ID: 1184259495

View in Genome Browser
Species Human (GRCh38)
Location 22:43306542-43306564
Sequence ACGAACACACACTCCTACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184259494_1184259495 -1 Left 1184259494 22:43306520-43306542 CCAGTGGAGGGAGGATGGGATCA 0: 1
1: 0
2: 4
3: 16
4: 268
Right 1184259495 22:43306542-43306564 ACGAACACACACTCCTACCAAGG 0: 1
1: 0
2: 0
3: 12
4: 140
1184259487_1184259495 26 Left 1184259487 22:43306493-43306515 CCAGGCACAGTGACAACAGATTT 0: 1
1: 0
2: 1
3: 24
4: 234
Right 1184259495 22:43306542-43306564 ACGAACACACACTCCTACCAAGG 0: 1
1: 0
2: 0
3: 12
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184259495 Original CRISPR ACGAACACACACTCCTACCA AGG Intronic
900593716 1:3471109-3471131 ACGCACACACACCCCTGCCCAGG - Intronic
905110246 1:35589611-35589633 AGGGCCACACACACCTACCAGGG - Intronic
905585977 1:39118664-39118686 ACGACCACATACTCATGCCAAGG - Intronic
906435288 1:45790362-45790384 ACGCACACACACCCCCACAATGG - Intronic
908165312 1:61451628-61451650 ACAAATCCACACTCCCACCAAGG - Intronic
908720571 1:67120974-67120996 AGGAACACATTCTCCAACCAAGG - Intronic
909844430 1:80374035-80374057 ATGAATACACACTCCTAAGAAGG - Intergenic
910814592 1:91277498-91277520 ACACACACACACACCCACCAGGG - Intronic
916421099 1:164638582-164638604 ACTCACACACACTCACACCATGG + Intronic
918202830 1:182283211-182283233 ACAAACACAAATGCCTACCAAGG - Intergenic
918960029 1:191262698-191262720 ACATACACACACACCCACCATGG + Intergenic
921325958 1:213986498-213986520 ACACACACACACTCCTTCCTAGG - Intronic
923111990 1:230898380-230898402 AGGAACTCACAGTCCTAACAGGG - Intergenic
1063416169 10:5874265-5874287 ACTAACACCCACTTCCACCAGGG - Intronic
1071867846 10:89756095-89756117 AAGGACACACACTTCAACCAAGG - Intronic
1071892928 10:90031671-90031693 ACACACACACACTCACACCAAGG + Intergenic
1074099412 10:110342571-110342593 AGGAACACAGAGTCCTAGCAGGG - Intergenic
1079063914 11:17273442-17273464 CCAAGCACACATTCCTACCAGGG - Intronic
1079162849 11:18011156-18011178 ACACACACACACCCCTAACAAGG + Intronic
1079374841 11:19882607-19882629 AAGAAAACAAACGCCTACCATGG - Intronic
1079627099 11:22628992-22629014 ACACACACACACACATACCATGG - Intronic
1082106935 11:48230535-48230557 ATGAACTAAAACTCCTACCATGG - Intergenic
1084755796 11:71237889-71237911 ATGAACACACACCACTACCCAGG + Intronic
1084761888 11:71278566-71278588 AGCAACACACAGGCCTACCATGG - Intergenic
1085045955 11:73353536-73353558 ACCAACGCACTCTCCTACCAGGG - Intronic
1086140659 11:83495216-83495238 ACAGACACACACATCTACCACGG - Intronic
1088302202 11:108371176-108371198 ATGAACACACACTTATATCATGG - Intronic
1091385467 12:91945-91967 AGGAACACAGCCTCCTACCCTGG + Intronic
1091935830 12:4433903-4433925 ATGCACACAAACTCCTACCCTGG + Intronic
1098020422 12:66149892-66149914 ACACACACACACTCCTACTAGGG + Intronic
1099677283 12:85778003-85778025 ACAAGGACACACTCCTACAATGG - Intergenic
1099860296 12:88217982-88218004 GGGAACTCACACTTCTACCATGG + Intergenic
1102926421 12:116829535-116829557 ACGTACACCCACATCTACCAAGG - Intronic
1104181210 12:126383187-126383209 ACAAACACACACGCACACCATGG + Intergenic
1105636204 13:22217798-22217820 ACGCACACACACTCATGTCATGG + Intergenic
1106433167 13:29701712-29701734 ACACACACACACACATACCATGG + Intergenic
1108835494 13:54541693-54541715 ACACACACACACCCCTACCAAGG - Intergenic
1110030325 13:70603466-70603488 ACTAATTTACACTCCTACCACGG - Intergenic
1111293825 13:86254753-86254775 ACAAACACACACTCCTAAAAAGG + Intergenic
1112773803 13:102822433-102822455 ACAAACACACACACACACCACGG - Intronic
1116317007 14:43410288-43410310 ACAGACACACACACATACCATGG - Intergenic
1117340013 14:54784612-54784634 AAGAACACACTCACCTCCCAGGG - Exonic
1119411251 14:74432132-74432154 ACACACACACACACCTTCCAAGG - Intergenic
1122143492 14:99675799-99675821 CCCAACACACACTCCTGCCTTGG - Exonic
1125259434 15:37805891-37805913 ATGAACACATACTCCCACGAAGG - Intergenic
1127495377 15:59506355-59506377 AAGAGCACAGACTCCCACCATGG - Intronic
1127809229 15:62548970-62548992 ACCATTACACACTCCTATCAAGG - Intronic
1130101907 15:80900575-80900597 ACACACACACACCCCTACCTGGG - Intronic
1134366896 16:13587475-13587497 ACACACACACACACATACCATGG + Intergenic
1135124920 16:19800976-19800998 ACAAACACACACTCCTAAAAAGG - Intronic
1136778745 16:32884811-32884833 ACGAACACACACACACACAATGG - Intergenic
1138867118 16:60835248-60835270 ACACACACACACCCCTATCAAGG - Intergenic
1139128430 16:64110370-64110392 ACACACACACACTTCTAACATGG - Intergenic
1203081160 16_KI270728v1_random:1146900-1146922 ACGAACACACACACACACAATGG - Intergenic
1145031851 17:19510481-19510503 ACGACCACCCATTCCCACCACGG + Intronic
1147904488 17:43813979-43814001 ACAAACACACACTCCCACATGGG + Intronic
1149922111 17:60669643-60669665 GCTAAAAGACACTCCTACCAGGG - Intergenic
1151901255 17:77016828-77016850 GCTAAAAGACACTCCTACCAGGG - Intergenic
1156284245 18:35675244-35675266 ACAAACACACACCCCTAACCTGG - Intronic
1156693414 18:39736266-39736288 ACAAACACACACACACACCAGGG + Intergenic
1158514124 18:58116939-58116961 ACCCTCACACACTCCAACCAGGG - Intronic
1158835558 18:61327848-61327870 ACCAACAATCACTCCTTCCATGG + Intergenic
1161911497 19:7197951-7197973 ACACACACACACTCCCACCATGG - Intronic
1161911503 19:7197976-7197998 ACACACACACACTCCCACCATGG - Intronic
1162028789 19:7908655-7908677 ACGGCTACACACACCTACCAAGG - Intronic
1162554241 19:11376687-11376709 AAAAACACACACACGTACCAGGG - Exonic
930729325 2:54712551-54712573 AAGAAAACCCACTCCTAGCACGG - Intergenic
930901296 2:56510520-56510542 ACCCACACACTCTCCTAACATGG + Intergenic
930984165 2:57564582-57564604 ACACACACACACCCCTATCATGG - Intergenic
931184444 2:59936452-59936474 ACACACACACACTCCTTCCTAGG - Intergenic
936960394 2:118067426-118067448 ACAAACACACACACCAACCTAGG - Intergenic
937726838 2:125176512-125176534 AGGGACACACATTCCTCCCATGG - Intergenic
940549522 2:155135411-155135433 ACACACACACACACCTATCAGGG + Intergenic
942276509 2:174327406-174327428 ACAAACAGACACACTTACCAGGG - Intergenic
942985534 2:182136400-182136422 ACAAACACACACACATACTAAGG + Intergenic
943639444 2:190343173-190343195 ACCAACACCCATTCCTACCTAGG + Intronic
945536074 2:211019456-211019478 ACACACACACACCCCCACCATGG - Intergenic
947916640 2:233836520-233836542 ACGCACACACACACATAACATGG + Intronic
948518576 2:238521813-238521835 ACGACCACAGGCTCCCACCACGG - Intergenic
948727930 2:239946092-239946114 CCGAACACACACAGCTGCCAAGG - Intronic
1172055999 20:32154798-32154820 AGGTAGACACACTCCTCCCAAGG + Intronic
1174417009 20:50374086-50374108 AAGCACACACACTCATGCCAGGG + Intergenic
1174810104 20:53638204-53638226 ACACACACACACACCTGCCATGG - Intergenic
1175436492 20:58954789-58954811 ACACACACACACGCATACCATGG + Intergenic
1177228777 21:18292047-18292069 ACGAGGACACATTCCTACAATGG + Intronic
1183707167 22:39481176-39481198 GCGCACATACACTCCTGCCAGGG + Intronic
1183738283 22:39655903-39655925 CCACGCACACACTCCTACCAGGG - Intronic
1184259495 22:43306542-43306564 ACGAACACACACTCCTACCAAGG + Intronic
955450326 3:59059193-59059215 ACACACACACACACATACCATGG - Intergenic
955864727 3:63371172-63371194 AGGAACCCACACTTCTACCATGG + Intronic
957713495 3:83894761-83894783 ACACACATACACCCCTACCAAGG + Intergenic
959024735 3:101228020-101228042 ACGAACAAACACTTCCACGAAGG + Intronic
962144517 3:132825972-132825994 ACACACACACACACATACCATGG - Intergenic
962748888 3:138418246-138418268 ACACACACACAGTCCTACCATGG + Intergenic
963343335 3:144064318-144064340 ACAAACACACACTCCACCCGTGG - Intergenic
963999574 3:151753792-151753814 AATAACACACACTCAAACCAGGG + Intronic
964829681 3:160870101-160870123 ACCCACACACACTTCTCCCATGG - Intronic
966612649 3:181883190-181883212 ACACACACACACTCCTCACAAGG + Intergenic
966686751 3:182703746-182703768 CCGAACACACACCCCAACTAGGG - Intergenic
967173397 3:186841891-186841913 ACACACACACACACATACCAAGG + Intergenic
972671281 4:41215503-41215525 ACACACACACAGTCCTACCAAGG + Intronic
972977191 4:44650521-44650543 ACACACACACACTTGTACCAAGG + Intronic
974340152 4:60604087-60604109 AGGAAAACACACTTCTCCCATGG - Intergenic
977372942 4:96163406-96163428 ACACACACACACTCCTATTATGG - Intergenic
977862896 4:101987583-101987605 ACAAAGATACACTCCTGCCAAGG - Intronic
979610517 4:122684217-122684239 ACTAATACACCCCCCTACCAGGG + Intergenic
984199867 4:176705204-176705226 ATAAACAAACACTACTACCAAGG + Intronic
985672021 5:1211525-1211547 ACGAGCACACATTCCTACACAGG - Intronic
985822776 5:2171315-2171337 AGGGACAGACACTCCAACCATGG - Intergenic
991212834 5:64126488-64126510 ATGAACATACACTTCTAACATGG - Intergenic
992395651 5:76367355-76367377 ACGCACACACACTGCTCTCAAGG - Intergenic
994653518 5:102560313-102560335 ACTAATTTACACTCCTACCAAGG - Intergenic
994706104 5:103208404-103208426 AAGCTCACACAATCCTACCAAGG + Intronic
997955329 5:138274536-138274558 ACGCACACACTCTCCCACCAGGG + Exonic
998492742 5:142561164-142561186 ACAAACCCAAACTTCTACCAGGG - Intergenic
1202774885 5_GL000208v1_random:60252-60274 AGAAACACAAACTACTACCAGGG - Intergenic
1003415216 6:5901275-5901297 ACAAACACATACACATACCATGG + Intergenic
1004497434 6:16177822-16177844 ATGAAATCACACTCCTAGCATGG - Intergenic
1007630526 6:43270670-43270692 ACAGACACCCAATCCTACCAGGG - Intronic
1009324064 6:62328414-62328436 ACACACACACACACCTTCCAAGG + Intergenic
1010500772 6:76596887-76596909 ACACACACACACCCCAACCATGG + Intergenic
1011022418 6:82829164-82829186 ACACACACACACTCATACCCAGG + Intergenic
1012547474 6:100436012-100436034 ACACACACACACCCCTCCCAAGG + Intronic
1015336522 6:132045442-132045464 ACACACACACACACATACCATGG + Intergenic
1018776183 6:167018376-167018398 ACACACACACACACATACCATGG - Intronic
1021715330 7:23456614-23456636 AGGAACACACTCTTCTACCATGG - Intronic
1022879399 7:34570239-34570261 GCTAAAACACACTCCCACCAGGG - Intergenic
1023723069 7:43114468-43114490 AGGCACACACATTCATACCAGGG - Intronic
1027218559 7:76199909-76199931 ACAAACATACACTCAGACCAAGG + Intergenic
1029513893 7:101013923-101013945 ACGAACACACACTGGTACTGGGG + Exonic
1031155130 7:118101025-118101047 ACGCACACACACACACACCATGG - Intergenic
1031359314 7:120828263-120828285 GGGAATAGACACTCCTACCAGGG + Intronic
1034456945 7:151175764-151175786 ATGAAGACACACTCCTACTGGGG - Exonic
1035028157 7:155840323-155840345 ACACACACACACACCTAGCAAGG + Intergenic
1036508204 8:9375668-9375690 ACACACACACACTCCTACATTGG - Intergenic
1038182132 8:25239381-25239403 CCAAACACAAACACCTACCAAGG - Intronic
1038677569 8:29637284-29637306 ACATACACACACACATACCATGG + Intergenic
1039000766 8:32977438-32977460 ACACACACACACACCCACCATGG - Intergenic
1042846872 8:73177256-73177278 ACGAACACACACTGGTATCTAGG + Intergenic
1042847105 8:73179287-73179309 ACACACACACACCCCTACCTGGG - Intergenic
1043190119 8:77210042-77210064 ACAAACACACACACATACAAAGG - Intergenic
1049913455 9:293268-293290 CCTAGCACACACTCCTCCCAGGG + Intronic
1050671103 9:7997916-7997938 ACAAACACACATTACTCCCATGG + Intergenic
1051361016 9:16281779-16281801 AAGCACCCACACTCCTATCATGG + Intergenic
1062234981 9:135503453-135503475 AGGAACACAGACGCCCACCAGGG - Intronic
1190062569 X:47220534-47220556 ACAAACACACTGTTCTACCATGG - Intronic
1192069181 X:67918685-67918707 CCGAACACACACCCCCACTAGGG - Intergenic
1192133078 X:68571133-68571155 AAGTACACTCACTCCTCCCAAGG - Intergenic
1194701608 X:97120317-97120339 CCGAACACACACCCCTACTGGGG - Intronic
1195541142 X:106064463-106064485 ACAAATACACACTCCCACAATGG - Intergenic
1200101064 X:153689230-153689252 ACGAACACACACACACACAATGG + Intronic
1200796078 Y:7342440-7342462 ACTAAAAGACACTCCCACCAGGG - Intergenic
1201287937 Y:12395011-12395033 ACTAAGAGACACTCCCACCAGGG + Intergenic