888620 2:240896372-240896394 GGACTGTGCCGTCCCTGGGATGG + Intronic
1170157811 20:13284652-13284674 GGTCTTTGCCGGGACATTGATGG + Intronic
1173336722 20:42118116-42118138 GGATTGTGGTGTGACAATGAGGG + Intronic
1175368174 20:58469639-58469661 GGACTGTGCCGTGGGCGTGGGGG + Intronic
1179896351 21:44365738-44365760 TGCCTGTGGCCTGACAGTGAGGG + Intronic
1181282263 22:21728296-21728318 GGACGGTGCCTTGCCAGTGAGGG - Intronic
1184255063 22:43281827-43281849 GGACTGTGCCGTGACAGTGAAGG - Intronic
949794608 3:7834567-7834589 GGAATGTGTAGTGACAGAGATGG - Intergenic
967777764 3:193401944-193401966 GGACTGTGTGTTGACTGTGATGG - Intergenic
968527606 4:1070465-1070487 GGACTGTGCTGTGTCAGCGTGGG + Intronic
968821948 4:2860901-2860923 AGTCTGTGCCCTGATAGTGATGG + Intronic
969544776 4:7818561-7818583 GGCCTGCGGCGTCACAGTGATGG + Intronic
970583665 4:17495180-17495202 GGACTGTGGCATGACGGGGATGG + Intronic
972834679 4:42855553-42855575 GGCATGTTCCGTGACAGTGGAGG - Intergenic
980586552 4:134824419-134824441 AGACTGTGCCTTGAAAATGATGG + Intergenic
983867508 4:172786618-172786640 GGACTTGGCCGTGACAGTTTTGG - Intronic
985659614 5:1150353-1150375 GGCCTGTGCCCTGAAAATGAGGG - Intergenic
995858986 5:116622186-116622208 GGAATGTGGGGTCACAGTGAGGG + Intergenic
998561402 5:143175352-143175374 GCACTCTGTGGTGACAGTGAAGG + Intronic
999081532 5:148848772-148848794 GCACAGTGCTGTGACAGTGCTGG + Intergenic
1006838717 6:37014791-37014813 GGACTGGGGGGTAACAGTGAGGG - Intronic
1013429752 6:110044766-110044788 GGGCTGTGCAGCAACAGTGAGGG + Intergenic
1018425289 6:163674300-163674322 GCACAGTGCTGTGACAGTGTAGG + Intergenic
1018856740 6:167680394-167680416 GGAGTGTGCCCTGAAAGTCAGGG + Intergenic
1020406651 7:7842943-7842965 GGTCTGTCCTGTGACTGTGAAGG + Intronic
1028209456 7:88055419-88055441 GCATTGTGCCTTGACTGTGAAGG + Intronic
1029707408 7:102283099-102283121 GGCCTCCCCCGTGACAGTGACGG + Intronic
1030942032 7:115663335-115663357 GGCCTGTGCACTGGCAGTGAGGG + Intergenic
1037716572 8:21406220-21406242 GGGCTGAGCCGTGACCGTGCAGG - Intergenic
1039258040 8:35740529-35740551 AGTCTGTGCTGTGACAGTAATGG + Intronic
1039602111 8:38848227-38848249 GGAGTGTGACCTGACAGTGCTGG + Exonic
1039968361 8:42299923-42299945 TGTCTGTGCCTTGGCAGTGAGGG + Intronic
1040710047 8:50176979-50177001 GGACTGTGCCGTGCAGGTAAAGG + Intronic
1042435505 8:68760101-68760123 GGCCTGTGGCTTGATAGTGAAGG + Intronic
1045935915 8:107678455-107678477 GGACTTTGCTGTGAGAGAGATGG + Intergenic
1053236189 9:36456585-36456607 AGACTCTGCCTTGCCAGTGAAGG + Intronic
1055961056 9:81820853-81820875 GGAGAGTGCAGTGACAGAGATGG + Intergenic
1060531251 9:124348137-124348159 GGTCTGTGCCGTGCCAGACATGG + Intronic
1060981755 9:127796550-127796572 GGACTGTGCCCTGTAAGTGGGGG + Intronic
1062431454 9:136528490-136528512 GGAATGGGCAGGGACAGTGAGGG + Intronic
1189992599 X:46608992-46609014 GGGATGTGCCGAGACAGGGAAGG - Intronic