ID: 1184274120

View in Genome Browser
Species Human (GRCh38)
Location 22:43400495-43400517
Sequence CCCTCCCGCAGCCATGCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184274120_1184274124 -7 Left 1184274120 22:43400495-43400517 CCCATGGCATGGCTGCGGGAGGG No data
Right 1184274124 22:43400511-43400533 GGGAGGGGCGCCCATCCTGCTGG No data
1184274120_1184274134 19 Left 1184274120 22:43400495-43400517 CCCATGGCATGGCTGCGGGAGGG No data
Right 1184274134 22:43400537-43400559 GGTGGCTGTGGAGCGGCCGGAGG No data
1184274120_1184274135 22 Left 1184274120 22:43400495-43400517 CCCATGGCATGGCTGCGGGAGGG No data
Right 1184274135 22:43400540-43400562 GGCTGTGGAGCGGCCGGAGGTGG No data
1184274120_1184274131 12 Left 1184274120 22:43400495-43400517 CCCATGGCATGGCTGCGGGAGGG No data
Right 1184274131 22:43400530-43400552 CTGGCCTGGTGGCTGTGGAGCGG No data
1184274120_1184274125 -2 Left 1184274120 22:43400495-43400517 CCCATGGCATGGCTGCGGGAGGG No data
Right 1184274125 22:43400516-43400538 GGGCGCCCATCCTGCTGGCCTGG No data
1184274120_1184274129 7 Left 1184274120 22:43400495-43400517 CCCATGGCATGGCTGCGGGAGGG No data
Right 1184274129 22:43400525-43400547 TCCTGCTGGCCTGGTGGCTGTGG No data
1184274120_1184274126 1 Left 1184274120 22:43400495-43400517 CCCATGGCATGGCTGCGGGAGGG No data
Right 1184274126 22:43400519-43400541 CGCCCATCCTGCTGGCCTGGTGG No data
1184274120_1184274133 16 Left 1184274120 22:43400495-43400517 CCCATGGCATGGCTGCGGGAGGG No data
Right 1184274133 22:43400534-43400556 CCTGGTGGCTGTGGAGCGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184274120 Original CRISPR CCCTCCCGCAGCCATGCCAT GGG (reversed) Intergenic
No off target data available for this crispr