ID: 1184265933

View in Genome Browser
Species Human (GRCh38)
Location 22:43346044-43346066
Sequence GTGAAAAATAGGACAGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184265933_1184265943 20 Left 1184265933 22:43346044-43346066 CCCACAGCTGTCCTATTTTTCAC No data
Right 1184265943 22:43346087-43346109 TCCCCTGCCAGGAGCACCCTTGG No data
1184265933_1184265940 9 Left 1184265933 22:43346044-43346066 CCCACAGCTGTCCTATTTTTCAC No data
Right 1184265940 22:43346076-43346098 CCTGCACCCTTTCCCCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184265933 Original CRISPR GTGAAAAATAGGACAGCTGT GGG (reversed) Intergenic
No off target data available for this crispr