ID: 1184270776

View in Genome Browser
Species Human (GRCh38)
Location 22:43381671-43381693
Sequence TCCGCAGAGAGTGCTGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184270771_1184270776 -2 Left 1184270771 22:43381650-43381672 CCCACGGAAGCCTCTGCCAGCTC No data
Right 1184270776 22:43381671-43381693 TCCGCAGAGAGTGCTGGAGCTGG No data
1184270772_1184270776 -3 Left 1184270772 22:43381651-43381673 CCACGGAAGCCTCTGCCAGCTCC No data
Right 1184270776 22:43381671-43381693 TCCGCAGAGAGTGCTGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184270776 Original CRISPR TCCGCAGAGAGTGCTGGAGC TGG Intergenic
No off target data available for this crispr