ID: 1184262164

View in Genome Browser
Species Human (GRCh38)
Location 22:43324652-43324674
Sequence TATCCAGGAGTCGCCGCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 63}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184262160_1184262164 26 Left 1184262160 22:43324603-43324625 CCAGCTAAAAAAATTTGCCAAAG 0: 1
1: 0
2: 0
3: 37
4: 522
Right 1184262164 22:43324652-43324674 TATCCAGGAGTCGCCGCCCCTGG 0: 1
1: 0
2: 0
3: 7
4: 63
1184262162_1184262164 9 Left 1184262162 22:43324620-43324642 CCAAAGCAAGTGGATTTATTATT No data
Right 1184262164 22:43324652-43324674 TATCCAGGAGTCGCCGCCCCTGG 0: 1
1: 0
2: 0
3: 7
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184262164 Original CRISPR TATCCAGGAGTCGCCGCCCC TGG Intronic
900004820 1:37961-37983 TAGCCAGGAGTCTCATCCCCTGG + Intergenic
905028932 1:34868765-34868787 TATCCAGGAGTCACGGCGGCCGG + Exonic
910292475 1:85612785-85612807 TATCCAGGAGTAGCCTCCACAGG - Intergenic
918240312 1:182615039-182615061 TATCCGCGGCTCGCCGCCCCGGG + Intergenic
922406956 1:225324091-225324113 TAGGCATGAGCCGCCGCCCCCGG + Intronic
1065298823 10:24302313-24302335 AATCCAGGAGTGGCCAACCCAGG - Intronic
1066963604 10:42242298-42242320 TATGGAGCAGTCGCCGCCGCCGG - Intergenic
1070592634 10:77811659-77811681 TAGCCAGGAGTTGTGGCCCCGGG - Intronic
1073899887 10:108207757-108207779 TATGCATGAGTCACCGCACCTGG - Intergenic
1084381019 11:68812817-68812839 TCCCCAAGAGTCGACGCCCCGGG + Intronic
1084791998 11:71480931-71480953 CCTCCAGGAGTCCCCACCCCAGG - Intronic
1091378231 12:40012-40034 TAGCCAGGAGTCTCATCCCCTGG + Intergenic
1092243747 12:6851448-6851470 TATCAAGGAGGCGTCACCCCTGG - Exonic
1096675044 12:53221704-53221726 TTTCCGGGAGTCGCCGCTGCTGG - Intronic
1103571344 12:121847036-121847058 GATCCAGGTGAGGCCGCCCCTGG - Exonic
1113833496 13:113314349-113314371 CCTCCAGGAGGCCCCGCCCCAGG - Intronic
1113833737 13:113315260-113315282 CCTCCAGGAGGCCCCGCCCCAGG - Intronic
1130411989 15:83654839-83654861 CAGCCAGGAGTCGCCGCCTCAGG + Intronic
1132448690 15:101952983-101953005 TAGCCAGGAGTCTCATCCCCTGG - Intergenic
1133250394 16:4476737-4476759 TCTCCAGAAGTCGTCTCCCCGGG + Intronic
1135494827 16:22942289-22942311 TCTCCAGGAGTTGCTTCCCCTGG - Intergenic
1136838093 16:33516672-33516694 TATGGAGCAGTCGCCGCCGCTGG - Intergenic
1137259954 16:46818151-46818173 TAGGCATGAGTCACCGCCCCTGG + Intronic
1203148266 16_KI270728v1_random:1816952-1816974 TATGGAGCAGTCGCCGCCGCTGG - Intergenic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1152627372 17:81393820-81393842 AATCCCGGAGTCCCCGCCCGCGG + Intergenic
1160636572 19:79570-79592 TAGCCAGGAGTCTCATCCCCTGG + Intergenic
1160796858 19:949585-949607 TAGGCAGGAGCCGCCGCCCCTGG + Intronic
1163405786 19:17121462-17121484 TATCCAAGAGCTGCCGCCACAGG + Intronic
1164976987 19:32581035-32581057 GATCCCGGAGGCCCCGCCCCAGG + Intergenic
1165871392 19:38975752-38975774 GATCTCAGAGTCGCCGCCCCCGG - Exonic
925708416 2:6713398-6713420 TTTCCTGGAGTCGCTGCCTCTGG - Intergenic
926130722 2:10302186-10302208 GAGCCAGGAGGCGCCGACCCTGG + Intergenic
933559276 2:83872071-83872093 GATCCAGGAGTGGCCAACCCAGG + Intergenic
937707854 2:124941878-124941900 TAGCCAGCAGTAGCAGCCCCTGG - Intergenic
944101906 2:196036482-196036504 TATCCAGGAGTCTTCCCCCAAGG + Intronic
948470188 2:238172562-238172584 TCTCCAGCAGCCGCCGCCTCTGG - Intronic
948974292 2:241454059-241454081 TAGCCATGAGTCACCGCACCCGG + Intronic
1175230061 20:57468102-57468124 TTTCTAGGAGCCGCTGCCCCGGG - Intergenic
1176169083 20:63689070-63689092 TATGCAAGGGTTGCCGCCCCTGG + Exonic
1179547140 21:42120465-42120487 TTACCAGGTGTCCCCGCCCCGGG + Intronic
1180309647 22:11158804-11158826 TATGGAGCAGTCGCCGCCCCCGG + Intergenic
1180548124 22:16520614-16520636 TATGGAGCAGTCGCCGCCCCCGG + Intergenic
1183192033 22:36327788-36327810 TCTCCAGGAGTCGACTTCCCTGG + Intronic
1184262164 22:43324652-43324674 TATCCAGGAGTCGCCGCCCCTGG + Intronic
953804951 3:46060723-46060745 TAGCCAGGAGTCACCGGTCCAGG - Intergenic
955671100 3:61404172-61404194 TATCAAGGAGTCTCTGCTCCAGG + Intergenic
970194471 4:13541640-13541662 TCTCCAGGAGTTGCCGCTCAGGG + Exonic
979565796 4:122152694-122152716 TATGAAGGAGTCGCCGCCGCAGG - Intronic
986557960 5:9030345-9030367 AATCCAGGAGTCGCCTCACCAGG + Intergenic
991488702 5:67163955-67163977 TATGCAGGAGGCGCCACCGCTGG + Exonic
1005339543 6:24830508-24830530 TATCCAGGACTTGCAGACCCAGG - Exonic
1007161150 6:39792629-39792651 TTTGCAGGAGCCGCCGACCCCGG + Intronic
1008381875 6:50845975-50845997 CCTCCAGGAGCCGGCGCCCCGGG - Exonic
1017981080 6:159401643-159401665 AATCCAGGAGTGGCCAACCCAGG - Intergenic
1019424747 7:969226-969248 TACCCAGGAGACGCCCCCACAGG + Exonic
1024081737 7:45862290-45862312 TCTCCAGGAGTCACCACACCTGG - Intergenic
1026708699 7:72717528-72717550 GATCCAGGAGTGGCCAACCCGGG - Intronic
1026889129 7:73971965-73971987 TTTCCAGGAGTCACCTCACCTGG - Intergenic
1027991725 7:85371425-85371447 TATCCAGGAGTCCCTGACCTGGG - Intergenic
1030715144 7:112800704-112800726 AATCCAGGAGTGGCCAACCCAGG - Intergenic
1039454320 8:37697383-37697405 TTTGCGGGAGTCGCCGCCGCCGG - Exonic
1039489519 8:37937093-37937115 CACCCAGGAGTGGCGGCCCCAGG + Intronic
1040415109 8:47188770-47188792 TTTCCAGGAGCCGCCACCGCTGG + Intergenic
1049657716 8:143806075-143806097 TCTCCAGGAGGGGCCGCTCCTGG - Intronic
1049887514 9:37743-37765 TAGCCAGGAGTCTCATCCCCTGG + Intergenic
1051780515 9:20684203-20684225 TCTCCTGCAGTCCCCGCCCCCGG + Intronic
1056598856 9:88030299-88030321 TATCCATGAGCCACCTCCCCTGG + Intergenic
1062230359 9:135479165-135479187 GCTCGAGGAGCCGCCGCCCCGGG + Intronic
1062370584 9:136236781-136236803 GCTCCAGGTGTCGCCGGCCCAGG - Intronic
1197749966 X:129957487-129957509 TATCTCGGAGCCGCAGCCCCGGG + Intergenic