ID: 1184256704

View in Genome Browser
Species Human (GRCh38)
Location 22:43291034-43291056
Sequence GGCTGTACTCACCATTGGAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 105}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184256698_1184256704 10 Left 1184256698 22:43291001-43291023 CCATCCTGGGGGGGGACATGCCT 0: 1
1: 0
2: 3
3: 16
4: 146
Right 1184256704 22:43291034-43291056 GGCTGTACTCACCATTGGAGCGG 0: 1
1: 0
2: 0
3: 5
4: 105
1184256702_1184256704 -10 Left 1184256702 22:43291021-43291043 CCTGGTCAGCATAGGCTGTACTC 0: 1
1: 0
2: 2
3: 6
4: 91
Right 1184256704 22:43291034-43291056 GGCTGTACTCACCATTGGAGCGG 0: 1
1: 0
2: 0
3: 5
4: 105
1184256700_1184256704 6 Left 1184256700 22:43291005-43291027 CCTGGGGGGGGACATGCCTGGTC 0: 1
1: 0
2: 0
3: 17
4: 177
Right 1184256704 22:43291034-43291056 GGCTGTACTCACCATTGGAGCGG 0: 1
1: 0
2: 0
3: 5
4: 105
1184256697_1184256704 11 Left 1184256697 22:43291000-43291022 CCCATCCTGGGGGGGGACATGCC 0: 1
1: 0
2: 0
3: 7
4: 77
Right 1184256704 22:43291034-43291056 GGCTGTACTCACCATTGGAGCGG 0: 1
1: 0
2: 0
3: 5
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184256704 Original CRISPR GGCTGTACTCACCATTGGAG CGG Exonic
903191991 1:21662090-21662112 GGCTGCACCCTGCATTGGAGTGG - Intronic
903318954 1:22530209-22530231 TGCTGAACTCACCCTTGGGGAGG - Exonic
911874906 1:103148469-103148491 GGCTGTAATCACACTTTGAGAGG + Intergenic
912202780 1:107477185-107477207 GGCTCTACTCAGCATTTCAGAGG - Intronic
915340117 1:155172879-155172901 GCCCGTACCCACCACTGGAGGGG + Exonic
918337142 1:183528017-183528039 AGGTCCACTCACCATTGGAGGGG - Exonic
919511558 1:198471992-198472014 GGCAGTACTCACCATGGGCTTGG + Intergenic
921989049 1:221344462-221344484 TTCTGTACTGACCATTTGAGTGG + Intergenic
923990902 1:239435957-239435979 GGCTGTGCTCACCATTAAAGTGG + Intronic
923991101 1:239437704-239437726 GCCTGTGCACACCATTGAAGTGG + Intronic
1063117550 10:3082543-3082565 GGCTGTGCTCAGCATGGGGGAGG - Intronic
1065135389 10:22662776-22662798 GGGTGTCCTCACCATTGTGGCGG - Intronic
1067727569 10:48782134-48782156 GGCTGGACTTATCATTAGAGAGG + Intronic
1068392351 10:56414448-56414470 GGCAGTACTCACCATGGGCCTGG - Intergenic
1072319970 10:94239609-94239631 GGCAGTAATCACCATTTCAGAGG + Intronic
1075822005 10:125322605-125322627 GGCTGTATTTGCCATTGTAGGGG + Intergenic
1076923463 10:133467542-133467564 GGCTGGAGTCCCCATCGGAGAGG + Intergenic
1077615016 11:3668188-3668210 TGCTGTACCCATCATGGGAGAGG - Intronic
1085286285 11:75363808-75363830 GGCAGTCCCCACCATGGGAGAGG - Intergenic
1091695059 12:2622812-2622834 GGCTGCCCTGACCATTGTAGGGG - Intronic
1093123423 12:15300123-15300145 GGCTGTACACAACAGGGGAGAGG + Intronic
1095279314 12:40331816-40331838 GGAGGTACTCACCATAGGATTGG + Intronic
1095642938 12:44505612-44505634 GTCTGCAGTCACCATTGCAGTGG - Intergenic
1098847981 12:75561553-75561575 GGCTGTTCTCACGCTAGGAGAGG - Intergenic
1103486145 12:121284029-121284051 GCCTGTCCTCAGCTTTGGAGAGG - Intronic
1105986622 13:25573605-25573627 GGCTGTTCTGACTATTGGCGAGG - Intronic
1106578733 13:30999800-30999822 GGCTGTACTGACCATGGGGCAGG + Intergenic
1108066556 13:46583561-46583583 GTCAGTACTCACCTTTGGACAGG + Intronic
1110053446 13:70934796-70934818 GCCTGTACTGACTAGTGGAGAGG + Intergenic
1118810793 14:69271556-69271578 GACTGTGCTCACCAGTGCAGTGG + Intronic
1122892956 14:104741519-104741541 GGCTGTACAGACCATCGGAAGGG - Intronic
1123092271 14:105747150-105747172 GGCTGTGGTCAGCAGTGGAGAGG - Intergenic
1128609536 15:69062939-69062961 GGATGTTCTCACCCTTGCAGGGG - Intergenic
1129561801 15:76578062-76578084 GGCAGTACTCACCATAGGCCTGG + Intronic
1131856536 15:96603070-96603092 GTCTGTATTCACCAGTAGAGAGG - Intergenic
1135022096 16:18971245-18971267 AGCTGTTGTCAGCATTGGAGGGG - Intergenic
1137367123 16:47870316-47870338 GGTGGTACTCAGCAGTGGAGTGG - Intergenic
1138697290 16:58826464-58826486 GGCTGTGGACAGCATTGGAGAGG + Intergenic
1139211504 16:65082310-65082332 AACTGTGCTCACCATTGGACTGG + Intronic
1140342019 16:74173756-74173778 GGCTCTACTCCCCATTGTGGTGG - Intergenic
1142668969 17:1478666-1478688 GGCTGTACACAGCCTTGGCGAGG + Exonic
1143058075 17:4177370-4177392 AGCTGAACTGACCACTGGAGAGG + Intronic
1149866763 17:60155357-60155379 GGCTGTACTCACCCAAGCAGGGG - Exonic
1150292459 17:63989356-63989378 TGCAGTACTCACTATTGGACGGG + Intergenic
1150308163 17:64104344-64104366 TGCTGTACTTACCATTGCAGGGG - Intronic
1151427497 17:74040567-74040589 GCCAGCACTCACCAGTGGAGAGG + Intergenic
1151699180 17:75733682-75733704 TGTTGTGCTCACCATTGCAGAGG - Exonic
1153448343 18:5197865-5197887 GGCTGTTCTCACACTTGCAGGGG - Intergenic
1155345488 18:24853074-24853096 GGCTGGGCTCACCTTGGGAGGGG + Intergenic
1157480702 18:48051779-48051801 GGCGGGACACACCAATGGAGAGG + Intronic
1159628594 18:70723218-70723240 GGCAGTAAACACCATTTGAGAGG + Intergenic
1159763829 18:72461275-72461297 GGCTGTAGACATCTTTGGAGGGG - Intergenic
925427209 2:3759996-3760018 AGCTGTACTTAACATTCGAGTGG + Intronic
925610202 2:5696126-5696148 GGCTGTCCCCACCCTTTGAGAGG - Exonic
929748951 2:44689903-44689925 AGCTGTGCTCAATATTGGAGAGG + Intronic
935127758 2:100239372-100239394 GACTGTGCTGACCCTTGGAGGGG - Intergenic
936805586 2:116328014-116328036 CTCTGTACTCACCATAGGAAGGG - Intergenic
943237196 2:185337821-185337843 GGCAGTACTCACCATGGGCCTGG - Intergenic
949002934 2:241627834-241627856 GCCTGGCCTCACCTTTGGAGGGG + Intronic
1170293995 20:14804625-14804647 GGCTGTACTGACCTGTGGTGGGG + Intronic
1170571460 20:17635140-17635162 GGCTGTACTCAACTCCGGAGGGG + Intronic
1171416862 20:24987836-24987858 GGGTGTCCTAGCCATTGGAGTGG - Intronic
1172480245 20:35267262-35267284 GGATCCACTCACCATCGGAGAGG + Exonic
1172759533 20:37312307-37312329 AGCTGTACTTACCATTCCAGAGG + Intronic
1173634972 20:44547565-44547587 GGCTGTACTCACCATGTGTGAGG - Intronic
1178181385 21:30166080-30166102 TGCTGTCCTCTTCATTGGAGGGG - Exonic
1180597544 22:16988473-16988495 GGCAGCACTCACCACTGCAGAGG - Intronic
1181306432 22:21919861-21919883 CGCTGGGCTCACCATAGGAGAGG + Exonic
1183746249 22:39693746-39693768 GGCTGGATTCACCCTTGGATGGG + Intergenic
1184256704 22:43291034-43291056 GGCTGTACTCACCATTGGAGCGG + Exonic
1184567602 22:45301496-45301518 GGATGTTATCACCATTGCAGTGG - Intergenic
949103619 3:176871-176893 AGCTGAACTCACCAATAGAGAGG + Intergenic
954426341 3:50445202-50445224 TGCTGAACACACCATTGGAAGGG + Intronic
955240532 3:57174126-57174148 GGGTGTCCTCTCCATTGCAGGGG + Intergenic
955768447 3:62368396-62368418 GGTTGTAGTCACCGTTCGAGAGG + Intergenic
958452950 3:94296540-94296562 GGCTGTAATCTCCAATGGGGTGG - Intergenic
958760201 3:98297253-98297275 GGCAGTACTCATCATGGGACTGG + Intergenic
959529111 3:107412157-107412179 AGCTGTAATCACTATTGCAGTGG + Intergenic
959900093 3:111651292-111651314 ATCTGTATTCAGCATTGGAGGGG - Exonic
965607040 3:170507912-170507934 GGCTGTACTGAGCATGGGAATGG + Intronic
967240978 3:187439343-187439365 GCCTTTTCTCACCATTGGAAAGG + Intergenic
968636261 4:1681841-1681863 GCCTGTTCTCACCAGTGGAGTGG - Intronic
969250573 4:5965651-5965673 GCCTGTTCTCACAGTTGGAGAGG - Intronic
970350218 4:15194952-15194974 GCCTGTCCTCACCATTGATGTGG - Intergenic
970915497 4:21328858-21328880 GGTGGTACTCACCATTGGCCTGG - Intronic
972855391 4:43099382-43099404 GGCTTTACTCTCTATCGGAGGGG - Intergenic
974307088 4:60156182-60156204 GGCAGTATTCACCATTGCTGAGG - Intergenic
974699650 4:65424052-65424074 GGTGGGACTCACCATTAGAGTGG - Intronic
977166883 4:93710868-93710890 GGCAGTACTCACCATGGGCCTGG - Intronic
977259605 4:94783023-94783045 GGTTGCACCCACCATTAGAGAGG - Intronic
984115779 4:175679547-175679569 GGCAATACTCATCATTGGATGGG - Intronic
985092552 4:186378994-186379016 GGTTGTACTTCTCATTGGAGTGG + Intergenic
987723368 5:21665723-21665745 GGCTTTACTCCACATGGGAGTGG - Intergenic
1005964582 6:30717944-30717966 GGCTGTCCCCACCTTTCGAGGGG + Intergenic
1009626900 6:66146173-66146195 TGCTGCACTCACCGTTGGGGAGG + Intergenic
1017010593 6:150060767-150060789 AGGTGGTCTCACCATTGGAGGGG - Intergenic
1018235305 6:161717875-161717897 GGCTCCACTCACCATGGAAGGGG - Intronic
1019797953 7:3065896-3065918 GGATGAAGTCACCAATGGAGGGG - Intergenic
1021215768 7:17913383-17913405 GGGTGTGCTCACCTTTGGTGAGG - Intronic
1021390232 7:20084055-20084077 TGCTCTGTTCACCATTGGAGGGG - Intergenic
1028299506 7:89180440-89180462 GGCAGTACCCACCATTGGCCTGG - Intronic
1029203439 7:98854387-98854409 GGCTGTATTCACCATGGGCATGG - Intronic
1031373276 7:120994071-120994093 GGCATTACTCACCATTGTTGTGG - Intronic
1033541012 7:142356204-142356226 GGCTGTACTATATATTGGAGAGG - Intergenic
1035643261 8:1199899-1199921 GGCTGTCATCACCAGGGGAGGGG - Intergenic
1042483306 8:69326787-69326809 GGCTGCACTCATCATAGCAGTGG - Intergenic
1044026884 8:87184028-87184050 GTCTGTGCTCACCACTGGGGTGG + Intronic
1047352385 8:124088311-124088333 GGCAGTACTCACCATGGGACTGG - Intronic
1188191993 X:27182755-27182777 AGCAGTACTCACCATGGGATGGG + Intergenic
1197025035 X:121738176-121738198 GGCAGTACTCACCATGGGCTTGG + Intergenic
1200091125 X:153636537-153636559 GGCTGGGCTCACCACTGCAGCGG + Intergenic