ID: 1184259560

View in Genome Browser
Species Human (GRCh38)
Location 22:43306851-43306873
Sequence CCAGGCACGGAGAAGTGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 200}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184259549_1184259560 23 Left 1184259549 22:43306805-43306827 CCCAAGTCCATGCTCTCCCTGTG No data
Right 1184259560 22:43306851-43306873 CCAGGCACGGAGAAGTGGACTGG 0: 1
1: 0
2: 2
3: 14
4: 200
1184259552_1184259560 7 Left 1184259552 22:43306821-43306843 CCCTGTGTCTAGAGCAGAGACCA 0: 1
1: 0
2: 1
3: 16
4: 193
Right 1184259560 22:43306851-43306873 CCAGGCACGGAGAAGTGGACTGG 0: 1
1: 0
2: 2
3: 14
4: 200
1184259551_1184259560 16 Left 1184259551 22:43306812-43306834 CCATGCTCTCCCTGTGTCTAGAG 0: 1
1: 0
2: 3
3: 22
4: 289
Right 1184259560 22:43306851-43306873 CCAGGCACGGAGAAGTGGACTGG 0: 1
1: 0
2: 2
3: 14
4: 200
1184259550_1184259560 22 Left 1184259550 22:43306806-43306828 CCAAGTCCATGCTCTCCCTGTGT No data
Right 1184259560 22:43306851-43306873 CCAGGCACGGAGAAGTGGACTGG 0: 1
1: 0
2: 2
3: 14
4: 200
1184259553_1184259560 6 Left 1184259553 22:43306822-43306844 CCTGTGTCTAGAGCAGAGACCAG 0: 1
1: 0
2: 2
3: 24
4: 204
Right 1184259560 22:43306851-43306873 CCAGGCACGGAGAAGTGGACTGG 0: 1
1: 0
2: 2
3: 14
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184259560 Original CRISPR CCAGGCACGGAGAAGTGGAC TGG Intronic
901129896 1:6955672-6955694 CCAGGCACGGAGCTAGGGACCGG - Intronic
903223350 1:21881098-21881120 CCAGGCATGGGGGAGTGGTCAGG + Intronic
903654775 1:24942571-24942593 CCAGGAAGGGAGAAGGGGGCTGG + Intronic
904586626 1:31584391-31584413 CCAGGCACAGAGAAGTGGCCAGG - Intronic
904812585 1:33172996-33173018 CCAGACATGGAGAAGAGGAGAGG - Intronic
906533878 1:46540697-46540719 CCAGGCAAGGAGAAGTCTCCAGG - Intergenic
906608842 1:47188659-47188681 CCAGGCTCGGAGAAGAGGTCAGG - Intronic
907526185 1:55055460-55055482 CCAGGCACAGAGAAGGGCCCGGG + Intronic
908477810 1:64506000-64506022 GCAGGCAGGTAGAAGTGGAAGGG - Intronic
912372474 1:109184756-109184778 CAAGGGAGGGAGAAGTGGCCTGG - Intronic
912512453 1:110198485-110198507 CCAGGCCTGGACAAGTGGGCAGG - Exonic
912523045 1:110259605-110259627 CCAGGCAGGAAGAAGGGGAAGGG - Intronic
913547631 1:119885356-119885378 ACAGGCATGGGGAAGTGGACGGG - Intergenic
913556547 1:119972891-119972913 ACAGACATGGGGAAGTGGACAGG + Intronic
913996971 1:143659417-143659439 CCTGAAACAGAGAAGTGGACAGG - Intergenic
914790758 1:150875971-150875993 CCGGGGACGGAGACGGGGACGGG + Intronic
915348879 1:155212460-155212482 CCAGGCAGGAAGAAGTTGAGGGG - Exonic
915352068 1:155233086-155233108 CCAGGCAGGAAGAAGTTGAGGGG - Intergenic
916576526 1:166071903-166071925 TCAGTCATGGAGAACTGGACTGG + Intronic
918569858 1:185976906-185976928 CCAGGCAAGGAGAAATATACAGG - Intronic
920349497 1:205328583-205328605 CCAGGCACGGGGAAGGGGGGTGG - Intergenic
920417815 1:205810443-205810465 ACAGGCACGGAGGAGGGGAAGGG + Exonic
922606421 1:226892474-226892496 CCTGGCACGCAGCAGTGGGCTGG - Intronic
922757548 1:228105046-228105068 CCAGGCACACAGAAGGTGACTGG + Intronic
1063467344 10:6255750-6255772 CCAGGCTCAGAGAAGCGGACTGG + Intergenic
1064692701 10:17934013-17934035 CCAGGCTGGAAGAAGTGGAATGG - Intergenic
1070637859 10:78143614-78143636 CCAGGCAGGAAGAAGAGGAAGGG + Intergenic
1075283415 10:121161310-121161332 GCAGGCAGTGAGAAGTGGTCAGG - Intergenic
1075333897 10:121595800-121595822 CCAGGCAGAGAAAGGTGGACAGG + Intronic
1075531521 10:123234161-123234183 CCAGGCACAGACATGTGCACAGG + Intergenic
1075891167 10:125952566-125952588 CCAGGCACAGAGAAGTGCTTTGG - Intronic
1076291355 10:129348432-129348454 CCCGGCTCGGAGGGGTGGACTGG - Intergenic
1076291371 10:129348483-129348505 CCTGGCTCGGAGGAGTGGATTGG - Intergenic
1076291399 10:129348584-129348606 CCTGGCTCGGAGGGGTGGACTGG - Intergenic
1076522107 10:131087807-131087829 CCAGGCAGAGAGAGGTGGCCGGG + Intergenic
1076777449 10:132705557-132705579 CCAGGCCGGGAGGAGTGTACAGG + Intronic
1077413217 11:2413096-2413118 CCAGGCAGGGTGGAGGGGACTGG - Intronic
1083362982 11:62124213-62124235 ACAGGGACGGAGCAGAGGACCGG - Intronic
1084838610 11:71826450-71826472 CCAAGCACTGAGATGTGAACTGG - Intergenic
1085050055 11:73375792-73375814 CCTGGCACAGAGAAGTGGTGCGG + Intergenic
1085205110 11:74726990-74727012 CCTGCCAGGGAGGAGTGGACAGG - Intronic
1088325493 11:108596602-108596624 ACAGGGATGGAGAAGTAGACTGG + Intergenic
1089775322 11:120831758-120831780 GAAGGCACGGAGATGTGGGCTGG - Intronic
1091702677 12:2674280-2674302 ACAGGCAGGGGGAAGGGGACAGG + Intronic
1092360707 12:7833828-7833850 CCAGGCAAGGTGAAGACGACTGG - Intronic
1092373248 12:7934580-7934602 CCAGGCAAGGTGAAGATGACCGG - Intronic
1092400079 12:8167643-8167665 CCAAGCACTGAGATGTGAACTGG + Intronic
1095314323 12:40741017-40741039 CCAGGCAGTGAGAAATGGCCAGG - Intronic
1097601037 12:61694118-61694140 CCAGGCAAGGTGAAGAGGCCAGG - Intergenic
1113618794 13:111699307-111699329 CCAGGCCGGGAAAAGTGAACGGG - Intergenic
1113624323 13:111784568-111784590 CCAGGCCGGGAAAAGTGAACGGG - Intergenic
1113678295 13:112223241-112223263 CCTGGCACGGGGAAGTGGCATGG - Intergenic
1114614866 14:24062937-24062959 CCAGGCACAGTGAGGTGGCCAGG - Intronic
1117814288 14:59581414-59581436 AAAGGCAGGGAGAAGTGGAAAGG + Intergenic
1118883498 14:69848556-69848578 CCCGGCTCAGAGAAGGGGACTGG - Intergenic
1119946985 14:78705360-78705382 ACAGCCACGCAGAAGTGTACTGG - Intronic
1121711743 14:96043713-96043735 CCAGGGAGGGAGAAGTGGGAGGG - Intronic
1122314386 14:100817244-100817266 CCTGGCAGGGCGAAGTGGGCAGG + Intergenic
1122921560 14:104882457-104882479 CCAGGCAGGGAGGAGGGGCCAGG + Intronic
1125793257 15:42385991-42386013 CCAGGGAAGGAGAATTGGACAGG - Intronic
1128672050 15:69581050-69581072 CCAGGCTGGGTGAAGAGGACAGG + Intergenic
1128757392 15:70192564-70192586 CCAGGGACAGAGAAGTGAAGTGG + Intergenic
1129391156 15:75221648-75221670 CCAGCCACGGTGAAGGGGAATGG - Intergenic
1129473155 15:75766231-75766253 CCAGCCACGGTGAAGGGGAATGG + Intergenic
1129731400 15:77934637-77934659 CCAGCCACGGTGAAGGGGAATGG + Intergenic
1130051460 15:80487247-80487269 CAAGGCACGGGGAGGTGGGCAGG - Intronic
1131890848 15:96969998-96970020 CCAGGCAGGGAGAAGAGCAAGGG + Intergenic
1132519622 16:381386-381408 CCCGGCGCGGGGAAGTGGAGGGG - Intronic
1132690942 16:1181535-1181557 GCAGGCACGGAGAGGAGGGCTGG + Intronic
1134093473 16:11403867-11403889 CCGGGCAGGGAGAAGGGGCCAGG - Intronic
1134610112 16:15601343-15601365 GCAGGCATGGAGAAGGGAACTGG - Intronic
1135495222 16:22945623-22945645 ACAGGCACAGAGATGTGGACTGG - Intergenic
1136570692 16:31094767-31094789 CCAGCCACGGAGCAGGGGCCGGG + Exonic
1140629705 16:76836560-76836582 CCAGGCACAGAGAAAAGAACTGG + Intergenic
1143048549 17:4103029-4103051 TCAGGCAGGGAGCAGTGGATAGG - Intronic
1143326697 17:6103687-6103709 CAGCGCACGGAGAAGGGGACTGG + Intronic
1144771805 17:17763577-17763599 GCAGGCAGGGAGAAGTGTGCTGG + Intronic
1144794810 17:17883870-17883892 GCAGGCAAGGTGAAGTGTACTGG + Intronic
1144864491 17:18326307-18326329 CCAGGCAGGTAGTTGTGGACTGG + Intergenic
1145932584 17:28696606-28696628 CCAGGCATGGTGATGTGCACCGG + Intronic
1148152875 17:45406596-45406618 GCAGGAACTGAGAAGTGGTCTGG + Intronic
1150128156 17:62652295-62652317 CCCCGCACGGAGAAATGAACAGG + Intronic
1150335178 17:64325848-64325870 CCAGGCACTGATAGGTGGATAGG - Intronic
1150995907 17:70317254-70317276 ACAGACACTGAGAAGTGGAACGG + Intergenic
1151000720 17:70372747-70372769 CCATGCAAAGAGAAATGGACTGG + Intergenic
1151306238 17:73264265-73264287 CCAGGCACCTAGAAGTGGGATGG - Intergenic
1151679282 17:75615155-75615177 CCAGGCACAGAGAAGAGCATCGG - Intergenic
1152579186 17:81158581-81158603 CCAGGCTCGGGGCAGTGGGCAGG - Intronic
1157877562 18:51287805-51287827 CCAGGCAGGGAGATTTGGAGGGG + Intergenic
1159741375 18:72175400-72175422 CCATGCACAGAGTAGTGGAGGGG - Intergenic
1160081507 18:75731645-75731667 GCAGGCCTGGAGAAGGGGACTGG + Intergenic
1160225707 18:77009273-77009295 CCACACAAGGAGAAGAGGACAGG + Intronic
1161064169 19:2229377-2229399 CCGGGCAAGGAGAGGAGGACTGG + Intronic
1161151333 19:2711601-2711623 CCTGGGACGGAGCACTGGACAGG - Intergenic
1161581516 19:5083362-5083384 CCAGTGACGGGGACGTGGACGGG + Intronic
1164433318 19:28207344-28207366 CAATGCACTGAGAAGTGGAAGGG - Intergenic
1164557235 19:29263107-29263129 CTGGGCACAGAGCAGTGGACTGG - Intergenic
1165092730 19:33395307-33395329 CCAGGCACAGAGCAGAGTACGGG - Intronic
1165186960 19:34030863-34030885 TCAGGCTCGGAGATGTGGATAGG + Intergenic
1165744562 19:38222860-38222882 CCAGGCTGGGGGAAGGGGACAGG + Intronic
925985949 2:9214740-9214762 CCAGGGATGTAAAAGTGGACAGG + Intronic
929925217 2:46201921-46201943 GCAGGCCCAGAGAAGTGGAGTGG - Intergenic
930790017 2:55315301-55315323 CCAGGGAAGGAGAAGAGGAATGG + Intronic
931217735 2:60262263-60262285 CCAGGCAGGGACACCTGGACGGG - Intergenic
932172665 2:69571779-69571801 ACAGACACAGAGAAGTGGACAGG + Intronic
935863512 2:107360158-107360180 CCAGGCACGGTGCTGTGGATTGG - Intergenic
936516615 2:113185277-113185299 CCAGGCAGGGAGAAGGGGAAAGG - Intronic
936819284 2:116499419-116499441 GCAGGCGTGGAGAAGTGGAAAGG + Intergenic
940840849 2:158580285-158580307 CCAGGCACTGAGAACCAGACAGG - Intronic
941157707 2:161999532-161999554 CCTGGCAAGGAGAAGTGGGAAGG + Intronic
941345051 2:164358084-164358106 CCAGGGAGGAAGAAGTTGACTGG + Intergenic
944478557 2:200131178-200131200 CCAGGAATTGAGAAGAGGACTGG + Intergenic
945220803 2:207482008-207482030 CCAGGCAAGAAGAAGTAGAGAGG - Intergenic
946055007 2:216893374-216893396 AAAGGAAGGGAGAAGTGGACAGG - Intergenic
948127155 2:235572596-235572618 CCAGGTGCAGAGAAGTGGGCAGG - Intronic
1171346785 20:24471168-24471190 CCTAGCACGGAGAAGTTGGCCGG - Intronic
1171358982 20:24573326-24573348 TCAGGCAGGGAGAAGTGGTCTGG + Intronic
1172836539 20:37877060-37877082 CCAGGCACCGAGATGTGGCAGGG - Intergenic
1175414452 20:58792632-58792654 CCAGGCACGGGGAAGGGGAATGG + Intergenic
1175972811 20:62695519-62695541 CCAGGCACTGAGACTTGGAGGGG + Intergenic
1176922808 21:14708772-14708794 CAAGGCAAGGAGAAGGTGACTGG - Intergenic
1178269036 21:31172582-31172604 CCAGGCATGCAGCAGGGGACCGG + Intronic
1179126332 21:38594475-38594497 CCATGCACAGAGCTGTGGACGGG + Intronic
1179727964 21:43350771-43350793 CCAGGCAGGGGGAACTGGCCAGG - Intergenic
1179947257 21:44686715-44686737 CCAGGGACTGAGAAGTGCAGGGG - Intronic
1180036142 21:45251320-45251342 CCAGTCACGGGGAAGTGGCAGGG - Intergenic
1182990443 22:34762630-34762652 AAAGGCACGGAGATGTAGACAGG + Intergenic
1183742852 22:39678226-39678248 CAGGGCACGGAGGAGTGGAGGGG + Intronic
1184192608 22:42904835-42904857 CCAGGCACAGAGATGGGGAGAGG - Intronic
1184259560 22:43306851-43306873 CCAGGCACGGAGAAGTGGACTGG + Intronic
952884442 3:38003866-38003888 CCAGGCTGGGAGAAGGAGACGGG - Intronic
952979747 3:38725113-38725135 CCAGACACTGAGCAGTGGGCTGG - Intronic
962273073 3:133992467-133992489 CCAGGCAGGCAGAAGAGGGCAGG + Intronic
962420963 3:135228997-135229019 ACAGGCACTGGGAACTGGACAGG - Intronic
962462923 3:135631211-135631233 CCAGGCACAAAGAAGGGGAAGGG + Intergenic
963820488 3:149887054-149887076 CCAGGGACGTTGAAGAGGACAGG + Intronic
966399953 3:179537976-179537998 ACAGGCAAGGAGGGGTGGACTGG - Intergenic
967118264 3:186361266-186361288 CTAGGCAAGGGGAGGTGGACCGG + Intronic
968507277 4:976640-976662 ACAGGCCTGGAGACGTGGACGGG - Intronic
968602409 4:1516455-1516477 CCAGGCACTGAGTAGGGGAGGGG + Intergenic
968763781 4:2457706-2457728 ACAGGCCGGGAGCAGTGGACAGG - Intronic
968807796 4:2786832-2786854 CCAAGGATGGAGAAGTGGAAGGG + Intergenic
969447108 4:7251688-7251710 CCAGGCAGGAAGAAGGGGATGGG + Intronic
969780026 4:9393936-9393958 CCAAGCACTGAGATGTGAACTGG - Intergenic
969937299 4:10695028-10695050 GCAGGGATGGAGGAGTGGACTGG + Intergenic
973818983 4:54645948-54645970 CCCAGCAGGGAGAAGGGGACAGG - Intergenic
976398508 4:84582920-84582942 CCGGGCAGGGAGAAGTGTGCGGG + Intergenic
978951675 4:114568228-114568250 CCAAGCCCGGAGAATTGGATAGG - Intergenic
980409077 4:132390986-132391008 CCAGGCACAGGGAAGAGGCCGGG + Intergenic
982927024 4:161350927-161350949 CCAGGCACAGAGAAGAGTAGAGG - Intergenic
985652941 5:1115483-1115505 ACAGGAAAGCAGAAGTGGACTGG - Intergenic
986353516 5:6902772-6902794 ACAGGCAGGGAGAAGTGCTCAGG - Intergenic
987148106 5:15012340-15012362 ACAGGCATGGACAGGTGGACAGG + Intergenic
988536645 5:32074453-32074475 CCAGGCACAGACCAGTGGCCAGG + Exonic
990632797 5:57689159-57689181 CCAGTCAGAGAGCAGTGGACAGG + Intergenic
991633563 5:68680770-68680792 CCAGGCTGGGAGGAGTGGAGTGG + Intergenic
993037478 5:82773590-82773612 CAAGGAATGGAGAAGTGGTCTGG + Intergenic
995493797 5:112720851-112720873 ACAGGCACGTAAAAGTGGAATGG + Intronic
997616093 5:135247292-135247314 CCTGGCACTGCGAAGTGCACCGG + Intronic
997895376 5:137711476-137711498 CCCAACAGGGAGAAGTGGACAGG + Intronic
998366409 5:141635519-141635541 CAAGGCACAGACAAATGGACTGG - Intronic
999704560 5:154260414-154260436 CCAGGCACGGGGCAGATGACTGG - Intronic
1003015542 6:2464594-2464616 CCAAGGACAGAGAAGTGGATGGG - Intergenic
1004324252 6:14659507-14659529 CCAGGCAAGGAGAACTGGAATGG + Intergenic
1007106909 6:39289821-39289843 CCAGACAGGGGGAAGTGGAAAGG - Intergenic
1007382500 6:41499820-41499842 CCAGGCTCAGGGAAGGGGACAGG - Intergenic
1007536963 6:42600708-42600730 CCAGGCTTGGAGAAGTGTAGTGG + Intronic
1007779617 6:44245543-44245565 GCAGGCATGGCGAAGTGGACAGG + Intergenic
1014060360 6:117064530-117064552 AAAGGCTCAGAGAAGTGGACAGG - Intergenic
1015213157 6:130720783-130720805 CCTCGCACAGAGAAGTCGACTGG + Intergenic
1018297807 6:162367958-162367980 CCAGTCACGGAGGAGTGGCATGG + Intronic
1019444898 7:1066219-1066241 CCAGGCCCACAGAAGGGGACCGG + Intronic
1023472257 7:40536347-40536369 ACAGGCAGGGAGAAGGGGGCAGG + Intronic
1024666201 7:51549733-51549755 CCGGGCCTGGAGAAGTGGAGAGG + Intergenic
1028754256 7:94417441-94417463 GCAGGCATGGAGAAGAGGATAGG - Intronic
1030146965 7:106366793-106366815 CTAGGAAGGGAGAGGTGGACTGG + Intergenic
1030196768 7:106860291-106860313 CAAGGCACAGAGAAGTTGAGTGG - Intergenic
1034116894 7:148591524-148591546 CTAGGCAAGGAGAAGGGAACAGG - Intronic
1034488113 7:151378972-151378994 CCAGGCATGGAGACTTGGGCCGG + Intronic
1035004301 7:155644082-155644104 CCGGGCGCGGAGAAGGGGACGGG + Intronic
1036277450 8:7367911-7367933 CCAAGCACTGAGATGTGAACTGG - Intronic
1036839226 8:12103190-12103212 CCAAGCACTGAGATGTGAACTGG + Intergenic
1036861015 8:12349433-12349455 CCAAGCACTGAGATGTGAACTGG + Intergenic
1036973041 8:13376466-13376488 GCAGGCAGGGAGAAGAGGAGGGG - Intronic
1038642273 8:29338049-29338071 CCATGCAAGGGGAAGGGGACTGG + Intronic
1038664088 8:29522498-29522520 CCAGGCACGGAGAAGAATGCTGG + Intergenic
1045524575 8:102930696-102930718 CCAGGCATGGTGATGTGCACCGG - Intronic
1048335758 8:133501007-133501029 CCAGGCAAGGGGACTTGGACAGG + Intronic
1048692980 8:136989039-136989061 GCAGGCAAGGAGAAGTAGAGAGG - Intergenic
1049360818 8:142211824-142211846 CCAGGCAAGGAGCAGTGCCCTGG + Intergenic
1049573409 8:143379874-143379896 ACAGGCACGTAGTCGTGGACGGG - Exonic
1053519435 9:38763200-38763222 CCAAGCAAGGAGAATTGGGCAGG - Intergenic
1055962984 9:81837839-81837861 ACAGGCGCTGAGTAGTGGACTGG + Intergenic
1058990014 9:110246498-110246520 CCAGGCACTCAAAAGAGGACTGG + Intronic
1060677455 9:125528384-125528406 GCAGGCAGGGAGAAGTGGACAGG - Intronic
1061084220 9:128389865-128389887 CCAGGCAGGGAAAAGAGGCCAGG + Exonic
1061249013 9:129415697-129415719 CCAGGAAAGGAGCACTGGACTGG + Intergenic
1061448413 9:130655258-130655280 CCAGACACAGAGGAGGGGACAGG + Intergenic
1061871410 9:133522622-133522644 CCAGGCAGGGAGGTGTGGCCTGG + Intronic
1062054413 9:134463537-134463559 CCAGGGACAGAGGAGTGGCCCGG - Intergenic
1203760857 EBV:12563-12585 CTAGGCCCGGGGAAGTGGAGGGG + Intergenic
1203761786 EBV:15635-15657 CTAGGCCCGGGGAAGTGGAGGGG + Intergenic
1203762715 EBV:18707-18729 CTAGGCCCGGGGAAGTGGAGGGG + Intergenic
1203763644 EBV:21779-21801 CTAGGCCCGGGGAAGTGGAGGGG + Intergenic
1203764573 EBV:24851-24873 CTAGGCCCGGGGAAGTGGAGGGG + Intergenic
1203765502 EBV:27923-27945 CTAGGCCCGGGGAAGTGGAGGGG + Intergenic
1203766431 EBV:30995-31017 CTAGGCCCGGGGAAGTGGAGGGG + Intergenic
1203767360 EBV:34067-34089 CTAGGCCCGGGGAAGTGGAGGGG + Intergenic
1189514375 X:41697603-41697625 AAAGGCATGGAGAAGTGAACTGG + Intronic
1190165788 X:48071835-48071857 CCAGGTGGGGAGAAGTGGGCGGG - Intergenic
1190267286 X:48835155-48835177 CCGGGCACGGAGAGGTGGGCAGG + Intronic
1196820041 X:119694270-119694292 CCAAGGCCGGAGAAGTGGAGAGG - Intergenic
1198225055 X:134637278-134637300 CCAGGCATGGGGAAGGGGACAGG + Intronic
1199827512 X:151515331-151515353 CCAGGCATGGGGAAGAGGAGGGG - Intergenic
1200108484 X:153726961-153726983 CCAGGCACGAGGAAGGGGAGGGG - Intronic
1201766392 Y:17576927-17576949 CCAGGCTCTGTGAAGTGGCCAGG + Intergenic
1201835160 Y:18329062-18329084 CCAGGCTCTGTGAAGTGGCCAGG - Intergenic