ID: 1184268003

View in Genome Browser
Species Human (GRCh38)
Location 22:43360301-43360323
Sequence CTGTGGGTGGGGAGTGAAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184267991_1184268003 27 Left 1184267991 22:43360251-43360273 CCTGGGAAGCAGAGCAAATGGCA No data
Right 1184268003 22:43360301-43360323 CTGTGGGTGGGGAGTGAAGCGGG No data
1184267998_1184268003 -10 Left 1184267998 22:43360288-43360310 CCTGGAGGCAACGCTGTGGGTGG No data
Right 1184268003 22:43360301-43360323 CTGTGGGTGGGGAGTGAAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184268003 Original CRISPR CTGTGGGTGGGGAGTGAAGC GGG Intergenic
No off target data available for this crispr