ID: 1184262160

View in Genome Browser
Species Human (GRCh38)
Location 22:43324603-43324625
Sequence CTTTGGCAAATTTTTTTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 560
Summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 522}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184262160_1184262163 11 Left 1184262160 22:43324603-43324625 CCAGCTAAAAAAATTTGCCAAAG 0: 1
1: 0
2: 0
3: 37
4: 522
Right 1184262163 22:43324637-43324659 ATTATTATAAAAACATATCCAGG 0: 1
1: 0
2: 3
3: 47
4: 753
1184262160_1184262164 26 Left 1184262160 22:43324603-43324625 CCAGCTAAAAAAATTTGCCAAAG 0: 1
1: 0
2: 0
3: 37
4: 522
Right 1184262164 22:43324652-43324674 TATCCAGGAGTCGCCGCCCCTGG 0: 1
1: 0
2: 0
3: 7
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184262160 Original CRISPR CTTTGGCAAATTTTTTTAGC TGG (reversed) Intronic
901252560 1:7791587-7791609 CTTCTGCAAATTTCTGTAGCAGG + Intronic
903909692 1:26714003-26714025 CTTTGGTAAATGTGTTTGGCTGG - Intronic
904339171 1:29822576-29822598 CTTTGGCCAATTTTTTTAAATGG + Intergenic
904554488 1:31350232-31350254 CTTTGGCAAACTTTTGTTGAGGG + Intronic
906929901 1:50159214-50159236 CTTTGGAAAAGATTTTTAGATGG - Intronic
907021092 1:51067289-51067311 CTTATGCAAATTTCTGTAGCTGG + Intergenic
907261762 1:53223583-53223605 CTTTGTCAAATTTATCTGGCAGG - Intergenic
907522247 1:55031827-55031849 CTTAGGCAAATTTCTGCAGCTGG - Intergenic
907862929 1:58371536-58371558 CTTGTGCAAATTTCTGTAGCAGG - Intronic
908487720 1:64611281-64611303 CTTAGGCAAATTTCTGCAGCTGG + Intronic
909066376 1:70939912-70939934 CTTATGCAAATTTCTCTAGCTGG + Intronic
909096038 1:71290600-71290622 CTTATGCAAATTTCTATAGCTGG - Intergenic
909149973 1:71989175-71989197 CTTAGGCAAATTTGTTTAGATGG - Intronic
909256923 1:73436216-73436238 CTTTGGCCCATTTTTTAAGTGGG - Intergenic
909274346 1:73665914-73665936 CTTTTGCAAATTTCTGTAGCTGG - Intergenic
909419884 1:75451387-75451409 CTTATGCACATTTTTTTGGCAGG - Intronic
909830672 1:80185495-80185517 CTTGGGTATATTTTATTAGCAGG + Intergenic
910161140 1:84273730-84273752 CTTTGGCCCATTTTTTTAATTGG + Intergenic
910656586 1:89625644-89625666 CTTTGGAAAATTATTGTAGACGG - Intergenic
911140585 1:94497392-94497414 CTTTAACAAATTTGTTAAGCTGG - Intronic
911232142 1:95372812-95372834 CTTTGAAAAAGTTTTTTGGCTGG + Intergenic
911941468 1:104052700-104052722 CTTATGCAAATTTTTGCAGCTGG + Intergenic
912031440 1:105249659-105249681 CTTTGGCCCATTTTTTTAACTGG + Intergenic
912068599 1:105779313-105779335 CTTAGGCAAATTTCTGAAGCAGG - Intergenic
912135537 1:106656394-106656416 CTTATGCAAATTTCTGTAGCTGG + Intergenic
912647057 1:111403192-111403214 CTTTTGCTAATTGTTGTAGCAGG + Intergenic
913590349 1:120318834-120318856 CTTTTGCTCATTTTTTTAACGGG - Intergenic
913617837 1:120579529-120579551 CTTTTGCTCATTTTTTTAACGGG + Intergenic
914927727 1:151903174-151903196 CTTTCCCAAATTTTCTGAGCTGG - Intronic
916054276 1:161057313-161057335 ATTTGGCTTATTTGTTTAGCCGG - Intronic
918345945 1:183607199-183607221 CTTTGGCAAATTACATTAGCAGG - Intergenic
918844705 1:189594678-189594700 CTTATGCAAATTTTTGAAGCAGG - Intergenic
918942556 1:191019730-191019752 CTTTGGGAAATTTTGTTAAATGG + Intergenic
919175094 1:194010126-194010148 CTTATGCAAATTTCTTCAGCTGG - Intergenic
919534906 1:198775507-198775529 CTTTGGGGATTTTTTTTAGGGGG - Intergenic
920419648 1:205823557-205823579 CTTTTGCACATTTTTTAATCGGG + Intergenic
921243587 1:213212899-213212921 CTTTGGCCCATTTTTTAATCAGG + Intronic
921275239 1:213512617-213512639 CTTTGGCAAATTATCTAAGTGGG + Intergenic
921428573 1:215035142-215035164 CTTTGGGAAATTGTTTTTACTGG - Intronic
921651475 1:217683734-217683756 TTTTAGAAAATATTTTTAGCCGG - Intronic
921969179 1:221126809-221126831 CTTTGCCAAATTTTGGTATCGGG - Intergenic
922107648 1:222526274-222526296 CTTTGGCAAATACGTTTAACTGG - Intronic
922879202 1:228967020-228967042 CTTTGGCCAATTTTTCTACTGGG + Intergenic
1064741211 10:18436801-18436823 CTTTGGCAAATTTTTATTTCTGG - Intronic
1064947281 10:20805075-20805097 CATTGGCAAATCTTGTCAGCTGG - Intronic
1065866217 10:29917682-29917704 ATTTGGAATATTTTTTAAGCAGG + Intergenic
1066500769 10:35992353-35992375 CTTTGGCAACTATCATTAGCAGG + Intergenic
1066626669 10:37414090-37414112 CTTTGGCTTATTTTTTTGACAGG - Intergenic
1067666189 10:48281154-48281176 CTTTTGCAAATTTCTGTAGCCGG + Intergenic
1067960678 10:50845507-50845529 CCTTGGCAAATTAATTTATCTGG - Intronic
1068334260 10:55611329-55611351 CTTTTGCCCATTTTTTTAACAGG - Intronic
1069046024 10:63744173-63744195 CTTTGTGAAATTTTTGTATCAGG - Intergenic
1069804074 10:71107034-71107056 CTTATGCAAATTTCTGTAGCCGG - Intergenic
1071025269 10:81105509-81105531 GTTTGGAAAATATTTTAAGCTGG - Intergenic
1071243882 10:83741291-83741313 CTTGTGCAAATTTCTTCAGCAGG + Intergenic
1071363026 10:84869855-84869877 CTTTGCCAGATTTTGGTAGCAGG - Intergenic
1071373540 10:84978547-84978569 ATTTGTCAAATTTTATTATCAGG + Intergenic
1071479245 10:86051585-86051607 TTTTGGGAAATCTTTATAGCAGG - Intronic
1072368905 10:94744353-94744375 CTTATGCAAATTTTTACAGCAGG - Intronic
1072504449 10:96050654-96050676 CTTAGGCACATGTTTTTAACAGG - Intronic
1072883151 10:99248622-99248644 CTTAGGCAAATTTCTGTAGCTGG - Intergenic
1073482023 10:103791962-103791984 CTTTGGCAGATCCTGTTAGCAGG - Intronic
1073964846 10:108977630-108977652 CTTTTGTAAATTTTTACAGCAGG - Intergenic
1074217186 10:111397050-111397072 CTTTGTCAAATTCTGTTATCAGG + Intergenic
1074397234 10:113108140-113108162 TTTATGCAAATGTTTTTAGCTGG + Intronic
1075138588 10:119810382-119810404 ATTTGACAAATATTTTTGGCTGG + Intronic
1075826212 10:125358793-125358815 CTTATGCAAATTTTTGCAGCTGG + Intergenic
1076464887 10:130672217-130672239 CTTATGCAAATTTCTGTAGCTGG + Intergenic
1078271078 11:9795125-9795147 CCTTGGGAAATGTTTTTACCGGG + Intronic
1078299061 11:10106836-10106858 CTTTGGCCCATTTTTTAAGTTGG - Intronic
1078586410 11:12594162-12594184 CTTTGTCAAGTTTTCTTAACAGG - Intergenic
1078750255 11:14154666-14154688 CTTAGGCAAATTTCTGCAGCAGG + Intronic
1079260182 11:18871145-18871167 CCTTGGCACAATTTTTTGGCAGG + Intergenic
1079819402 11:25105993-25106015 CTTTTGCACATTTTTACAGCTGG + Intergenic
1080707623 11:34713016-34713038 CTTATGCAAATTTATGTAGCTGG - Intergenic
1081080527 11:38734030-38734052 CTTATGCAAATTTCTGTAGCAGG + Intergenic
1081380627 11:42410201-42410223 CTTTGGCCATCTTTTTTGGCAGG - Intergenic
1081441661 11:43087487-43087509 CTTTGCCGAATTTGTTTATCAGG + Intergenic
1085336011 11:75696360-75696382 CTTTGCCAAGTTTTTGTATCAGG + Intergenic
1085658586 11:78340822-78340844 CTTGGGCAAATTTCTTAAACTGG - Intronic
1086620608 11:88883591-88883613 CTTATGCAAATTTCTTCAGCTGG - Intronic
1086663084 11:89446033-89446055 GTTTGGCACATTTTTTTAATTGG - Intronic
1086750660 11:90489918-90489940 CTTAGGCAAATTTTTGCAGCTGG - Intergenic
1087125085 11:94617328-94617350 ACCTGGTAAATTTTTTTAGCAGG + Intronic
1087325174 11:96712745-96712767 CATGGGCAATTTTTTATAGCAGG + Intergenic
1087583316 11:100087467-100087489 CTTTGGCAAATTTTGTTGTTAGG - Intronic
1091343449 11:134837531-134837553 CTTTGGCAAACTTTCTTCTCTGG + Intergenic
1091422202 12:351514-351536 CTATAGCAAATTTTTTTGACAGG + Intronic
1091939538 12:4465417-4465439 CTTTGGAAAAGCTTTTTAGTTGG - Intergenic
1092577293 12:9800685-9800707 CTTTGGCCCATTTTTTAATCAGG + Intergenic
1092665506 12:10792054-10792076 CTTACGCAAATTTCTGTAGCAGG + Intergenic
1092931802 12:13322532-13322554 CTTGGGAAAATGTATTTAGCAGG + Intergenic
1093911915 12:24758052-24758074 CTGTGCCAAATTTTTTTATTGGG - Intergenic
1094650441 12:32370653-32370675 CTTTGGAAAATTTCTTTTGCTGG + Intronic
1095446001 12:42283206-42283228 CTTTTGCAACTTTTTTTTGAGGG + Intronic
1095544198 12:43345370-43345392 CTTAGGCAAATTTCTACAGCAGG + Intergenic
1095771327 12:45962029-45962051 CTTTCTTAAATTTTTTTAACGGG + Intronic
1095880433 12:47130152-47130174 GTTTGGCTAATTTTTTTAAGTGG + Intronic
1096298259 12:50402113-50402135 CTATGGCAGATTTTTTTTTCCGG + Intronic
1096642874 12:53008354-53008376 CTTCAGTAAATCTTTTTAGCTGG + Intronic
1097168012 12:57095989-57096011 CTTTGGGAGATTTTTTAATCAGG + Exonic
1097368054 12:58742052-58742074 CTTATGCAAATTTTTGTAGCCGG - Intronic
1097401699 12:59135142-59135164 CTTTTGCAAATGTCTTTAGCTGG + Intergenic
1098592373 12:72228562-72228584 CTTATGCAAATTTTTACAGCTGG + Intronic
1099260823 12:80380436-80380458 CTTTGGCTCATTTTTCTATCAGG - Intergenic
1099339358 12:81409085-81409107 CTTTAGGAAATTCTCTTAGCTGG + Intronic
1099525339 12:83711429-83711451 CTTATGCAAATTTCTTCAGCAGG + Intergenic
1099806723 12:87529650-87529672 CTTTGGCACATCTTTTTAACAGG + Intergenic
1099900012 12:88695855-88695877 CTTATGCAAATTTTTGAAGCAGG + Intergenic
1100971877 12:100079656-100079678 CTTACGCAAATTTCTGTAGCTGG - Intronic
1101194706 12:102370241-102370263 CTTAGGCAAATTTCTCCAGCAGG + Intergenic
1101258028 12:102998534-102998556 CGTTTGCAAATTTCTGTAGCTGG + Intergenic
1101682796 12:106985965-106985987 ATTTCGCAAATGATTTTAGCAGG + Exonic
1101692707 12:107096549-107096571 CTTAGGCAAATTTCTGCAGCTGG - Intergenic
1103263442 12:119609408-119609430 CTTATGCAAATTTTTGTAGCCGG - Intronic
1104210545 12:126684287-126684309 CTTATGCAAATTTTTGCAGCTGG + Intergenic
1104587889 12:130062346-130062368 CTTATGCAAATTTCTGTAGCGGG - Intergenic
1105227287 13:18447989-18448011 CTTATGCAAATTTTTGCAGCTGG - Intergenic
1106121689 13:26864808-26864830 CTTTGGCAAATGTCTCTAACTGG + Intergenic
1106718716 13:32418037-32418059 CTTAGGCAAATTTCTGCAGCTGG - Intronic
1107235391 13:38162443-38162465 CTTTAGCCAATTTTTTAATCAGG + Intergenic
1108270538 13:48755630-48755652 CTTATGCAAATTTCTGTAGCCGG - Intergenic
1108719701 13:53118192-53118214 CTTATGCAAATTTTTGCAGCTGG + Intergenic
1108770912 13:53699735-53699757 CTTATGCAAATTTCTGTAGCTGG - Intergenic
1109453906 13:62557526-62557548 ATTTGACAGATTTTATTAGCAGG - Intergenic
1109750450 13:66685064-66685086 CTTAGGCAAATTTCTGCAGCTGG - Intronic
1110490915 13:76105802-76105824 CTTTTGCAGATTTTTTTTCCTGG + Intergenic
1110493246 13:76134566-76134588 CTTTGGTATATTGTTTTAGGAGG + Intergenic
1110872056 13:80463817-80463839 TATTGCCAAATTTTTTTAGCAGG + Intergenic
1110979966 13:81884825-81884847 CTTATGCAAATTTTGGTAGCTGG + Intergenic
1111393195 13:87626321-87626343 ATTTAGCAATATTTTTTAGCTGG + Intergenic
1111601683 13:90482166-90482188 CTTAAGCAAATTTCTGTAGCAGG + Intergenic
1111666039 13:91269498-91269520 CATTTGCTAATTTTTTGAGCAGG - Intergenic
1112790354 13:102995725-102995747 CTTGTGCAAATTTTTGCAGCAGG + Intergenic
1112857790 13:103792300-103792322 CTTTGGCAAAAGTTTTCTGCAGG - Intergenic
1113191029 13:107746082-107746104 CTTTGGCAAATATTTCTCCCAGG - Intronic
1114011739 14:18376443-18376465 CTTATGCAAATTTTTGCAGCTGG - Intergenic
1114348068 14:21818141-21818163 CTTTGGCCCATTTTTTAATCAGG + Intergenic
1114880714 14:26782011-26782033 CTGTGGCAAAATTTTTTATAGGG - Intergenic
1115772412 14:36678618-36678640 CTTTATCAAATGTTTTTAGGTGG + Exonic
1115802102 14:37006474-37006496 TTTTGGCAAATCTTTTCAGAGGG - Intronic
1115820248 14:37206045-37206067 CTTAGGCAAATTTCTGCAGCTGG - Intronic
1116080199 14:40162199-40162221 CTTATGCAAATTTCTGTAGCAGG - Intergenic
1116284040 14:42949206-42949228 TTTTGCCAGATTTTTTTATCAGG - Intergenic
1116293239 14:43069736-43069758 CTTTTGCTTATTTTTTTAGTTGG + Intergenic
1116533746 14:46005838-46005860 CTTGGGCAGTTTTTTATAGCAGG + Intergenic
1116922967 14:50600655-50600677 ATTTAGCAATCTTTTTTAGCAGG + Intronic
1117304284 14:54458931-54458953 ATTATGCAAATTTTTGTAGCTGG - Intergenic
1117396241 14:55312935-55312957 CTTATGCACATTTTTGTAGCTGG + Intronic
1118083293 14:62387089-62387111 CTTATGCAAATTTCTTCAGCAGG - Intergenic
1120455531 14:84725289-84725311 CTTTGGCCCATTTTTTTAATGGG - Intergenic
1120485935 14:85113126-85113148 CTTAGGCAAATTTCTGCAGCTGG + Intergenic
1120660421 14:87242160-87242182 CTTTTGCCCATTTTTTAAGCAGG - Intergenic
1121369363 14:93342558-93342580 CTTATGCAAATTTTTGTAGTTGG + Intronic
1121471112 14:94155258-94155280 CTTTTGCAAATTTCTGTAGCAGG - Intronic
1121881828 14:97507876-97507898 CTTATGCAAATTTCTTCAGCTGG - Intergenic
1123979834 15:25590943-25590965 CTTTGGTATATTTTTCTAGATGG + Intergenic
1125251743 15:37713108-37713130 CTTATGCAAATTTCTATAGCTGG - Intergenic
1126490695 15:49232494-49232516 CTTATGCAAATTTCTGTAGCTGG + Intronic
1126499906 15:49334461-49334483 CTTTGGCATATGTTTGTAACAGG - Intronic
1128884200 15:71271149-71271171 CTTGGGCAAATTTTTTTTTATGG - Intronic
1129065291 15:72898245-72898267 CTTAGGGAAATCTTTTTAGTGGG + Intergenic
1129580185 15:76800686-76800708 CTTTTAAACATTTTTTTAGCTGG - Intronic
1129679275 15:77648870-77648892 CTTTGGGAACTCTGTTTAGCAGG - Intronic
1130629264 15:85549684-85549706 CTCTGCCAAATTTTTGTAGAGGG - Intronic
1131921391 15:97332568-97332590 CTTATGCAAATTTTTGCAGCAGG - Intergenic
1133151312 16:3833942-3833964 CTTTGGCCCATTTTTTAAACAGG - Intronic
1133904297 16:10007451-10007473 CTTTTGCCAATTTTTTTAATTGG + Intronic
1140867562 16:79077238-79077260 CTTTGGCACATTTTAATAGTGGG - Intronic
1140982359 16:80123158-80123180 CTTTGGCCATGTTTTTTAGATGG + Intergenic
1143424339 17:6821967-6821989 CTTATGCAAATTTCTGTAGCTGG - Intronic
1144281702 17:13733446-13733468 CTTATGCAAATTTCTTCAGCTGG - Intergenic
1145022517 17:19442948-19442970 CTTATGCAAATTTCTGTAGCTGG - Intergenic
1145400670 17:22529630-22529652 CTATTGCAAAGATTTTTAGCGGG - Intergenic
1146146463 17:30422652-30422674 CTTTTTCAAATTTTTTTTTCAGG + Exonic
1146697304 17:34919652-34919674 CTTAGGCAAATTTCTGCAGCCGG - Intergenic
1149115995 17:53097397-53097419 CTTAGGCAAATTTCTGCAGCAGG - Intergenic
1149235795 17:54589208-54589230 CTTTGGTAAATTTTTGTATAAGG + Intergenic
1149976406 17:61270423-61270445 CTTTTGCCGATTTTTTTATCAGG + Intronic
1150270639 17:63862267-63862289 CTTTGGGAAACTGTTTTTGCAGG + Intergenic
1153012002 18:547673-547695 CTTATGCAAATTTCTTCAGCTGG + Intergenic
1153077351 18:1179638-1179660 CTTTGTCTAGTTTTTTTATCAGG - Intergenic
1153138459 18:1944512-1944534 CTTTTGCAAATTTTTTGTGGGGG - Intergenic
1153657158 18:7292916-7292938 CTTTGCCAGGTTTTGTTAGCAGG + Intergenic
1154337790 18:13479749-13479771 TTTTGGCCAATTTTTTAATCAGG - Intronic
1154526090 18:15291486-15291508 CTTATGCAAATTTTTGCAGCTGG + Intergenic
1155841939 18:30657759-30657781 CTTTTGCCAATTTTTTAAGCAGG - Intergenic
1155975240 18:32121651-32121673 ATTTGGAAGATTTTTTAAGCTGG + Intronic
1155988176 18:32252742-32252764 CTTATGCAAATTTTTGTAGCTGG + Intronic
1156122733 18:33864243-33864265 CTTATGCAAATTTCTGTAGCTGG + Intronic
1156151659 18:34250350-34250372 CTTATGCAAATTTCTGTAGCAGG - Intergenic
1156683424 18:39617663-39617685 CTTATGCAAATTTTTGCAGCTGG + Intergenic
1157941052 18:51929726-51929748 CTTATGCAAATTTCTGTAGCCGG - Intergenic
1158110166 18:53931952-53931974 CTTTGGCAAAATTGTGGAGCAGG - Intergenic
1158815549 18:61090925-61090947 CTTTGGACCATTTTTTAAGCAGG + Intergenic
1158905365 18:62006147-62006169 CTTATGCAAATTTTTGCAGCTGG + Intergenic
1159097520 18:63921292-63921314 CCTTGGCAAATATGTCTAGCAGG - Intronic
1159729091 18:72002727-72002749 CTTTGTTAAATTATTTTAGATGG + Intergenic
1159756067 18:72367674-72367696 CTTTGCCAAATTTATCTAGCTGG + Intergenic
1159761359 18:72430369-72430391 CTTATGCAAATTTTTGCAGCTGG + Intergenic
1165134169 19:33655415-33655437 CTTTGGCAGATTTTGGTACCAGG + Intronic
1165520904 19:36313068-36313090 CTTTGGCAAAGTCATTTACCTGG - Intergenic
1165623168 19:37265518-37265540 CTTTGGCAAAGTCATTTACCTGG + Intergenic
1165659158 19:37559978-37560000 TTTTTAAAAATTTTTTTAGCTGG + Intronic
1165883900 19:39063389-39063411 CTTTTTAAAATTTTTTTAGACGG - Intergenic
1166981012 19:46631979-46632001 GTTTGGCCAATTATTTTACCTGG - Intergenic
1167016690 19:46845635-46845657 TTTGGTCAAATTTTTTTTGCTGG - Intronic
926391895 2:12402532-12402554 CTTATGCAAATTTCTTCAGCTGG - Intergenic
926519856 2:13897391-13897413 CTTATGCAAATTTATTCAGCTGG - Intergenic
926646210 2:15292318-15292340 CATGGGAAACTTTTTTTAGCTGG + Intronic
926840872 2:17079339-17079361 CTTATGCAAATTTCTTCAGCTGG - Intergenic
928162009 2:28936466-28936488 GTTAGGCAAATTTTTATAGTAGG - Intronic
929771075 2:44892404-44892426 CTTATGCAAATTTCTGTAGCTGG + Intergenic
930481482 2:51953062-51953084 CTTATGCAAATTTTTGCAGCTGG + Intergenic
930942175 2:57026147-57026169 CTTAGACAAATTTCTTCAGCTGG + Intergenic
931703333 2:64926394-64926416 CTTATGCAAATTTCTGTAGCTGG - Intergenic
931734609 2:65182516-65182538 CTTAGGCAAATTTCTGCAGCAGG - Intergenic
932647309 2:73516911-73516933 ATTTGGCAAATGTTTTAAGGAGG + Intronic
932923253 2:75941646-75941668 CTTAGGCAAATTTCTGCAGCCGG - Intergenic
933124240 2:78584261-78584283 CTTTTGCAAAAGTTTTAAGCTGG - Intergenic
933350451 2:81146189-81146211 CTTTCGCAAATTTCTGCAGCTGG + Intergenic
933464933 2:82640083-82640105 TTTATGCAAATTTTTGTAGCAGG - Intergenic
934053793 2:88234598-88234620 TTATGGAAAATTTTTTTATCAGG - Intergenic
934536003 2:95134125-95134147 CTTGGCCAAATTTTTTTATTGGG + Intronic
935138396 2:100328776-100328798 CTTTGGCACATTTTCTGTGCTGG + Intergenic
935338218 2:102036246-102036268 CTTTGGCCAATTATTCCAGCAGG + Intergenic
936892296 2:117386110-117386132 CTTTGGACAATTTTTTTATTAGG + Intergenic
938525193 2:132122851-132122873 CTTATGCAAATTTTTGCAGCTGG + Intergenic
939050168 2:137298455-137298477 CTTATGCAAATTTTTGCAGCTGG - Intronic
939828292 2:147042336-147042358 CTTTGGCAAATATTTTCTCCTGG - Intergenic
939915008 2:148029562-148029584 TTTTGGTAAATTGTTTTAGAAGG + Intronic
940380121 2:153005136-153005158 CTATGGCTAATTTCTTTATCTGG + Intergenic
941089507 2:161158865-161158887 CTTTGGCCCATTTTTTAATCAGG - Intronic
942123826 2:172803633-172803655 CTTATGCAAATTTCTGTAGCTGG + Intronic
942904802 2:181167256-181167278 CTTATGCAAATTTCTGTAGCTGG + Intergenic
943017229 2:182528555-182528577 CTTATGCAAATTTCTGTAGCCGG - Intergenic
943093422 2:183400756-183400778 CTTTGTCAAAGCTTTTTAGTTGG + Intergenic
943481305 2:188421617-188421639 CTTTTGCAAATCTTTTGATCTGG + Intronic
943529521 2:189062064-189062086 TTTTGGCATATTTTTTTGGGGGG - Intronic
944021785 2:195114350-195114372 CTTATGCAAATTTCTTCAGCTGG - Intergenic
945336669 2:208600242-208600264 CTTAGGCAAATTTCTGTAGCAGG + Intronic
947054482 2:226084935-226084957 CTTATGCAAATTTTTGCAGCTGG + Intergenic
947130875 2:226923861-226923883 CTTTGCCAAATTTGTTTAATGGG + Intronic
947199478 2:227601711-227601733 CTTTAGCAAAACTTTTTCGCCGG + Intergenic
947880569 2:233506990-233507012 CTTTTGCCAATTTTTATATCAGG - Intronic
948250250 2:236522220-236522242 CTTTGTCAAGTTTTGTTATCAGG + Intergenic
1169985269 20:11436441-11436463 CTTTTGCAAATTTCTGCAGCTGG + Intergenic
1170778082 20:19396820-19396842 CTTTGACACATTTTTTTTTCTGG - Intronic
1171130178 20:22644899-22644921 CTTATGCAAATTTCTGTAGCTGG + Intergenic
1171221066 20:23398542-23398564 CTTTAAAAAATTTTTTTGGCTGG + Intronic
1173023472 20:39287099-39287121 CTTATGCAAATTTCTGTAGCCGG - Intergenic
1173128818 20:40367236-40367258 CTTTGGCGGATGTTTATAGCAGG + Intergenic
1173183807 20:40823925-40823947 CTTTGACAGATGATTTTAGCTGG + Intergenic
1175289359 20:57863950-57863972 CTTCCTCAAATTTTTTAAGCTGG + Intergenic
1175748862 20:61481040-61481062 CTTTGGCAAAGTTCTTAACCGGG - Intronic
1176771331 21:13077002-13077024 CTTATGCAAATTTTTGCAGCTGG - Intergenic
1177236182 21:18392182-18392204 CTTATGCAAATTTCTGTAGCTGG + Intronic
1177478099 21:21650773-21650795 CTTAGGCAAATTTCTGCAGCTGG - Intergenic
1180436232 22:15307251-15307273 CTTATGCAAATTTTTGCAGCTGG - Intergenic
1180518475 22:16171447-16171469 CTTATGCAAATTTTTGCAGCTGG - Intergenic
1182556352 22:31131094-31131116 CATTGGCCAATATCTTTAGCTGG + Intronic
1182824223 22:33249362-33249384 CTTTGGCACATTTACTAAGCTGG + Intronic
1182887610 22:33788980-33789002 CTTAGGCAAATTTCTGCAGCAGG - Intronic
1184262160 22:43324603-43324625 CTTTGGCAAATTTTTTTAGCTGG - Intronic
949230489 3:1744395-1744417 CTTAGGCAAATTTCTGCAGCTGG + Intergenic
951180733 3:19655241-19655263 CTTAGGCAAATTTCTACAGCTGG + Intergenic
951887423 3:27537962-27537984 ATTTAGCAAATTTTTCTTGCAGG - Intergenic
952057030 3:29459896-29459918 CTTTAGCAAATTGTTTGAACTGG - Intronic
952569979 3:34702174-34702196 CTTATGCAAATTTCTGTAGCTGG + Intergenic
952575770 3:34772922-34772944 CTTATGCAAATTTATGTAGCTGG - Intergenic
952636000 3:35532547-35532569 CTTTGGCCTATTTTTTAATCAGG - Intergenic
952739655 3:36723393-36723415 CTTAGGCAAATTTCTGCAGCCGG - Intronic
953503699 3:43462636-43462658 CTTATGCAAATTTCTGTAGCTGG - Intronic
955844180 3:63143456-63143478 CTTTGATAATTTTTTGTAGCAGG - Intergenic
955999847 3:64717668-64717690 ACTTGGCAAATATTTTTGGCGGG - Intergenic
956391584 3:68779338-68779360 CTTATGCAAATTTTTATAACTGG - Intronic
957108212 3:75918899-75918921 CTTTGCCAAAGTTGTTTATCAGG + Intronic
957260678 3:77897454-77897476 CTTTTGCAAATTTCTGCAGCTGG + Intergenic
957360030 3:79143250-79143272 TTTTGGCAAATTTGGTTACCAGG - Intronic
957662782 3:83183423-83183445 CTTTTGCAAATTTCTGCAGCAGG - Intergenic
957738691 3:84234232-84234254 CTTACGCAAATTTTTGCAGCAGG + Intergenic
957771316 3:84696007-84696029 CTCTGGAAAATTTTTCCAGCTGG + Intergenic
957873060 3:86112393-86112415 CTTATGCAAATTTCTTCAGCTGG - Intergenic
958566498 3:95818290-95818312 CTTTTGCAAATTCTTTTAGAAGG - Intergenic
959227650 3:103605585-103605607 CTTTGGTAATTTTTTGTAGTGGG - Intergenic
959233693 3:103690855-103690877 CTTAGGCAAATTTCTGCAGCAGG + Intergenic
959299475 3:104579100-104579122 CTTATGCAAATTTTTGCAGCTGG + Intergenic
959324005 3:104912759-104912781 CCTTGGCAAATTTTGGTATCAGG + Intergenic
959368337 3:105491390-105491412 CTTAGGCAAATTTCTACAGCTGG + Intronic
959818584 3:110704589-110704611 CTTATGCAAATTTTTGCAGCTGG + Intergenic
960350759 3:116589813-116589835 CTTTGGTCAATTTTATTTGCAGG + Intronic
960509305 3:118529433-118529455 CTTGGGCATTTTTTTATAGCAGG - Intergenic
960977803 3:123193174-123193196 CTTTTGCAAATTGTTTTCTCAGG + Intronic
961144445 3:124582751-124582773 CCTTGGCACATTTTTTTTGGGGG + Intronic
962672897 3:137726934-137726956 CTTATGCAAATTTTTGCAGCCGG + Intergenic
963576997 3:147073247-147073269 CTTTGCCAGATTTTTGTATCAGG - Intergenic
964520745 3:157563788-157563810 CTTATGCAAATTTCTGTAGCTGG + Intronic
964934077 3:162059933-162059955 CTTATGCAAATTTTTGCAGCTGG + Intergenic
964978363 3:162647353-162647375 CTTATGCAAATTTCTGTAGCTGG - Intergenic
965108479 3:164388568-164388590 CTTATGCAAATTTCTGTAGCAGG + Intergenic
965166613 3:165201972-165201994 TTTTGGCAAATCTTTTTAGAAGG - Intergenic
965361427 3:167744076-167744098 GTTTGACAAATTTTTTTAAAAGG - Intronic
965662067 3:171052585-171052607 CTTAGGCAAATTTCTGCAGCGGG - Intergenic
965884840 3:173432549-173432571 CTTTGGCCAATTTTTTAATCAGG + Intronic
965929739 3:174028724-174028746 CTTATGCAAATTTTTGCAGCTGG - Intronic
966059293 3:175734913-175734935 CTTAGGCAAATTTCTCCAGCTGG + Intronic
966305697 3:178531703-178531725 CTTTGGAACATTTTTTAATCAGG + Intronic
966512243 3:180776798-180776820 CTTATGCAAATTTCTATAGCTGG + Intronic
966661582 3:182420431-182420453 CTTGGGCAAAGTTTTTCAGAAGG + Intergenic
967782979 3:193459733-193459755 ATTTGAAAAATGTTTTTAGCCGG - Intronic
968014651 3:195318823-195318845 TTTTTGCAAATTTTTGCAGCTGG - Intronic
968403042 4:315211-315233 CTTATGCAAATTTTTGCAGCTGG + Intergenic
968695902 4:2026397-2026419 CTTATGCAAATTTTTGCAGCAGG + Intronic
970061478 4:12039088-12039110 CTTATGCAAATTTCTATAGCTGG - Intergenic
970361009 4:15308720-15308742 CTTACGCAAATTTCTTCAGCTGG + Intergenic
970434115 4:16016460-16016482 CTTTGCCTCTTTTTTTTAGCTGG - Intronic
970461999 4:16284088-16284110 CTTATGCAAAATTTTGTAGCAGG - Intergenic
970999215 4:22303685-22303707 CTTCTGCAAATTTCTGTAGCTGG - Intergenic
971518776 4:27522201-27522223 CTTTGGAAAATTTTTGAAGCAGG - Intergenic
971720971 4:30244744-30244766 CTTTGGTAAATTTCTGCAGCTGG + Intergenic
971815057 4:31476682-31476704 CTTATGCAAATTTCTTCAGCTGG + Intergenic
971874437 4:32287960-32287982 CTTTGGTAAAATTTATTAGTAGG + Intergenic
971972166 4:33634739-33634761 CTTATGCAAATTTGTGTAGCTGG - Intergenic
972236965 4:37146289-37146311 CTTATGCAAATTTTTCCAGCTGG - Intergenic
972301173 4:37787154-37787176 CTTATGCAAATTTTTGCAGCAGG - Intergenic
974214576 4:58828419-58828441 CTTATGCAAATTTCTATAGCAGG + Intergenic
974455798 4:62128283-62128305 CTTAGGCAAATTTCTGCAGCCGG - Intergenic
974555885 4:63446511-63446533 CTTTTGCAAATTTCTGCAGCTGG + Intergenic
974612648 4:64235965-64235987 ATTTGGCAAATTTTTGTAAATGG - Intergenic
974732933 4:65893416-65893438 CTTTAGCACATTTTTTGAGCAGG - Intergenic
974805614 4:66876406-66876428 TTTTTGCATTTTTTTTTAGCTGG - Intergenic
974908581 4:68087038-68087060 CTTTGTCAAATTTTGGTATCAGG - Intronic
974909730 4:68102641-68102663 CTTTTGCACATTTTTTAATCAGG + Intronic
974915439 4:68173304-68173326 CTTATGCAAATTTTTTCAGCTGG - Intergenic
975496004 4:75036657-75036679 GTTTGGAAAATTTTGTTAGCAGG + Intronic
976133509 4:81910125-81910147 CTTTGGCCAATTTTTTAATCTGG - Intronic
976305829 4:83558529-83558551 CATTGGCAAATGTTTTTTGGTGG + Intronic
976405672 4:84658460-84658482 CTTATGCAAATTTCTGTAGCCGG + Intergenic
976715593 4:88119904-88119926 CTTATGCAAATTTCTGTAGCAGG - Intronic
976991023 4:91366346-91366368 CTTTGTCATATTTTTTGAGTGGG + Intronic
977415929 4:96733175-96733197 CTTATGCAAATTTTTGCAGCTGG - Intergenic
978939010 4:114415212-114415234 CTTATGCAAATTTTTGCAGCTGG - Intergenic
978963628 4:114714593-114714615 CTTTGGCATATTTTTCTTGTAGG + Intergenic
979210110 4:118090328-118090350 CTTTGGGAAATCTGTTTAGGAGG + Intronic
979426472 4:120572897-120572919 CTTATGCAAATTTCTGTAGCTGG + Intergenic
979610162 4:122681624-122681646 CTTTTGCAAATTTCTGCAGCTGG - Intergenic
979951388 4:126897635-126897657 CTTATGCAAATTTCTGTAGCTGG + Intergenic
979984442 4:127296252-127296274 CTTAGGCAAATTTCTGCAGCTGG + Intergenic
980043159 4:127962863-127962885 CTTTGGCAAATGTATTTCTCTGG - Intronic
980166405 4:129233391-129233413 CTTTAGCACATTTTTTTTCCTGG + Intergenic
980337387 4:131494511-131494533 CTTATGCAAATTTCTGTAGCTGG + Intergenic
980381842 4:132031214-132031236 CTTTGCCAAATTTATCTAGTAGG + Intergenic
980531763 4:134065777-134065799 CTTTGGCAGATTTTTGTATATGG + Intergenic
980674079 4:136051383-136051405 CTCGGGCAATTTTTTATAGCAGG + Intergenic
980805099 4:137802487-137802509 CTGTGGCAAATTATTATAGATGG + Intergenic
981121057 4:141051340-141051362 CTTATGCAAATTTTTGCAGCTGG + Intronic
981308031 4:143267493-143267515 CTTACGCAAATTTTTGCAGCTGG - Intergenic
981420198 4:144541164-144541186 CTTTGGCAAATGTCTTGAGGAGG - Intergenic
981904838 4:149910605-149910627 GTTTGGTAATTTTTTTTAGGTGG - Intergenic
981915308 4:150026780-150026802 CTTATGCAAATTTCTGTAGCTGG - Intergenic
982400005 4:154955386-154955408 CCTAGGTAAATTTTTTCAGCTGG + Intergenic
982532000 4:156557405-156557427 ATTTTGCAAGTATTTTTAGCTGG + Intergenic
983298086 4:165891291-165891313 CTTATGCAAATTTCTTCAGCTGG + Intronic
983317385 4:166149537-166149559 CTTATGCAAATTTCTGTAGCAGG - Intergenic
983854942 4:172632650-172632672 CTTATGCAAATTTTTGCAGCTGG - Intronic
985933053 5:3074097-3074119 CTTTGGCAAATGGGTTTACCTGG + Intergenic
985990497 5:3555990-3556012 CTTTGGCCCATTTTTTAATCAGG - Intergenic
986619284 5:9654318-9654340 CTTGGGCAAAAATTTTTAGAAGG + Intronic
987254312 5:16133955-16133977 CTTTGGCCAATTTTCTGTGCAGG - Intronic
987541380 5:19260803-19260825 CTTAGGCAAATTTCTGCAGCCGG - Intergenic
987659503 5:20854666-20854688 CTTATGCAAATTCTTATAGCTGG - Intergenic
987674992 5:21063191-21063213 CTTATGCAAATTTCTGTAGCTGG - Intergenic
987898028 5:23973722-23973744 CTTTGTCCAATTTTGTTATCAGG + Intronic
988074835 5:26339033-26339055 CTTATGCAAATTTTTGCAGCAGG + Intergenic
988076788 5:26364204-26364226 CTTTTGCAAATTTCTGCAGCAGG - Intergenic
988339978 5:29958884-29958906 ATTTGGCAAATTTTTGTATCTGG - Intergenic
988764145 5:34350981-34351003 CTTATGCAAATTCTTATAGCCGG + Intergenic
990580570 5:57163817-57163839 CTTTGGAAAGTCTTTTAAGCAGG - Intergenic
990628954 5:57646396-57646418 CTTTGGCTTATTTTTTTGGGAGG + Intergenic
990660714 5:58012060-58012082 TTTTGGCAAATCTTTTTACCAGG + Intergenic
991443216 5:66673118-66673140 CTTTGGCCATTTTTTTTAACTGG + Intronic
991922952 5:71675430-71675452 CTTTGGCTAATTTTGGTATCAGG + Intergenic
991931101 5:71753173-71753195 CTTTGCCAATTTTTTTTACTGGG - Intergenic
992215460 5:74520649-74520671 CTTTGTGAAATTCTTTTACCTGG - Intergenic
992629166 5:78664312-78664334 GCTTGGCAAACTTTTGTAGCAGG - Intronic
992857891 5:80882131-80882153 CTTTGGCTCATTTTTTGATCTGG + Intergenic
993001011 5:82380256-82380278 CTTATGCAAATTTCTGTAGCTGG + Intronic
994059090 5:95454151-95454173 CTTTGCCCATTTTTTTTATCAGG - Intergenic
994324174 5:98429547-98429569 CTTTGACAAATTTTTTATGAGGG + Intergenic
994649020 5:102504011-102504033 CTTTTGCAAATTTCTGCAGCTGG - Intergenic
994717687 5:103342298-103342320 CTTTGGCCTATTTTTTAACCAGG + Intergenic
994833063 5:104810470-104810492 CTTATGCAAATTTCTGTAGCTGG + Intergenic
995360952 5:111296447-111296469 GTTTGGCAAATCTTTTTAAAAGG + Intronic
995667248 5:114555565-114555587 CTTTTGCAAATTTCTGCAGCAGG + Intergenic
995691012 5:114825633-114825655 CTTATGCAAATTTCTGTAGCAGG + Intergenic
995988629 5:118209560-118209582 CTTATGCAAATTTCTGTAGCTGG - Intergenic
996467948 5:123825445-123825467 CTTTTGCAAATTTCTGCAGCTGG - Intergenic
996897574 5:128503781-128503803 CTTGGGCAAATTTCTACAGCTGG - Intronic
997102439 5:130983365-130983387 CTTGGGCATATTTTATTATCAGG + Intergenic
997194726 5:131971324-131971346 CTCTGGGAAATTCTTTTATCTGG - Intronic
997492082 5:134285659-134285681 CTTTTGCAAATTTCTGCAGCTGG + Intergenic
998298308 5:140993164-140993186 CTTTGGGAAATTTCTTTAGAGGG + Intronic
999473638 5:151878446-151878468 CTTATGCAAATTTCTTCAGCTGG - Intronic
999875729 5:155803718-155803740 CTTGGGCAAAAGATTTTAGCAGG + Intergenic
1000580449 5:163029350-163029372 CTTTGGCCAATTTTTAAATCAGG + Intergenic
1001004390 5:168037550-168037572 TTTTGGCTAATTTTATTAACAGG + Intronic
1001158493 5:169293756-169293778 CTTTGGCCAATTTTTTTCCAGGG + Intronic
1003690142 6:8346103-8346125 CTTATGCAAATTTTTGCAGCTGG - Intergenic
1004027002 6:11828608-11828630 CTATGGCCAATTTTTACAGCTGG + Intergenic
1004102710 6:12630686-12630708 CTTTGCCCAAATTTTTAAGCAGG + Intergenic
1004864846 6:19843015-19843037 CTTAGGCAAAACTTTTTAGCAGG - Intergenic
1004957304 6:20743137-20743159 CTTGGGAAACTATTTTTAGCAGG + Intronic
1005605688 6:27474691-27474713 CTTTGGCCTATTTTTTTAATCGG - Intergenic
1005632990 6:27726152-27726174 CTTGGGTAAATTTTTTCGGCCGG - Intergenic
1007015015 6:38456858-38456880 GTATGGCAAATTGTTTGAGCAGG - Intronic
1007423123 6:41731521-41731543 CTTTGGCAAAGATTTGTAGAAGG + Intronic
1007968001 6:46021111-46021133 ATTTTGCCTATTTTTTTAGCTGG - Intronic
1008208947 6:48697569-48697591 CTTTGCCATATTTTTGTATCAGG - Intergenic
1008363545 6:50649808-50649830 CTTATGCAAATTTCTGTAGCAGG - Intergenic
1009501590 6:64420434-64420456 CTTATGCAAATTTCTGTAGCAGG + Intronic
1009550707 6:65088670-65088692 CTTATGCAAATTTCTATAGCAGG - Intronic
1010344938 6:74800318-74800340 CTTAGGCAAATTTCTGCAGCAGG - Intergenic
1010441284 6:75897795-75897817 CTTTGGCAAATGTTTATCCCTGG + Intronic
1010766650 6:79782807-79782829 CTTTGAAAGATTTTTTTAGCAGG - Intergenic
1011120768 6:83949796-83949818 CTTGGGCAAATTACTTTATCTGG + Intronic
1011350565 6:86418756-86418778 CTTTGGCCCATTTTTTAATCTGG + Intergenic
1011867899 6:91854182-91854204 CTTATGCAAATTTTTGCAGCAGG - Intergenic
1012019924 6:93905419-93905441 CTTATGCAAATTTTTGCAGCCGG + Intergenic
1012202600 6:96424514-96424536 CTTATGCAAATTTCTTCAGCAGG + Intergenic
1012224093 6:96685663-96685685 CTTATGCAAATTTCTGTAGCTGG - Intergenic
1012898564 6:104979933-104979955 CTTTGGGAAATTTTGTCACCTGG + Intronic
1014143676 6:117971968-117971990 CTTTTGCAAATTTCTCCAGCTGG + Intronic
1014562965 6:122913599-122913621 CTTCTGCAAATTTGTGTAGCTGG - Intergenic
1014705238 6:124738031-124738053 CTTATGCAAATTTCTGTAGCTGG - Intronic
1015042219 6:128735254-128735276 CTTTTGCAAATTTTTTCCGAAGG - Intergenic
1015650971 6:135458756-135458778 ATTTGGCAAATTCTTTGAGCAGG - Intronic
1015832572 6:137386172-137386194 CTTTTGCAGATCTTTTCAGCTGG - Intergenic
1016126257 6:140408131-140408153 CTTATGCAAATTTCTGTAGCAGG - Intergenic
1016143706 6:140644238-140644260 CTTATGCAAATTTCTGTAGCTGG + Intergenic
1016276568 6:142360097-142360119 CCTTGGCAAATTATTTGAGATGG + Intronic
1016775458 6:147899861-147899883 AGTTGTAAAATTTTTTTAGCTGG + Intergenic
1017860609 6:158393876-158393898 CTTATGCAAATTTCTATAGCTGG + Intronic
1018554515 6:165036106-165036128 CTTATGCAAATTTCTGTAGCTGG - Intergenic
1018922762 6:168186798-168186820 CTTATGCAAATTTCTATAGCCGG + Intergenic
1019092304 6:169549194-169549216 CTTTGGCCCAATTTTTTATCGGG - Intronic
1020019652 7:4855760-4855782 CTTTGGCCCATTTTTTAAACTGG + Intronic
1020150477 7:5678126-5678148 TATTGGCAAATTTATGTAGCCGG - Intronic
1020581721 7:10011436-10011458 CTTATGCAAATTTTTGCAGCAGG - Intergenic
1020755104 7:12191529-12191551 CTTATGCAAATTTCTTCAGCAGG + Intergenic
1021222356 7:17988884-17988906 CTTTGGCAACTGTGTTTAGTAGG - Intergenic
1021274374 7:18631337-18631359 CTTTGGTAGATATTTTTAACTGG + Intronic
1021406393 7:20272167-20272189 CTTGGGCAAAATTTCTAAGCTGG - Intergenic
1022487723 7:30793348-30793370 CTTTAGTATTTTTTTTTAGCAGG + Intronic
1024383588 7:48725801-48725823 CTTATGCAAATTTCTGTAGCTGG + Intergenic
1026507486 7:70997754-70997776 CTTTGGTATATTTTCTTACCAGG + Intergenic
1026762255 7:73135682-73135704 GCTTGGCTAATTTTTGTAGCTGG + Intergenic
1027038590 7:74944496-74944518 GCTTGGCTAATTTTTGTAGCTGG + Intergenic
1027084969 7:75257007-75257029 GCTTGGCTAATTTTTGTAGCTGG - Intergenic
1027625975 7:80545382-80545404 CTTATGCAAATTTTTGCAGCTGG - Intronic
1027800104 7:82739573-82739595 CTATGGCAAATTTATCTATCTGG + Intergenic
1028141010 7:87274608-87274630 CTTATGCAAATTTCTATAGCCGG + Intergenic
1028671022 7:93400102-93400124 CTTGGACTAATTTTTGTAGCCGG - Intergenic
1028698081 7:93740916-93740938 CTATTGCAAACTTTTTTAGTTGG + Intronic
1030992904 7:116322749-116322771 CTTTGGGAAGTTTTTGTAGAGGG + Intronic
1031298610 7:120037301-120037323 CTTAGGCAAATATCCTTAGCTGG + Intergenic
1031522022 7:122778420-122778442 CTTGGGCAAATTTTTGCAACAGG - Intronic
1031631818 7:124052469-124052491 CTTTTGCAAAATTTTTTGGGAGG + Intergenic
1031791926 7:126117855-126117877 CTTATGCAAATTTCTGTAGCTGG - Intergenic
1033924073 7:146435367-146435389 ATTGGGCACAGTTTTTTAGCAGG - Intronic
1033998792 7:147386292-147386314 CTTATGCAAATTTCTGTAGCAGG + Intronic
1034876209 7:154726689-154726711 CTTATGCAAATTTCTGTAGCAGG + Intronic
1035180263 7:157084427-157084449 CTTATGCAAATTTCTGTAGCTGG - Intergenic
1035547854 8:497636-497658 CTTATGCAAATTTTTGCAGCTGG - Intronic
1035990748 8:4487686-4487708 TTTTGGCAAAATTTTTTAAATGG - Intronic
1036716165 8:11126032-11126054 CTTTGGCAGTTTTTTTTTGGTGG + Intronic
1037263642 8:17035830-17035852 CTTTTGCAAATTTCTGCAGCTGG - Intronic
1037368186 8:18145207-18145229 CTATGATAAATTTTTCTAGCCGG - Intergenic
1038320595 8:26522671-26522693 CTTTGTACATTTTTTTTAGCTGG + Intronic
1038470975 8:27820305-27820327 CTTTGGGAAATATTTCTAACTGG - Intronic
1039095726 8:33882716-33882738 CTTTGGCCCATTTTTTAATCAGG - Intergenic
1039107469 8:34004605-34004627 CTTTTGCAAATTTTTACTGCTGG + Intergenic
1039178853 8:34840566-34840588 CCTTGACAAATTTTTTTTCCTGG + Intergenic
1039342070 8:36661440-36661462 CCTTTGCCAATTTTTTTAGATGG - Intergenic
1039511314 8:38094425-38094447 CTTTTGCAAATTTCTGCAGCAGG - Intergenic
1040617442 8:49051669-49051691 CTTTGCCACATTTTTGTATCAGG + Intergenic
1041865839 8:62572013-62572035 CTTAGGCAAATTTCTGTAGCTGG + Intronic
1041975419 8:63794072-63794094 CTTGGTCAAATATTTTTTGCTGG + Intergenic
1042466408 8:69133764-69133786 CTTATGCAAATTTCTGTAGCTGG + Intergenic
1042635484 8:70868726-70868748 CTTATGCAAATTTCTTCAGCTGG + Intergenic
1043321718 8:78995095-78995117 CTTTTGCCCATTTGTTTAGCTGG - Intergenic
1043518496 8:81019282-81019304 CTTAGGCAAATTTCTGCAGCTGG - Intronic
1043994224 8:86792912-86792934 ATTAGGCAAATTTTTTTGACTGG - Intergenic
1044185857 8:89251396-89251418 CTTTGGCAGATTTTGGTATCAGG + Intergenic
1044205730 8:89490454-89490476 CTTTTGCAAATTTCTGCAGCAGG - Intergenic
1044277585 8:90320603-90320625 CTTTGTTTAGTTTTTTTAGCTGG + Intergenic
1044324895 8:90847987-90848009 CTTATGCAAATTTCTGTAGCAGG + Intronic
1044960100 8:97522135-97522157 CTTTGCCCATTTTTTTTAACGGG - Intergenic
1045109002 8:98921628-98921650 TTGTGGCAAACTTTGTTAGCTGG + Intronic
1045588237 8:103563163-103563185 CTTTTGCAAATTTCTGCAGCTGG + Intronic
1046311306 8:112440996-112441018 CTTATGCAGATTTCTTTAGCTGG + Intronic
1046380810 8:113447920-113447942 GTTTGGCAGATTGTTTGAGCTGG + Intergenic
1046495706 8:115010660-115010682 CTTTTGCAAATTTCTGCAGCTGG + Intergenic
1046656281 8:116898920-116898942 CTTATGCAAATTTCTGTAGCTGG - Intergenic
1047089348 8:121556553-121556575 TTTTAGCAAATGATTTTAGCAGG - Intergenic
1047221782 8:122924484-122924506 CTTTGACATATCTTTTTAGGGGG + Intronic
1047699910 8:127438560-127438582 CTTTGCCAGATTTTTGTATCAGG - Intergenic
1050442238 9:5677349-5677371 CTTTTGCCCATTTTTTTAGATGG + Intronic
1050939271 9:11439312-11439334 CTTATGCAAATTTCTGTAGCTGG - Intergenic
1051254346 9:15197321-15197343 CTTTGTGAAATATTTTTAGAAGG - Intronic
1051431405 9:16984315-16984337 CTTTGGGAAATTATTTTCCCTGG + Intergenic
1051549549 9:18313999-18314021 CTTTGCCCATTTTTTTTAGTTGG - Intergenic
1051568387 9:18526704-18526726 GTTTGGAGAATTTTTTTAACTGG + Intronic
1051569062 9:18535039-18535061 CTTGTGCAAATTTTTGCAGCAGG + Intronic
1051986545 9:23096306-23096328 CTTATGCAAATTTCTGTAGCTGG - Intergenic
1052019307 9:23507951-23507973 CTTATGCAAATTTCTTCAGCTGG - Intergenic
1053703903 9:40730303-40730325 CTTATGCAAATTTTTGCAGCTGG + Intergenic
1054413986 9:64853912-64853934 CTTATGCAAATTTTTGCAGCTGG + Intergenic
1055341964 9:75293351-75293373 CTTTTGCAAATTTCTGCAGCTGG + Intergenic
1055845048 9:80551819-80551841 CTTTGTCCATTTTTTTTAGTTGG + Intergenic
1055848279 9:80594134-80594156 CTTAGGCAAATTTCTGTAGCAGG - Intergenic
1057204996 9:93166199-93166221 CCTTGGGAAAGTTTTATAGCAGG + Intergenic
1058393716 9:104525325-104525347 CTTATGCAAATTTCTGTAGCAGG + Intergenic
1058939321 9:109798592-109798614 CTTTGCCCAATGTTTTTAACTGG - Intronic
1059871798 9:118586528-118586550 CTTATGCAAATTTCTGTAGCCGG - Intergenic
1186003350 X:5039575-5039597 CTCTGGCATATTTTATTAGACGG + Intergenic
1187603701 X:20861151-20861173 CTTGTGCAAATTTCTGTAGCCGG - Intergenic
1189652714 X:43207775-43207797 CTTATGCAAATTTTTGCAGCAGG - Intergenic
1189841743 X:45086695-45086717 CTTTGGAATTTTTTTTTAGTTGG + Intronic
1189869616 X:45368737-45368759 CTTATGCAAATTTTTGCAGCAGG - Intergenic
1190466092 X:50726368-50726390 CTTATGCAAATTTCTATAGCAGG - Intronic
1192350390 X:70351055-70351077 CTTTGGCAAATTATTTTTTGGGG - Intronic
1192525031 X:71835265-71835287 CTTTGCCCAATTTTTTTATGGGG - Intergenic
1193246607 X:79237312-79237334 CTTATGCAAATTTCTGTAGCAGG + Intergenic
1193678280 X:84483690-84483712 CTTATGCAAATTTCTTCAGCTGG + Intronic
1193789262 X:85798761-85798783 ATTTGGCCCATTTATTTAGCTGG + Intergenic
1193890911 X:87045461-87045483 CTTACGCAAATTTCTGTAGCAGG - Intergenic
1193930035 X:87542276-87542298 CTTTTGCAAATTTCTGCAGCAGG - Intronic
1194352753 X:92840499-92840521 CTTTTGCAAATTTCTGCAGCAGG + Intergenic
1195133766 X:101881988-101882010 TTTTGACAAATTTTTTACGCTGG - Intergenic
1195138005 X:101930764-101930786 GTTTGGGAAATGTTCTTAGCTGG - Intronic
1196368346 X:114947492-114947514 CTTATGCAAATTTTTGCAGCTGG + Intergenic
1196543692 X:116938004-116938026 CTTATGCAAATTTCTGTAGCAGG + Intergenic
1196762781 X:119214646-119214668 CTCTGGCAAATTTTTTTCTAAGG - Intergenic
1196767274 X:119258594-119258616 CTTTTGCAAATATTTTCTGCCGG - Intergenic
1197303550 X:124811333-124811355 CTTTTGCCAATTTTTTAATCAGG - Intronic
1197566584 X:128095356-128095378 CTTTTGCAAATTTCTGCAGCTGG + Intergenic
1197567221 X:128101991-128102013 CTTATGCAAATTTCTATAGCTGG + Intergenic
1197581841 X:128293951-128293973 CTTATGCAAATTTCTGTAGCAGG - Intergenic
1197975610 X:132163110-132163132 CTTATGCAAATTTTTGCAGCTGG - Intergenic
1198274608 X:135089171-135089193 CTTATGCAAATTTCTTCAGCAGG - Intergenic
1198817482 X:140608197-140608219 CTTATGCAAATTTCTGTAGCAGG - Intergenic
1198912770 X:141633293-141633315 CTTATGCAAATTTTTGGAGCTGG - Intronic
1199220388 X:145309898-145309920 CTTATGCAAATTTTTGCAGCAGG + Intergenic
1200043274 X:153385278-153385300 CTTTTTAAAATTTTTTGAGCTGG - Intergenic
1200332380 X:155311133-155311155 CTTATGCAAATTTCTGTAGCTGG + Intronic
1200661056 Y:5957241-5957263 CTTTTGCAAATTTCTGCAGCAGG + Intergenic
1200679690 Y:6195125-6195147 CTTATGCAAATTTTTGTATCTGG + Intergenic
1200979743 Y:9251673-9251695 CTGTGGCAAATTTTAGTAGTGGG - Intergenic
1201400449 Y:13599067-13599089 CTTAGGCAAATTTGTGCAGCTGG - Intergenic
1202131639 Y:21617576-21617598 CTGTGGCAAATTTTAGTAGTGGG + Intergenic