ID: 1184272870

View in Genome Browser
Species Human (GRCh38)
Location 22:43394797-43394819
Sequence GAGGTTAAACAGCATGACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184272865_1184272870 6 Left 1184272865 22:43394768-43394790 CCCATTTAATTCTTGCAAAGAGG No data
Right 1184272870 22:43394797-43394819 GAGGTTAAACAGCATGACCAAGG No data
1184272862_1184272870 23 Left 1184272862 22:43394751-43394773 CCCTTCATGCACCTTTTCCCATT No data
Right 1184272870 22:43394797-43394819 GAGGTTAAACAGCATGACCAAGG No data
1184272864_1184272870 12 Left 1184272864 22:43394762-43394784 CCTTTTCCCATTTAATTCTTGCA No data
Right 1184272870 22:43394797-43394819 GAGGTTAAACAGCATGACCAAGG No data
1184272863_1184272870 22 Left 1184272863 22:43394752-43394774 CCTTCATGCACCTTTTCCCATTT No data
Right 1184272870 22:43394797-43394819 GAGGTTAAACAGCATGACCAAGG No data
1184272861_1184272870 24 Left 1184272861 22:43394750-43394772 CCCCTTCATGCACCTTTTCCCAT No data
Right 1184272870 22:43394797-43394819 GAGGTTAAACAGCATGACCAAGG No data
1184272867_1184272870 5 Left 1184272867 22:43394769-43394791 CCATTTAATTCTTGCAAAGAGGT No data
Right 1184272870 22:43394797-43394819 GAGGTTAAACAGCATGACCAAGG No data
1184272860_1184272870 30 Left 1184272860 22:43394744-43394766 CCTAGACCCCTTCATGCACCTTT No data
Right 1184272870 22:43394797-43394819 GAGGTTAAACAGCATGACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184272870 Original CRISPR GAGGTTAAACAGCATGACCA AGG Intergenic
No off target data available for this crispr