ID: 1184264224

View in Genome Browser
Species Human (GRCh38)
Location 22:43338293-43338315
Sequence CTGCCCTGCACCTGGGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 485
Summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 447}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184264224_1184264230 -2 Left 1184264224 22:43338293-43338315 CCAGCACCCCAGGTGCAGGGCAG 0: 1
1: 0
2: 4
3: 33
4: 447
Right 1184264230 22:43338314-43338336 AGAAAGGCTGGAGAGACAGATGG 0: 1
1: 1
2: 9
3: 118
4: 1163
1184264224_1184264232 30 Left 1184264224 22:43338293-43338315 CCAGCACCCCAGGTGCAGGGCAG 0: 1
1: 0
2: 4
3: 33
4: 447
Right 1184264232 22:43338346-43338368 ACCAGTGTCTGTCCAAGCACTGG 0: 1
1: 0
2: 0
3: 11
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184264224 Original CRISPR CTGCCCTGCACCTGGGGTGC TGG (reversed) Intronic
900103460 1:972442-972464 CTGCCCAGGACCTGGGCTGTGGG - Intronic
900134080 1:1106875-1106897 CTGCCCAGGGCCGGGGGTGCCGG - Intronic
900156672 1:1205981-1206003 CTGACCTGCACCTGGGGATGAGG - Intronic
900179492 1:1304998-1305020 CTGCCCTAGACCTGGAGTCCTGG - Intronic
900376596 1:2357546-2357568 CAGCCCCGCAGCTGGGGTGCCGG - Exonic
900419541 1:2549744-2549766 CCCCTCTGCACCTGGGGTGGTGG + Intergenic
900425691 1:2577642-2577664 CCCCTCTGCACCTGGGGTGGTGG - Intergenic
900468526 1:2838196-2838218 TCTCCCTGCACGTGGGGTGCTGG + Intergenic
900657156 1:3764058-3764080 CTGCCCTGTCCCTGGGCTGGAGG + Intronic
900920549 1:5667676-5667698 CTCCCCTGCACCAGTGGTTCAGG + Intergenic
901229948 1:7636153-7636175 CTGCCCAACACCGGGGGTGGGGG - Intronic
901640100 1:10688789-10688811 CTGCCCTGCACAGGTGGTCCCGG + Intronic
901653428 1:10755863-10755885 ATGGCCTGCAGCTGGGGTGGGGG - Intronic
901814877 1:11788300-11788322 CTGCCAGGCACCTGGCCTGCTGG - Exonic
902470728 1:16646351-16646373 CTGCCCTGCAGAGTGGGTGCAGG - Intergenic
902531469 1:17093536-17093558 AGGCCCTGCACTTGGGGGGCAGG - Intronic
902916662 1:19644035-19644057 CTGCCCTGCCTCTCGGGCGCCGG + Intronic
902921441 1:19668056-19668078 CTGCCTATCACCTGGGGTGGGGG + Intronic
903264016 1:22145738-22145760 CTTGCCTTCTCCTGGGGTGCTGG + Intergenic
903383235 1:22910717-22910739 CTGCCCTGCCTTAGGGGTGCAGG + Intronic
904054194 1:27659519-27659541 GTACCCTGCACTAGGGGTGCTGG - Intergenic
904618448 1:31762324-31762346 CTGCACTGCTACTGGGGTGAGGG - Intronic
904630219 1:31835645-31835667 CTCCCTTGCAGCTAGGGTGCAGG - Intergenic
904800628 1:33090459-33090481 CGGCCCTGCACTGGGTGTGCAGG - Intronic
904821443 1:33247370-33247392 CAGCCCTGCATTTTGGGTGCTGG - Intergenic
905462528 1:38130993-38131015 CTGCTCAGCAGGTGGGGTGCTGG - Intergenic
905480355 1:38257699-38257721 CTGCCAGGCACATGGGGTGTGGG - Intergenic
906684775 1:47756280-47756302 CAGCCCTCCACCTGTGCTGCTGG + Intergenic
907655751 1:56340480-56340502 CTGCCTTGTCCCTGGGGTGGTGG - Intergenic
908318990 1:62963102-62963124 ATGCCCTGCACATGGGGAGGGGG + Intergenic
909887558 1:80961898-80961920 ATTCACTGCACCTGGGCTGCAGG - Intergenic
911019935 1:93375844-93375866 CTGCCCAGGACTTGGGGTGGGGG + Intergenic
911924879 1:103817364-103817386 CTGCCTTGCCACTGGGGTGAGGG - Intergenic
913505128 1:119509898-119509920 CAGTCCTGCACCTGGTGTACAGG + Intronic
913508504 1:119541192-119541214 CAGTCCTGCACCTGGGGTACAGG + Intergenic
913515684 1:119603683-119603705 CAGTCCTGTACCTGGTGTGCAGG + Intergenic
916214577 1:162384285-162384307 TTGCTCTGCCCCTGGGGTGGAGG + Intronic
916568000 1:165998566-165998588 CTACCCTGCACGTGTGCTGCTGG - Intergenic
916931796 1:169586413-169586435 CTGCCCAGGTCCTGGGGTGGTGG - Exonic
919907049 1:202085397-202085419 GTGCACTGCAGCTTGGGTGCTGG - Intergenic
920243319 1:204569669-204569691 CAACCCTGCACCCTGGGTGCTGG + Intergenic
920311060 1:205048521-205048543 CTGCCCTGGTGCAGGGGTGCAGG - Intronic
920365258 1:205444895-205444917 TTGCCCTTTACCTGGGGTGGGGG - Intronic
921001718 1:211051032-211051054 CTGCACTCCAGCTGGGGTGATGG - Intronic
921191127 1:212709449-212709471 CTGCCCAGCCACTGGGGTGGAGG + Intergenic
922883201 1:228998258-228998280 CGGCCCAGCACATGGGGAGCGGG - Intergenic
922896146 1:229102025-229102047 CTGCCTTTCACCTGGGTTTCTGG + Intergenic
922972514 1:229754868-229754890 CTGCCTAGCAGGTGGGGTGCAGG - Intergenic
923243226 1:232106059-232106081 CTGCCCTTCACCTGCAGAGCAGG + Intergenic
923261158 1:232269277-232269299 CTGTCTTGCAGCTAGGGTGCTGG + Intergenic
923314982 1:232771692-232771714 CTGCGCTCACCCTGGGGTGCGGG - Intergenic
923365972 1:233261797-233261819 CTGCCGTCCACCTGCGCTGCTGG - Intronic
923986438 1:239387240-239387262 CTGCCCAGCGCCTGGGTGGCGGG - Intronic
924705700 1:246500209-246500231 CTCCCTTGCAGCTAGGGTGCGGG - Intronic
1063390864 10:5649189-5649211 CTGCCCTGCACCAAGGATGGAGG - Intronic
1064156814 10:12909437-12909459 CTGCCCTGCCCATGGAGTGTGGG + Intronic
1065554893 10:26905647-26905669 CTGCCCAGGGCCAGGGGTGCCGG - Intergenic
1066517444 10:36178763-36178785 CTGCTGTCCAGCTGGGGTGCTGG + Intergenic
1066648979 10:37637981-37638003 ATGCCCTGCACATGGGGTGCAGG - Intergenic
1067174208 10:43931042-43931064 ATGCATTGCACCTGGGCTGCTGG + Intergenic
1067710633 10:48648743-48648765 CTGCTCTGCACCAGCAGTGCCGG - Intronic
1068554968 10:58448515-58448537 CTGCCCAGGACCTGCGGCGCTGG + Intergenic
1069590810 10:69640792-69640814 CTGCCCTGTCCCCGGGGAGCAGG + Intergenic
1069855775 10:71440185-71440207 CCGTCCTCCTCCTGGGGTGCAGG + Intronic
1069906932 10:71737591-71737613 CTTCCCTGCATGTGGGGTTCAGG - Intronic
1070834192 10:79437701-79437723 CTGCGCTGCATGAGGGGTGCAGG + Intronic
1071596678 10:86932950-86932972 CTGCTGTGTACCTGGGGTTCAGG + Intergenic
1072336947 10:94405733-94405755 CTTACCTGCAGGTGGGGTGCAGG + Intronic
1073255528 10:102148541-102148563 GCGCCATGCACCTGGGATGCAGG + Intronic
1075646545 10:124100582-124100604 CTGTCTTTCACCTGGGATGCCGG - Intergenic
1075895347 10:125990114-125990136 CTGCTCTGTACCTGGGGAGGAGG - Intronic
1076922294 10:133460351-133460373 GTTCCGTGCACCTGGGGAGCTGG + Intergenic
1077120684 11:906597-906619 CTGCCATGCTCGTGGTGTGCCGG + Intronic
1077247344 11:1546192-1546214 CCGCCCTGCACCTGGGCTGGGGG + Intergenic
1077330631 11:1982501-1982523 CTGCCCAGCTCCTGGGCTGTGGG + Intronic
1077507117 11:2934919-2934941 CCGCCCTGCACCTGGCTTGTGGG + Intergenic
1077514878 11:2995420-2995442 ATGCCCTTCACCTGTGGTGGGGG + Intergenic
1077532689 11:3104585-3104607 CGGGCCTGGACCTGGGCTGCGGG - Intronic
1080037295 11:27722643-27722665 CTGCCCCGCCGCCGGGGTGCCGG + Intergenic
1081675294 11:44965076-44965098 CTGCCCTTCACCTGCGTTCCGGG + Intergenic
1081702001 11:45158202-45158224 CTGCCCTGTCCCAGGGCTGCTGG + Intronic
1082010628 11:47447784-47447806 CTGCTGTCCCCCTGGGGTGCAGG + Intronic
1082078895 11:47996703-47996725 TTGCCATGCACCCAGGGTGCAGG + Intronic
1083176281 11:60952000-60952022 CTGCCCTGGGCGTGGGGTGGGGG + Intronic
1084190056 11:67494699-67494721 CTGCCCCGCCCCTGGGGTCCTGG - Intronic
1084403831 11:68959912-68959934 CTGCCCTGTTCCTGGTCTGCAGG + Intergenic
1084519276 11:69653663-69653685 CTTCCCTGCGCCTGTGATGCTGG + Exonic
1084657683 11:70528704-70528726 CTTCCATGCCCCTGGGGAGCCGG - Intronic
1085345249 11:75764430-75764452 CCGCTTTGCACATGGGGTGCAGG - Intronic
1085527038 11:77170346-77170368 CTGAGGTGCACCTGGGATGCAGG - Intronic
1085614187 11:77982518-77982540 CTCCCCTGCAGCTGGGGCCCAGG - Intronic
1086061796 11:82707608-82707630 ATGCCTGGCACCTGGTGTGCTGG + Intergenic
1087932981 11:103999717-103999739 CTGCCCGTAACCTGGGATGCTGG + Intronic
1088130723 11:106486990-106487012 CTGCACTTCACCCGGGGTGATGG - Intergenic
1088333196 11:108674545-108674567 CTGCACTGCACCCTGGGTGACGG - Intronic
1090240707 11:125179550-125179572 CTGACAGGCAGCTGGGGTGCTGG + Intronic
1090347115 11:126080462-126080484 CTCCCCTGGAGCTGGGGTGGGGG - Intergenic
1090383011 11:126339851-126339873 CTGCCCTGCACCTAGAGATCCGG + Intronic
1090780248 11:130001823-130001845 CTGCGCTGCACCCTGGGTGCAGG + Intronic
1091037309 11:132245621-132245643 CTGCCCCGCACCAGGACTGCAGG - Intronic
1091129680 11:133134812-133134834 CTGCCTTGTAGCTGGGGTGCAGG - Intronic
1091237224 11:134030498-134030520 ATCCCCTGCACCTGGTGTTCTGG + Intergenic
1202813609 11_KI270721v1_random:37680-37702 CTGCCCAGCTCCTGGGCTGTGGG + Intergenic
1091787878 12:3253882-3253904 CAGCCACGCACCTGGGGTTCTGG - Intronic
1092115190 12:5996068-5996090 CTGCCTTGCTCCAGGGCTGCAGG + Exonic
1092117236 12:6018356-6018378 CTCCCCTGCACCTGGTATGCTGG - Exonic
1093373105 12:18388305-18388327 CTGCCCTCCAGCTTGGGTGATGG - Intronic
1093766354 12:22967838-22967860 CTGCACTGCACCTGTTGTGCAGG - Intergenic
1095097962 12:38158061-38158083 CTGGCTTGCACCGAGGGTGCGGG + Intergenic
1095423789 12:42053131-42053153 CTGCGCTGCACCTGGAGAGACGG + Intergenic
1096807337 12:54148756-54148778 CTTCCCTCCACCTTGGCTGCTGG + Intergenic
1097899933 12:64862508-64862530 CTGCCCTGCCCCAGGGATGATGG - Intronic
1099709042 12:86196403-86196425 CAGCCCTGCCCCTGAGGTACTGG + Intronic
1101044882 12:100794701-100794723 CTCCCCTGCACCTGGGGAGGGGG + Intronic
1101201206 12:102438270-102438292 CTGGCCTGCACATTGGCTGCTGG + Intronic
1101304897 12:103518569-103518591 CTCCCTTGTACCTGGGATGCAGG - Intergenic
1102238775 12:111310714-111310736 ATGCCCTGGACCTGGCGTGGTGG - Intronic
1103351904 12:120289754-120289776 CTGCACTCCAGCTGGGGTGACGG + Intergenic
1104062494 12:125280557-125280579 CTCCCCTGGACCTAGGCTGCCGG + Intronic
1104248018 12:127061454-127061476 CTGTCCTGCTTCTGGGTTGCAGG - Intergenic
1104661849 12:130616974-130616996 CTGACCTGAAGTTGGGGTGCAGG + Intronic
1104736508 12:131138746-131138768 CTGCCCTGCTCCATGGGAGCTGG + Intronic
1105243685 13:18628926-18628948 CTCCCCTGCACCTAGGGTCCGGG - Intergenic
1105804861 13:23946899-23946921 CTGCCCTGACTCTAGGGTGCGGG - Intergenic
1106313200 13:28571714-28571736 CTGCTCTGGGCCTTGGGTGCAGG + Intergenic
1106581617 13:31023678-31023700 CTGTCATCCACCTGGGGTTCTGG - Intergenic
1108128718 13:47273909-47273931 CAGCCCTGCTCCTGGGGCCCAGG - Intergenic
1109971120 13:69770190-69770212 CTGGCTTTCACCTTGGGTGCTGG - Intronic
1112235338 13:97630888-97630910 CTGCCCTGCACATTGAATGCTGG + Intergenic
1112431626 13:99355492-99355514 CTGACCTGCAGCTGGGCTGTGGG + Intronic
1113384868 13:109839359-109839381 CTGCCATGCACCTGCAGTGGTGG + Intergenic
1113804942 13:113107071-113107093 CTTCCCTGGGACTGGGGTGCAGG + Intronic
1114216426 14:20660818-20660840 GTGGCCTGCACCTGTGGTCCTGG + Intergenic
1114558025 14:23572833-23572855 CTTCCCTGCTCCTTAGGTGCAGG + Intronic
1114814898 14:25945608-25945630 CTGCCCTGCAGCTGATGTGAAGG - Intergenic
1117722180 14:58638419-58638441 CTGCGCGGCGCCGGGGGTGCGGG + Exonic
1119001870 14:70889644-70889666 CTGCCTTGCTCCTGGGCTCCTGG - Intergenic
1119494785 14:75069436-75069458 CAGCCCTGCCCTTGGGGAGCCGG - Exonic
1119522177 14:75294389-75294411 CTGCCCCGCCCCTGGAATGCTGG + Intergenic
1119601720 14:75981166-75981188 TTGCCCTCCACCTGGCCTGCTGG - Exonic
1119768990 14:77208571-77208593 CTCCCTTGCAGCTGGGGTTCTGG - Intronic
1120855894 14:89212345-89212367 CTTCCTTGCAGCTGGGGTTCTGG + Intronic
1121279241 14:92687563-92687585 CAGCATTGCGCCTGGGGTGCAGG + Intronic
1121731861 14:96192941-96192963 CTTTTCTGCACCTGGGGTGCAGG + Intergenic
1122023721 14:98859574-98859596 CTGCCCTGCAGCTTGAGGGCTGG - Intergenic
1122128418 14:99591519-99591541 CTGCCCTTCCTCTGAGGTGCAGG - Intronic
1122634725 14:103124592-103124614 CTGCCATTCTCCTGGGGTGGGGG - Intronic
1122782431 14:104149369-104149391 CTGGCTGGCACCTGGGCTGCTGG + Intronic
1122807963 14:104270226-104270248 CTCCCCTGGCCGTGGGGTGCCGG - Intergenic
1122875474 14:104662349-104662371 CTCCCCTGGCCGTGGGGTGCCGG + Intergenic
1123487608 15:20755705-20755727 CTCCCCCGCACCTAGGGTCCCGG + Intergenic
1123544100 15:21324763-21324785 CTCCCCCGCACCTAGGGTCCCGG + Intergenic
1124971897 15:34496314-34496336 GTGCCCAGCTCCTGGGGGGCTGG - Intergenic
1125736314 15:41928888-41928910 CTGCCCTGCATCTGGTCAGCTGG - Intronic
1126111818 15:45179685-45179707 GTGCAGTGCTCCTGGGGTGCTGG - Intronic
1126164430 15:45642481-45642503 CTGGCCTGCACTTGGCCTGCAGG + Intronic
1126775293 15:52095040-52095062 CTGCCCTTCAGCTGTGGTGTTGG + Intergenic
1127065040 15:55228377-55228399 CTGCCTTGCACCTGGAGCACAGG + Intronic
1128290704 15:66476406-66476428 ATGCCCTGCTCCTGGAGTCCTGG - Intronic
1128786017 15:70398006-70398028 CTGTCCTGCTCCTGGGGGCCTGG + Intergenic
1129172691 15:73817677-73817699 CAGGCCTGGGCCTGGGGTGCTGG - Intergenic
1129455202 15:75673101-75673123 CTGCCCTGCCCCCAGGGAGCTGG - Intergenic
1129523655 15:76200935-76200957 CTGCCCTGACCCTGGGAGGCTGG - Intronic
1130938805 15:88491119-88491141 CTGCCCTGTGCCTGGGAGGCTGG - Intergenic
1131259910 15:90882870-90882892 CTGCCCTGGCCCTGAGGTGTGGG + Exonic
1131550174 15:93350508-93350530 CTGCCCTGCAGAGGAGGTGCAGG + Intergenic
1132092462 15:98957319-98957341 CGGCCCCGGCCCTGGGGTGCTGG + Exonic
1132336373 15:101050933-101050955 CTGCCCAGCACCTGCTGTGTGGG - Intronic
1132451586 15:101971702-101971724 CTGCTCTGCACGTGGAGTGTTGG + Intergenic
1202952442 15_KI270727v1_random:52036-52058 CTCCCCCGCACCTAGGGTCCCGG + Intergenic
1132659662 16:1055715-1055737 GTGGCTTGCACCTGGTGTGCTGG - Intergenic
1133233404 16:4376826-4376848 CTGCCCTTCACCCTGGGGGCTGG - Intronic
1133806370 16:9128515-9128537 CTGTCCTGGATCTGGGGTTCTGG + Intergenic
1134456548 16:14399537-14399559 CTGCCCTGCCCTTGGTGTCCTGG + Intergenic
1135146064 16:19963737-19963759 CTTCCTTGCACCTGGGCGGCTGG + Intergenic
1135401709 16:22170619-22170641 CTGCCCTTAACTTAGGGTGCAGG - Intronic
1136230141 16:28880903-28880925 CAGGCCAGCACCTGGGGAGCAGG - Exonic
1136349326 16:29696879-29696901 CAGCACTGCAGCTGGGGCGCGGG - Intronic
1136645217 16:31608307-31608329 CTGCCAAGCACCTGGGGGGAGGG + Intergenic
1136912684 16:34157572-34157594 CTGCACTCCAGCTGGGGTGGGGG - Intergenic
1137559355 16:49492933-49492955 CTGCGGTGCCCATGGGGTGCAGG - Intronic
1138121246 16:54402472-54402494 CTGCCCAGCATCTGGGGCGCTGG + Intergenic
1138354507 16:56366792-56366814 CTGCCCTACACCTGTGGCCCTGG - Intronic
1138615543 16:58162700-58162722 TGGCCCTGCAGCTGGGGTGAGGG + Intronic
1140753052 16:78043609-78043631 CTGCCCTGTCCCTGGCTTGCTGG - Intronic
1141890833 16:86925498-86925520 CTGCCCTGCAGAAAGGGTGCTGG - Intergenic
1142286807 16:89174844-89174866 CAGCCCTGCACCTGGGGTAGGGG - Intronic
1142392521 16:89811518-89811540 CTGCCATGCACCTGGTGGGCAGG + Intronic
1142408298 16:89903287-89903309 CTGCCCTCAACCTGCAGTGCTGG + Intronic
1142763520 17:2054218-2054240 CTGACCTTCACGTGGGGCGCGGG + Intronic
1143345424 17:6245464-6245486 CTGCCCTTCCCCTAGGATGCTGG + Intergenic
1143419123 17:6775709-6775731 CTGCCCTTATCCTGGGGTCCTGG - Intergenic
1143610765 17:8016275-8016297 CTGACCTGCAACCGGGGTGAGGG + Exonic
1144727330 17:17508352-17508374 CTGGCCTGGACGTGGGGTGGGGG + Intronic
1144804681 17:17956749-17956771 CTGCCCGGGGCCTGCGGTGCTGG + Intronic
1145027362 17:19478289-19478311 GTGCCCTGCACTGGGGGTCCTGG + Intergenic
1145251593 17:21299643-21299665 CTGCCCTCCAGCTTGGGTGACGG + Intronic
1145868455 17:28255558-28255580 CTCCAGTGCATCTGGGGTGCTGG + Intergenic
1146627246 17:34444016-34444038 CAGAACTGCACCTGGGGTGAGGG - Intergenic
1146678720 17:34791884-34791906 CTGCCCTCCCCATGGGCTGCAGG + Intergenic
1146955621 17:36935059-36935081 CTGCCCTGACCCGTGGGTGCCGG - Intergenic
1147121884 17:38339945-38339967 CTGCCCTGTACCTGGGAGGAAGG + Intronic
1147442137 17:40453804-40453826 CTGCCCAGCCCCTGGGGCTCAGG + Intronic
1147805329 17:43126922-43126944 CTGCCCGGGGCCGGGGGTGCGGG - Intergenic
1147944871 17:44075231-44075253 CTGCACTGCAGCTGGGGGTCGGG + Intronic
1147984662 17:44298532-44298554 CTGCCCTGCACAGGAGGTGAGGG + Intergenic
1149659196 17:58325567-58325589 CTGCCTTGCAGCGGGAGTGCAGG - Exonic
1150226990 17:63529653-63529675 ATGCCCTGCTCCTGTGATGCAGG - Intronic
1151349679 17:73524412-73524434 CTGCCCTTCCCCTGGTGGGCTGG + Intronic
1151476089 17:74345041-74345063 CTCCCCTGTTCCTGTGGTGCTGG - Intronic
1151678740 17:75613305-75613327 CTGCCATGCCCCTGGGGGCCTGG - Intergenic
1151980196 17:77504056-77504078 CAGCCCTGGTCCTGGGGTGTCGG + Intergenic
1152073249 17:78144460-78144482 CTGCCCAGGCCCTGGGCTGCTGG - Intergenic
1152075667 17:78158264-78158286 CTGCCCTGGTCCTAGGCTGCTGG + Intronic
1152239261 17:79153014-79153036 CTGCCCTGCACTTAGGGAGTAGG - Intronic
1152250342 17:79209236-79209258 CTGGCCTGCTCCTGGGATGGGGG - Intronic
1152858514 17:82680286-82680308 CTGCCCTGGCCCTGGGTCGCAGG + Intronic
1153328415 18:3846779-3846801 TTGCCCTGGACCTGGGGTAGGGG + Intronic
1153354829 18:4123263-4123285 CTTTCCTGCACCTGGAATGCAGG - Intronic
1153724635 18:7942493-7942515 CTGCCCTGTATCTGGAGGGCAGG - Intronic
1154445257 18:14430959-14430981 CTCCCCTGCACCTAGGGTCCGGG + Intergenic
1155156265 18:23160427-23160449 CTGCCCTGCAGGTGCAGTGCCGG + Intronic
1157601129 18:48893865-48893887 CTGCCTTGAAGCAGGGGTGCGGG - Intergenic
1158319636 18:56248867-56248889 CTGCCCAAGACCTGGGGTGGGGG + Intergenic
1160179340 18:76620337-76620359 CTCCCCAGCACGTGGGGGGCGGG - Intergenic
1160391733 18:78539233-78539255 GCGCCCTGACCCTGGGGTGCCGG + Intergenic
1160805217 19:989624-989646 CTGCCCTGCCCCAGGACTGCGGG - Intronic
1161067634 19:2246476-2246498 GAGCCCTTCACCAGGGGTGCTGG - Intronic
1161081835 19:2314789-2314811 CTGGCATGCACCTGTGGTCCTGG - Intronic
1161266151 19:3365781-3365803 CTCCCCTGCCCCTTGGGTGCTGG + Intronic
1161343191 19:3753808-3753830 CGGCCGTGGTCCTGGGGTGCCGG + Exonic
1161619227 19:5289639-5289661 CTGGACTGCACTTGGGGTGTTGG - Intronic
1161620904 19:5296635-5296657 CAGCACTGCACCTGGCGTGTTGG + Intronic
1161621437 19:5299328-5299350 CAGGACTGCACTTGGGGTGCTGG - Intronic
1163555243 19:17988400-17988422 CTGCCCTGCACACAGGGAGCTGG + Exonic
1165108397 19:33487583-33487605 CTGCCCCCCACCCCGGGTGCTGG - Intronic
1165467503 19:35983726-35983748 CTGCCCAGCCCTTGGGGTCCTGG + Intergenic
1166410757 19:42554301-42554323 CTGCCCTGAACCTGTACTGCTGG + Intronic
1167101935 19:47409068-47409090 CCACCCTGCACCTGGGCAGCAGG + Intronic
1167173567 19:47849855-47849877 CTGACATGCACCTGGGGCGCTGG + Intergenic
1167309162 19:48726942-48726964 ATGCCCTGCACCTGGGGACCTGG - Intronic
1167441608 19:49512599-49512621 GTGCCCTGCAACTGGGGGGTGGG + Exonic
1167623124 19:50569567-50569589 CTGAGCTGCATCTTGGGTGCAGG + Intergenic
1168152778 19:54457922-54457944 ATGCCCTGCACCTGGGGCAGCGG - Exonic
1168636283 19:57999803-57999825 CTCACCTGAACCTGGGCTGCTGG + Exonic
1168712648 19:58510832-58510854 CTCCCCTACACCAGGGGTGGGGG - Exonic
924995283 2:355280-355302 CTGCGCTGATCGTGGGGTGCGGG + Intergenic
925274974 2:2642166-2642188 CTGCCATGAACCCGGGGGGCAGG - Intergenic
925313212 2:2902589-2902611 CTGCCATGCTCCTTGGGTGAAGG - Intergenic
925426302 2:3751409-3751431 CGGAGCTGCACCTGGGGAGCTGG - Intronic
925455065 2:4009055-4009077 CTGCGATGAACATGGGGTGCAGG + Intergenic
925919246 2:8627913-8627935 CTGTCGTGCGCCTGGCGTGCTGG - Intergenic
926224181 2:10955567-10955589 CTGCCCTGCACCTGGGCTCCAGG + Intergenic
927861329 2:26562096-26562118 CTCCCATGGAGCTGGGGTGCAGG + Intergenic
927960789 2:27239573-27239595 CTGCCCTGGACCAGGGGTTGGGG + Intronic
928102271 2:28445961-28445983 CGGACCTGCACCAGGGGTCCAGG - Intergenic
928471449 2:31580560-31580582 CTGCCCTGCTCCCGGCGTCCAGG - Intronic
930000823 2:46860448-46860470 CTGCTCTGGACCTGGGAGGCTGG - Intergenic
931089218 2:58867622-58867644 CTGCCCTGTACCTGGAGGGAAGG + Intergenic
932092348 2:68817650-68817672 CTGCCCAGCTGCTGGGGTGGGGG - Intronic
932202648 2:69845421-69845443 CTGCTCTGCAGCTTGGGTGGTGG - Intronic
932688524 2:73893327-73893349 CTGCACTGGCCCTGGGGAGCAGG - Intronic
932741837 2:74296748-74296770 CTGCCCTCCAGCTTGGGTGACGG + Intronic
933472247 2:82740759-82740781 CAGCCCAGCACCTGGAGAGCAGG + Intergenic
933973195 2:87486789-87486811 CTGCACTGCTCCTTGGGTGTTGG - Intergenic
934996606 2:98967431-98967453 CAGCCCTGCACCAGGGAGGCTGG - Intergenic
935598130 2:104895962-104895984 CTGCCCTGCAGGTGGGCAGCTGG + Intergenic
936232951 2:110720191-110720213 CTGCCTTGCACCTGGGAGGAAGG + Intergenic
936320526 2:111463424-111463446 CTGCACTGCTCCTTGGGTGTTGG + Intergenic
936399685 2:112155882-112155904 CTGCCAGGAACCTGGGGTGATGG - Intronic
942045868 2:172099145-172099167 CTGCCCTGCCCCTCCGGCGCCGG - Intergenic
943947875 2:194090652-194090674 CTGCCCAGGACCGGTGGTGCCGG + Intergenic
946280055 2:218659951-218659973 TTGCCCTGCGCCTGGCATGCAGG - Exonic
946777804 2:223161840-223161862 CTGCCTTGCACCCTGAGTGCCGG - Intronic
946799558 2:223398345-223398367 CTGCCCTGCACATGTGGATCAGG + Intergenic
947577492 2:231287357-231287379 CTCCCTTGCAGCTAGGGTGCAGG - Intronic
947723021 2:232380704-232380726 CTGCCCTGCGCCTGCTGAGCAGG + Exonic
947727371 2:232408785-232408807 CTGCCCTGCTCCTGCTGAGCAGG + Exonic
947736511 2:232458079-232458101 CTGCCCTGCGCCTGCTGAGCAGG + Exonic
947813028 2:233016082-233016104 CAGCCCTGGGCCTGGGGAGCTGG - Intergenic
948191340 2:236061676-236061698 CTCCCCTGCACCTGGCAAGCAGG - Intronic
948747655 2:240107923-240107945 CTGCCCTGGGCCTGGTGGGCAGG + Intergenic
948818000 2:240523294-240523316 CTGCCCTGCACGCTGGGGGCTGG + Intronic
948880644 2:240855663-240855685 CTGTCCTGGAATTGGGGTGCTGG + Intergenic
948978582 2:241480172-241480194 CTGACCTGCACATGGGCAGCTGG - Intronic
1168876144 20:1173643-1173665 CAGCCCTGCAGCTGGGAGGCAGG + Intronic
1168986987 20:2057719-2057741 CTGCACTGCAGCAGGGGTGATGG + Intergenic
1171839528 20:30193689-30193711 CTCCCCTGCAGCTGGCGTGTTGG - Intergenic
1172579695 20:36037104-36037126 CTGCTCAGCCCCTGGGGTGGGGG - Intergenic
1172689503 20:36780552-36780574 GTGCCCTGGCCCTGGGGTGGGGG - Exonic
1172811164 20:37649411-37649433 CTGCCCTGGCCCTGGGGTTTCGG + Intergenic
1173333550 20:42095436-42095458 CTACCCTGCAGCCTGGGTGCAGG + Intronic
1173465657 20:43279081-43279103 CTGTCCTGCCCCTGGGGGCCTGG - Intergenic
1175153656 20:56954795-56954817 TGGCCCTGCACCTGGCGTGAAGG + Intergenic
1175247759 20:57591866-57591888 CTACCCTGCTGCTGGGGCGCCGG + Intergenic
1175520409 20:59599167-59599189 CTGCCCTGCTCCAGGAGTGAAGG - Intronic
1175752998 20:61512147-61512169 CTGTCCTGCAGCTGGGTTCCTGG + Intronic
1176031725 20:63016088-63016110 CACCCCTGCATCTGGGCTGCTGG + Intergenic
1176052863 20:63129798-63129820 CTGCCCTGCTCCTGGGGTGTGGG + Intergenic
1176059381 20:63165677-63165699 CTGCCCTGAGCTTGGGATGCGGG + Intergenic
1176093340 20:63328618-63328640 CTGTCCAGCCTCTGGGGTGCTGG + Intronic
1176450735 21:6858904-6858926 CTCCCCCGCACCTAGGGTCCGGG - Intergenic
1176828904 21:13723922-13723944 CTCCCCCGCACCTAGGGTCCGGG - Intergenic
1178445537 21:32638200-32638222 GTGCCATGCACCTGTGGTCCTGG - Intronic
1179682442 21:43033106-43033128 CTGCCCTGCACCTGTGGAGCAGG + Exonic
1179924773 21:44528423-44528445 CAGCCCTGCACCCGGGGCGTTGG - Intronic
1179992234 21:44954085-44954107 CTGCACTGCCCTTGGGGTTCTGG + Intronic
1180137617 21:45871464-45871486 CACCCCTGCCCCTGGGGTCCTGG - Intronic
1180244041 21:46534436-46534458 TTGCCATGTACCTGGGCTGCTGG + Intronic
1180568670 22:16696769-16696791 CTCCCCTGCCCCTGGTATGCTGG - Intergenic
1180732438 22:17992227-17992249 CAGCCCTGCACTTTGGCTGCAGG - Intronic
1180898425 22:19353865-19353887 CTGACCAGCACCTGGGGCACAGG + Intronic
1181013538 22:20055779-20055801 CTGCCAGGCACCTGAGGGGCTGG + Intronic
1181329296 22:22076728-22076750 CTTTCCTGCACCTGGGCTGAAGG + Intergenic
1181517186 22:23421542-23421564 CAGCCCTGCACTTTGGCTGCAGG - Intergenic
1181647051 22:24237250-24237272 ATGCCCCACACGTGGGGTGCAGG + Intronic
1182427845 22:30284283-30284305 CCGCCCTGCTCCTGGGGACCAGG - Intergenic
1182486792 22:30643934-30643956 CTGCCCTTTCCCTGGGCTGCAGG + Intronic
1182520113 22:30880398-30880420 TATCCCTGCACCAGGGGTGCTGG + Intronic
1183423752 22:37726415-37726437 CTGCACTGCGCCTGGGGCCCTGG - Exonic
1184172089 22:42765765-42765787 CTGAGCTCCACCTGGGGTGTGGG - Intergenic
1184264224 22:43338293-43338315 CTGCCCTGCACCTGGGGTGCTGG - Intronic
1184407833 22:44310044-44310066 TTCGCCTGCAGCTGGGGTGCCGG + Intronic
1184513303 22:44945580-44945602 ATCCCCTGCACCTGGGCTGCAGG + Intronic
1184745536 22:46453578-46453600 CTGTCCTGCTCCTGGGGGCCAGG - Intronic
1184751327 22:46488109-46488131 CTGCCCTGCACCTCAGTTTCAGG + Intronic
1184751331 22:46488113-46488135 CTCCCCTGAAACTGAGGTGCAGG - Intronic
1184823337 22:46929859-46929881 GTCCCCTGGACCTGGTGTGCTGG + Intronic
1184864750 22:47195884-47195906 CTGCCCTCCCCCTGGGCTGCAGG + Intergenic
1184867003 22:47207015-47207037 CTGCCCTGCATCATGGGTGTTGG + Intergenic
1184942658 22:47780564-47780586 CTGCACTGCACCTGGAGCGATGG + Intergenic
1184992604 22:48180823-48180845 CTGCCCTGCATCTGAGGCTCAGG - Intergenic
1185048329 22:48540278-48540300 CCGCCCTGGTCCTGGGGAGCAGG - Intronic
950658081 3:14449641-14449663 CTCACCTGCACCTGGGGAGATGG + Intronic
951635710 3:24773283-24773305 CTGCCCTCCAGCTTGGGTGACGG + Intergenic
952338288 3:32423820-32423842 GTGACCTGCACCTGGGGGGCTGG - Intronic
954391577 3:50270537-50270559 CTGCCCTGTCTCTGGGGTGAGGG - Intronic
954509164 3:51106591-51106613 TGCCCCTGCACCAGGGGTGCTGG + Intronic
957083455 3:75658439-75658461 CTCCCCTGCCCCTGGGGGGGTGG - Intergenic
961480135 3:127174245-127174267 CTGCACTGCACCTCTGCTGCTGG + Intergenic
961541203 3:127600652-127600674 CTGCCCTGGACTTGGGGTCAGGG + Intronic
961957055 3:130815090-130815112 CTGCCCTGGGCCGGTGGTGCTGG + Intergenic
962894741 3:139704222-139704244 CTGGCCTGCAGCTTGGGTTCTGG + Intergenic
965520279 3:169663213-169663235 CTGCCCTCCACCCGGGGCCCCGG + Intronic
966658050 3:182382277-182382299 CTCACCTGCACCTGAGGTGGGGG + Intergenic
968083847 3:195865472-195865494 CTGATTTGCACCTGGGATGCAGG - Intronic
968083857 3:195865537-195865559 CTGATTTGCACCTGGGATGCAGG - Intronic
968131218 3:196193990-196194012 CTGCCCTGACCCTTGGGTGGGGG - Intergenic
968580042 4:1385549-1385571 CTGCCCTCATCCTGGAGTGCGGG + Intronic
968609945 4:1552384-1552406 CTGCCCTGGGCCTGGGCTCCAGG - Intergenic
969663193 4:8542422-8542444 CTGCCCTGGCCTTGAGGTGCTGG + Intergenic
969857770 4:10014051-10014073 CTAGGCTTCACCTGGGGTGCTGG - Intronic
969955836 4:10889862-10889884 ATGTCCTGCACCTGTGGTCCTGG - Intergenic
975367356 4:73544733-73544755 CTGAACTGGACCTGGGATGCTGG + Intergenic
976246727 4:83012597-83012619 CTTCCCTGAAGCTGGGTTGCGGG - Intronic
976261450 4:83148789-83148811 CTGCTCTGCACAAGAGGTGCTGG + Intergenic
977176556 4:93827396-93827418 CTGCACCGCCCCTGGGGCGCGGG - Intergenic
978741221 4:112140159-112140181 CTGCCTAGCTCCTGGGGTACAGG + Intergenic
983060407 4:163153263-163153285 CCGCACTGCACCGGGGCTGCAGG - Intronic
984750078 4:183263817-183263839 CTGCCCTGCATGTGGGGTGGTGG + Intronic
985144321 4:186879032-186879054 CTATCCTGCACCTGAGGTTCTGG + Intergenic
985440342 4:189979361-189979383 CTGCCGGCCTCCTGGGGTGCAGG + Intergenic
985440354 4:189979388-189979410 CTGCCGGCCTCCTGGGGTGCAGG + Intergenic
985993048 5:3578955-3578977 CTGCCCAGCACATGGGCTTCTGG - Intergenic
987416115 5:17663509-17663531 CTTCCCTCCACCGGGGGTGCGGG + Intergenic
988509018 5:31849805-31849827 CTGCCCTCCAACTTGGGTGATGG + Intronic
989475514 5:41869614-41869636 CTGGCCCGCGCCTGGGCTGCAGG - Intronic
990032688 5:51281078-51281100 CTGTCCTGCAGCTGGGGAGAAGG + Intergenic
992027376 5:72683740-72683762 CTTCCCTGTACCTGGGGAGTGGG + Intergenic
992293959 5:75308473-75308495 CTGCACTCCAGCTGGGGTGACGG + Intergenic
993010207 5:82473453-82473475 TGGCCCTGCAGCTGGGGTGAGGG + Intergenic
993997838 5:94744005-94744027 CTGCACTCCACCTTGGGTGATGG - Intronic
996233030 5:121088969-121088991 ATTCCCTGCACCTGGGGGTCTGG + Intergenic
997262484 5:132475446-132475468 CTGCCCTCCTGCTGGGGTTCTGG - Intronic
997361520 5:133298334-133298356 TTGCCCAGCACCTGGTGTACAGG - Intronic
999182223 5:149677835-149677857 CTGCCCTGCTCCTGGTGCTCAGG - Intergenic
999772819 5:154788296-154788318 TTGCCCTGCACTGGGGGTGTGGG + Intronic
1001019455 5:168170659-168170681 TTGCTCTGCACCTGGGTTACGGG + Intronic
1001952959 5:175829085-175829107 CTGCCCTTCACCTGACGTGGTGG - Intronic
1002043525 5:176530259-176530281 CTGACTTGCACCTGGGCTCCGGG - Intronic
1002043542 5:176530307-176530329 CTGACTTGCACCTGGGCTCCGGG - Intronic
1002043575 5:176530403-176530425 CTGACTTGCACCTGGGCTCCGGG - Intronic
1002082085 5:176743299-176743321 CGTCCCTGCCCCGGGGGTGCGGG + Intergenic
1002259340 5:177983091-177983113 CTTCCCTGCAACTGGAGAGCCGG + Intergenic
1002329032 5:178428985-178429007 AGGCCCAGCACCCGGGGTGCGGG + Intronic
1002385101 5:178860408-178860430 CTGCCCTGCGCTCGGGGTCCCGG - Intronic
1002856034 6:1039127-1039149 CTGCCCTGTCCATGGGGTGGGGG + Intergenic
1003873762 6:10420019-10420041 GTGCCCTGCACCTCGTGGGCGGG - Intergenic
1005074636 6:21895043-21895065 CTGCACTGCACCCTGGGTGACGG + Intergenic
1005189540 6:23204583-23204605 CTGCCCTGCTCCTAAGCTGCGGG - Intergenic
1005510101 6:26505008-26505030 CTCCACTGCACCTGGGGCTCTGG - Exonic
1005769072 6:29046911-29046933 CTGCACTCCACCCTGGGTGCTGG + Intergenic
1006034551 6:31201346-31201368 TGGCTCTGCACCTGGGGTCCGGG + Intronic
1006405581 6:33842945-33842967 TTTCCCTGAACCTGGGGGGCTGG + Intergenic
1007061258 6:38942742-38942764 CTAGCCTGCACCTGAGGTGTGGG + Intronic
1007127647 6:39440878-39440900 TTGTCCTGCACCTGGGTTTCTGG - Intronic
1007517656 6:42425946-42425968 TTTCCCTGCACGTGGGGAGCAGG + Intronic
1009011988 6:57853953-57853975 CTGCCCGGCTCCAGGGCTGCGGG - Intergenic
1011209170 6:84936337-84936359 CTGCAATGGACCTGGGATGCTGG + Intergenic
1013288518 6:108700101-108700123 CTGCCCTGAAGGTGGGGTGAAGG + Intergenic
1013737918 6:113248923-113248945 CTGCCCTGCCTCTGTGGTCCAGG + Intergenic
1013770501 6:113622847-113622869 CTAACCTGTACCTGGGGGGCTGG - Intergenic
1015355132 6:132268936-132268958 CTGCACTCCAGCTGGGGTGACGG + Intergenic
1017034194 6:150252313-150252335 CTGCACTGCAGATGGGGAGCAGG - Intergenic
1017758656 6:157551216-157551238 CTCCCTTCCTCCTGGGGTGCTGG + Intronic
1018192835 6:161325657-161325679 CTGACCTGAATCTGGGGTGCAGG + Intergenic
1018328684 6:162704175-162704197 ATGCCCTCCACCTGGGCAGCAGG + Intronic
1018472117 6:164106473-164106495 CTGCCCTGCATCGGGGCTGCGGG + Intergenic
1018623352 6:165752414-165752436 CTGCACTGAACCTGGGCTCCTGG + Intronic
1019064202 6:169282208-169282230 CTTCCCTGCACCGGGGATGCTGG - Intergenic
1019095922 6:169578969-169578991 CTGCCGTGTACCTAGGGTGCTGG - Intronic
1019291666 7:253551-253573 CTGCCCTGCACTTGGAGTGGGGG - Intronic
1019321458 7:417315-417337 CTGGCCTGCACCTGGCGGACAGG - Intergenic
1019403221 7:868320-868342 CTGCCCTGCACCTGGAGGTGGGG + Intronic
1019417944 7:935752-935774 CTGCTCTGCCCCGCGGGTGCCGG + Intronic
1019525555 7:1478937-1478959 CTGCTCTGGGCCTCGGGTGCCGG - Intronic
1019551027 7:1602606-1602628 CGGCCCCGCACCTGGGCTCCGGG + Intergenic
1019605208 7:1906704-1906726 CTGCCCTGCACCTGAGAACCCGG + Intronic
1019641432 7:2105833-2105855 CTACCCTGGAGCTGGGGAGCGGG - Intronic
1023332952 7:39138766-39138788 CTTCCATGGACCTGGGGGGCAGG - Intronic
1024240861 7:47434710-47434732 CAGCTATGCACCTGGGCTGCTGG + Intronic
1024307378 7:47939889-47939911 CTGCCCTGCAGGTGGGGAGTAGG - Intronic
1024389135 7:48787033-48787055 CTGCCCTGCTTCTCGGGTGAAGG - Intergenic
1026828669 7:73598822-73598844 CTGAACTGCACCTGGGGGCCAGG + Intronic
1026896691 7:74013601-74013623 CTGCCCAGCCCCTGGGGGGAGGG - Intergenic
1027229293 7:76262953-76262975 CTGCCCTTCCTCTGGGCTGCTGG - Intronic
1029269320 7:99367347-99367369 CTACCTAGCACCAGGGGTGCTGG + Intronic
1029529745 7:101117426-101117448 CTGTCATGCAGCTGGGCTGCTGG - Intergenic
1029604244 7:101589127-101589149 CTTCCCTGCACCCGGCGTCCTGG + Intergenic
1029642924 7:101832424-101832446 GTCCCCAGCACCTGCGGTGCAGG + Intronic
1029736417 7:102468137-102468159 CTGCCCTCCACCTGGGCCGACGG - Exonic
1030682799 7:112450802-112450824 CTGGCCGGCAACTGGGATGCCGG - Intronic
1033650448 7:143338748-143338770 CTGCACTCCAGCTTGGGTGCTGG + Intronic
1034266450 7:149783385-149783407 CTGCCCTCCACCTGGGCTCTTGG + Intergenic
1034433807 7:151053651-151053673 CTGCCCTGCCCCAGGGGTGAGGG + Intergenic
1034584438 7:152076656-152076678 CTGCCCTGCACGTGGGCAGATGG + Intronic
1035717277 8:1763914-1763936 CTGCCCCTCACCTGGGTTCCCGG - Intronic
1035717299 8:1763971-1763993 CTGCCCCTCACCTGGGTTCCCGG - Intronic
1035752897 8:2008402-2008424 GAGCCCTGCTCCTGGGGGGCAGG + Intergenic
1036821406 8:11942787-11942809 CTGCCGTGGACCTGGGGGCCAGG + Intergenic
1037710333 8:21350542-21350564 CTGCCTTGAACCTGGGATCCAGG - Intergenic
1037760561 8:21738844-21738866 GAGCCTTGCACCTGGGATGCTGG - Intronic
1037937528 8:22925325-22925347 GAGCCCTGAACCTGGGGTGAAGG + Intronic
1037959305 8:23084246-23084268 CTGCCCTGCCCATGGGTTTCTGG + Intergenic
1038776832 8:30538924-30538946 CTGCCCTGCACCACGGGAGCTGG + Intronic
1041090442 8:54296865-54296887 CTCAACTGCACCAGGGGTGCTGG - Intergenic
1041693057 8:60708528-60708550 CTTCCCTTCACCTGGGATGCAGG + Intronic
1044058450 8:87601709-87601731 CTGTCCTGTCCCTGGGGAGCTGG + Intronic
1044971459 8:97624477-97624499 CATCCCTGCACCCGGGGCGCTGG - Intergenic
1045167375 8:99621868-99621890 CTGCACTGCAGCCTGGGTGCTGG - Intronic
1045891464 8:107162967-107162989 TTGGCCTGGACCTGGGGTGGGGG + Intergenic
1046231025 8:111358556-111358578 GTGCCCTGCTCTTGGGGGGCAGG + Intergenic
1048606511 8:135973988-135974010 GTGTCCTATACCTGGGGTGCAGG + Intergenic
1048936627 8:139362835-139362857 CTCCCCTGCATCTGGGTTGGGGG + Intergenic
1049411227 8:142474846-142474868 CTGCCCTGGACCTGGCCAGCTGG - Intronic
1049469344 8:142768530-142768552 CTTCCCTGCACCAGGGCTCCTGG - Intronic
1049756794 8:144314361-144314383 CAGCCCTGCACTGGGGGTGGGGG - Exonic
1049759381 8:144325210-144325232 CTGCTGTGGGCCTGGGGTGCTGG - Intronic
1052700011 9:31926263-31926285 CTGCCTTGTACCTGAGCTGCAGG + Intergenic
1052864998 9:33459539-33459561 CTTCCCTTCCCCTGGGGTTCTGG + Intergenic
1053428837 9:38028426-38028448 TCACCCTGCAGCTGGGGTGCTGG + Intronic
1055949093 9:81714164-81714186 CTGCACTGCACCTGGGTGACAGG - Intergenic
1057079658 9:92163441-92163463 CTGCAGTGCAGGTGGGGTGCAGG - Intergenic
1057526532 9:95808018-95808040 CTGCCCTGCAGCTGTTGGGCTGG - Intergenic
1057554685 9:96078371-96078393 CTGCCCATCACCTGGGCTGCTGG + Intergenic
1057739117 9:97696856-97696878 CTTCGCTGCACCTCGGCTGCTGG - Intronic
1060152807 9:121299653-121299675 CCGCCCCGGAGCTGGGGTGCAGG + Intronic
1060488602 9:124065461-124065483 CTGAACTCCACCTGGGCTGCAGG - Intergenic
1061315678 9:129794395-129794417 CTTTCCTGTACCTGGGGTGGTGG + Intergenic
1062440787 9:136568428-136568450 CTCCCCTCCAGCTGGGGTGGGGG - Intergenic
1062567190 9:137168519-137168541 CTGCCCTGCACCTTGGGCACGGG + Exonic
1062624123 9:137435328-137435350 CTGGCCTCCACCTGGGGCCCAGG + Exonic
1203768983 EBV:39824-39846 CTCCACTGCACCTGGAATGCAGG + Intergenic
1203518447 Un_GL000213v1:25613-25635 CTCCCCCGCACCTAGGGTCCGGG + Intergenic
1185446600 X:261171-261193 CTGACATGGACCTGGGGTTCCGG + Intergenic
1185729233 X:2447574-2447596 CTGCAGTGCACAGGGGGTGCAGG - Intronic
1185730624 X:2458375-2458397 CTGCAGTGCACAGGGGGTGCAGG - Intronic
1185912527 X:3998306-3998328 CTGCGTTGAACATGGGGTGCAGG + Intergenic
1187227351 X:17386320-17386342 GTGCCCTGCACCTGTGGTAGAGG - Intronic
1188805946 X:34590356-34590378 CTGCCCTGCCCCAGAGGTACTGG + Intergenic
1190109787 X:47582512-47582534 CTGGGCTGCAGCTTGGGTGCTGG + Intronic
1192156044 X:68747343-68747365 CTGCCCTGCCTCTGGGATTCTGG + Intergenic
1195840602 X:109172244-109172266 CTGGCTTGCACATGGAGTGCAGG - Intergenic
1197243485 X:124145089-124145111 CTGCCCTGCACATAGGGATCAGG + Intronic
1200122511 X:153797840-153797862 CTCCCCTGTCCCTGGGGAGCAGG + Intronic