ID: 1184255758

View in Genome Browser
Species Human (GRCh38)
Location 22:43285893-43285915
Sequence CCTTGTGCACAGATGAACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184255755_1184255758 -1 Left 1184255755 22:43285871-43285893 CCTCAGGTTTTGGCATGTACTAC 0: 1
1: 0
2: 0
3: 5
4: 145
Right 1184255758 22:43285893-43285915 CCTTGTGCACAGATGAACCTGGG 0: 1
1: 0
2: 1
3: 13
4: 140
1184255753_1184255758 12 Left 1184255753 22:43285858-43285880 CCATCTTGTTGGGCCTCAGGTTT 0: 1
1: 0
2: 2
3: 17
4: 223
Right 1184255758 22:43285893-43285915 CCTTGTGCACAGATGAACCTGGG 0: 1
1: 0
2: 1
3: 13
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184255758 Original CRISPR CCTTGTGCACAGATGAACCT GGG Intronic
901746462 1:11376983-11377005 TCAAGTGCACAGATGGACCTGGG - Intergenic
902057365 1:13612702-13612724 CCTTGTGCTGAGGAGAACCTTGG + Intronic
902225072 1:14991655-14991677 CCTTGGGCTCAGGTGTACCTGGG - Intronic
902787704 1:18743844-18743866 CTTTGTGAATAGATGAACCTTGG - Intronic
905477944 1:38242111-38242133 CCTTGTGTACAGAACAGCCTGGG - Intergenic
906848891 1:49226089-49226111 CTTTGTTAACAGATGGACCTGGG - Intronic
914352658 1:146853795-146853817 CCTTGTGCAAGCATGAACTTAGG + Intergenic
915358253 1:155269391-155269413 CCTTGTTCTCAGCTGAACATTGG - Intronic
915583500 1:156830444-156830466 CCTTGTGCCCAGGTGAACCTGGG + Intronic
916100342 1:161388837-161388859 CCTTGTGGCCAGAAGAAGCTAGG + Intergenic
920393990 1:205631095-205631117 CCTTGTGCACAGCTGCATCGAGG - Intronic
921229567 1:213055168-213055190 ACTTGTGCAGTGATGAACATGGG - Intronic
921268468 1:213445916-213445938 CCCTGTGCACCGAGGAAGCTGGG + Intergenic
1066208733 10:33215454-33215476 CCTTGTGCTCAGAAGCTCCTTGG - Intronic
1067776436 10:49167875-49167897 CCCTGTGCACAGAATAACATGGG + Intronic
1068398000 10:56488839-56488861 CCTTGTGGACACATGACCTTGGG + Intergenic
1075582142 10:123627994-123628016 CCATGTACAAAGATGAAACTTGG - Intergenic
1076695173 10:132243908-132243930 GCTTGGGCACAGCTGAGCCTGGG + Intronic
1077360210 11:2137500-2137522 CCCTGTGCAGAGATGAGCCGGGG - Intronic
1079629948 11:22662162-22662184 CCTTGAGTCCAAATGAACCTAGG + Intronic
1080155693 11:29108098-29108120 CCATTTGCACAGATGACCCTAGG + Intergenic
1082958497 11:58896980-58897002 CCTTGTAGGCAGATGAACCCGGG + Intronic
1082974082 11:59055023-59055045 CCTTGTAGGCAGATGAACCCGGG + Intergenic
1082978491 11:59098814-59098836 CCTTGTAGGCAGATGAACCCGGG + Intergenic
1083069931 11:59967803-59967825 CCTTGTGAACAGCTCAACCAGGG - Intergenic
1084661504 11:70549122-70549144 CCGTGTGCACAGCTGTGCCTGGG - Intronic
1085696019 11:78705353-78705375 CCATGTGCACAGAGGTGCCTGGG + Intronic
1090293967 11:125569830-125569852 CCTCGTGCACAGTTGTGCCTAGG + Intronic
1092786315 12:12030207-12030229 CCTGGAGCACAGAGGAGCCTGGG - Intergenic
1094272293 12:28630169-28630191 CCTTGTGCCCAGGGGAATCTGGG - Intergenic
1095188422 12:39228502-39228524 CTCTGTGTACAGATGTACCTGGG - Intergenic
1096317968 12:50585371-50585393 CCTTGTAGACAGATGAAGCGTGG + Intronic
1099653246 12:85456532-85456554 CCTTGTGCTCATAAAAACCTGGG + Intergenic
1100616705 12:96236609-96236631 CCTTGTGCAAAGCCGAACTTTGG - Intronic
1102058781 12:109916213-109916235 CCTTGTGGTCAGATGACACTGGG + Intronic
1104199034 12:126569415-126569437 TCTTATCCACAGATAAACCTGGG + Intergenic
1104657347 12:130583233-130583255 CCTCCTTCACAGATGAAGCTGGG - Intronic
1106009349 13:25803590-25803612 GCGTGTGCACAGATCAGCCTCGG + Intronic
1111327714 13:86721039-86721061 CATTGGACACACATGAACCTTGG + Intergenic
1118927618 14:70207090-70207112 CATGGAGCACTGATGAACCTGGG - Intergenic
1122456974 14:101861614-101861636 CCTTGTGCACACATGGTCTTAGG + Intronic
1123003999 14:105312730-105312752 CCAAGTGCACAGATGTCCCTTGG - Exonic
1124169597 15:27360739-27360761 CCTGCTGCAAAGATGACCCTGGG + Intronic
1124477176 15:30045205-30045227 AGTTGTCCACAGATGCACCTGGG - Intergenic
1127358405 15:58223804-58223826 CCTTTTGTCCAGAAGAACCTGGG - Intronic
1129321336 15:74776783-74776805 CCTCCTGCAGAGATAAACCTTGG - Intergenic
1131647715 15:94363276-94363298 CCTTGGGCACTGATGAGCCTCGG + Intronic
1132540360 16:505616-505638 GCTGGTGCACAGGTGAGCCTGGG + Exonic
1137461684 16:48670314-48670336 CTTTGTGCACAGATGGATCTAGG - Intergenic
1138664801 16:58556897-58556919 CCTTTTGTACAGAGGAAACTGGG - Exonic
1139280980 16:65770294-65770316 CCAAGGGCACAGATGAGCCTAGG - Intergenic
1139981371 16:70861723-70861745 CCTTGTGCAAGCATGAACTTAGG - Intronic
1142404385 16:89879241-89879263 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404421 16:89879493-89879515 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404428 16:89879535-89879557 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404435 16:89879577-89879599 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404442 16:89879619-89879641 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404449 16:89879661-89879683 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404456 16:89879703-89879725 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404463 16:89879745-89879767 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404470 16:89879787-89879809 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404477 16:89879829-89879851 CCGTGTGCACAGATGGGCTTCGG + Intronic
1142404484 16:89879871-89879893 CCGTGTGCACAGATGGGCTTCGG + Intronic
1151635911 17:75347667-75347689 CCTTGGGAACTGCTGAACCTGGG + Intronic
1152078349 17:78171846-78171868 AGTTGTCCACAGATGCACCTGGG - Exonic
1154396961 18:13999345-13999367 CCTTGTGGCCAGTTGAATCTGGG - Intergenic
1155758219 18:29529132-29529154 ACTTTTGCACAGAAGAACCATGG + Intergenic
1157006470 18:43589854-43589876 CTTTGGGCACAGATGAGCATGGG - Intergenic
1162965943 19:14156138-14156160 GCTTGAGCACAGATGAGCTTCGG + Exonic
1165931283 19:39360896-39360918 CCTGGTGAGCAGAAGAACCTGGG - Intronic
1167349344 19:48964965-48964987 CCCTGTGAACTGATGACCCTGGG - Intergenic
1167357373 19:49012176-49012198 CCTTGGGCCCAGCTGAAACTGGG + Intronic
1167697873 19:51025656-51025678 CCTTGTTCCCAGAGGAACCTGGG - Exonic
925409778 2:3633235-3633257 CCCTGGGCACAGATGCACTTGGG + Intronic
927497097 2:23558274-23558296 CCTTGTTGGCAGGTGAACCTTGG + Intronic
929770001 2:44883758-44883780 CCTTGAGCACAGATCAACTGTGG + Intergenic
930275029 2:49300732-49300754 TCATGTGCAAAGATGAACATGGG + Intergenic
933996305 2:87672484-87672506 ACTTGAGCACACATGTACCTCGG + Intergenic
936297550 2:111278427-111278449 ACTTGAGCACACATGTACCTCGG - Intergenic
936596751 2:113855391-113855413 TCTTGTCCACAGATCAACCATGG + Intergenic
936905490 2:117531554-117531576 CATTGAGCACACATGAACATAGG + Intergenic
937286642 2:120758278-120758300 CTTTGTGCACAGCTGAGCGTGGG + Intronic
937758313 2:125567967-125567989 CCTTGGTTTCAGATGAACCTGGG - Intergenic
938180711 2:129179428-129179450 ACTTGGGCACTGATGAACATAGG - Intergenic
941701986 2:168613405-168613427 CCTTGTGCACAGACCACCCTTGG - Intronic
941927087 2:170906697-170906719 CCTTGTGAACAGATGAGGCCAGG + Intergenic
942432189 2:175924095-175924117 ACTTGTGTAAAGATGAACCAAGG - Exonic
948401257 2:237687161-237687183 ACTTGTCCACAGATGCACATTGG - Intronic
949055101 2:241923381-241923403 CCATGTGCAGACATGAAGCTGGG + Intergenic
949055108 2:241923432-241923454 CCATGTGCAGACATGAAGCTGGG + Intergenic
949055129 2:241923585-241923607 CCATGTGCAGACATGAAGCTGGG + Intergenic
1172672549 20:36644356-36644378 CCTTGTTCACAGATGAGACGGGG - Intronic
1173020901 20:39267439-39267461 CATTGTGCTTAGATGAACCTGGG + Intergenic
1176099955 20:63360426-63360448 CCTGGAGCACAGATGGACCTAGG - Intronic
1178526103 21:33330768-33330790 CCTCGTTCCCAGATGATCCTAGG - Intronic
1179520773 21:41942911-41942933 CCACGGGCACAGGTGAACCTTGG - Intronic
1180741700 22:18057577-18057599 CCTTTTGCAAAAGTGAACCTAGG - Intergenic
1183716934 22:39538562-39538584 CCTTGTCCACAGATGGAGCAGGG - Intergenic
1184255758 22:43285893-43285915 CCTTGTGCACAGATGAACCTGGG + Intronic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
950150508 3:10683241-10683263 CCCTGTGGCCACATGAACCTGGG - Intronic
953369011 3:42371547-42371569 CCTTGTCCAAAGATGAAGTTGGG + Intergenic
955097949 3:55818543-55818565 CCTTCTGCTCAGATGAATCTAGG + Intronic
955482320 3:59402216-59402238 CCTTGGGGTCAGATGGACCTGGG + Intergenic
958562129 3:95760010-95760032 CCTTGTGCTCTCAGGAACCTGGG - Intergenic
959724734 3:109530648-109530670 CATTGTACACAAATGATCCTTGG - Intergenic
962436529 3:135372101-135372123 ACCTATGCACAGATGAACCCTGG + Intergenic
966826464 3:183969127-183969149 CCTGGTGCACAGAAGACACTTGG + Intronic
968284721 3:197501795-197501817 CCATGTGCTCAGCTGAACATTGG + Intergenic
968500754 4:948764-948786 CCTTGCGCACCCATGAAGCTTGG - Intronic
969864718 4:10067261-10067283 CCTTGTGAACAGAATAGCCTGGG - Intergenic
977993679 4:103476422-103476444 GGAAGTGCACAGATGAACCTAGG + Intergenic
982890483 4:160843158-160843180 CCTTGTACTCAGTTGAACTTTGG - Intergenic
983095109 4:163552285-163552307 CCATGTGTCCAGATGGACCTGGG + Intronic
987061765 5:14250175-14250197 CTTTGTGCAAAGATGAACTGTGG - Intronic
989536627 5:42571941-42571963 ACTTCTGCACAGTTGAACTTGGG - Intronic
999269653 5:150289446-150289468 CCTTGTACACAGATGAAGGCAGG - Intronic
1001479889 5:172081527-172081549 CCTTAGGCACAGATATACCTCGG - Intronic
1005494996 6:26380680-26380702 CCTCCTGCTCAGATGAACTTTGG + Intergenic
1005796679 6:29370132-29370154 CATTGAGCACACATGAACATAGG - Intronic
1008087739 6:47262102-47262124 CCGTAAGCTCAGATGAACCTTGG + Intronic
1011797550 6:90973767-90973789 CCTTGTGCAGTGACAAACCTTGG + Intergenic
1011829925 6:91359225-91359247 CCTTGTGGCCAGTTGAACATGGG + Intergenic
1013916260 6:115340758-115340780 CCTTATGCAAAGAGGAAACTTGG + Intergenic
1015061132 6:128967915-128967937 CCTTGAGCAACGATGGACCTGGG - Intronic
1018123603 6:160660568-160660590 CCCTGTGTAGAAATGAACCTTGG + Intronic
1019261927 7:86597-86619 CCTTGAGCTAAGATGAACTTAGG - Intergenic
1019550119 7:1597959-1597981 CCTTCTGCCCAGCTGAGCCTGGG - Intergenic
1032386915 7:131531470-131531492 GCATGTGCTCAGGTGAACCTTGG + Intronic
1032850555 7:135791572-135791594 CCTTGTGCACAGAAGTCCCAGGG + Intergenic
1034680098 7:152922095-152922117 CCTGGTGGACAAATCAACCTGGG + Intergenic
1035876270 8:3193223-3193245 ACTTGTGTACAAATGACCCTTGG - Intronic
1036623713 8:10446745-10446767 CCTTGTGGACAAACTAACCTAGG - Intergenic
1037574839 8:20192078-20192100 CCTTATGCACAGTGTAACCTTGG - Intergenic
1037643967 8:20773489-20773511 CCATGTGCACAGCTGGACCTGGG + Intergenic
1038143064 8:24867264-24867286 CCTTGTACATAGAAGAATCTTGG + Intergenic
1041350348 8:56942121-56942143 CCTTATGCAGATATTAACCTGGG - Intergenic
1041769503 8:61457645-61457667 CCTTGTGCCCACATCACCCTAGG + Intronic
1042062042 8:64829812-64829834 CCTTGAGAACAGATAAATCTAGG - Intergenic
1043593394 8:81855947-81855969 CACTGTGCACAGATGAAACATGG - Intergenic
1044602580 8:94020414-94020436 CCCAGTCGACAGATGAACCTGGG - Intergenic
1047543710 8:125795938-125795960 GCTTGTGCACAGAGAAACTTGGG - Intergenic
1048832696 8:138492106-138492128 CCTTGTGCACAGTAGACACTGGG + Intronic
1049309120 8:141924070-141924092 CCTTCTGTACAGCTAAACCTTGG + Intergenic
1049815455 8:144597076-144597098 CCTTGGGCACAGATTAACCAGGG - Intronic
1053054914 9:34988495-34988517 CCTCGAGCACAGATGGGCCTGGG + Intergenic
1055623652 9:78150600-78150622 AGTTGTCCACAGATGCACCTGGG + Intergenic
1056074507 9:83024671-83024693 CCTTGTGAATAGATCAACCTTGG + Intronic
1057957960 9:99426480-99426502 CCTGGTGCACAGATGAGATTTGG - Intergenic
1186094928 X:6090102-6090124 CCTCCTGCAGAGATGAAGCTGGG + Intronic
1186205014 X:7191741-7191763 CCTCCTGCAGGGATGAACCTGGG - Intergenic
1186996173 X:15125517-15125539 ACTTGGGCACAGATACACCTTGG - Intergenic
1188929625 X:36091077-36091099 TCTTGTGCACTGATGAAGTTAGG + Intronic
1193075406 X:77349745-77349767 CCTTGTGCAAAGATGCACATAGG + Intergenic
1194618121 X:96132882-96132904 CTTGTTGCACAGCTGAACCTGGG - Intergenic