ID: 1184274127

View in Genome Browser
Species Human (GRCh38)
Location 22:43400521-43400543
Sequence AGCCACCAGGCCAGCAGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184274127_1184274134 -7 Left 1184274127 22:43400521-43400543 CCCATCCTGCTGGCCTGGTGGCT No data
Right 1184274134 22:43400537-43400559 GGTGGCTGTGGAGCGGCCGGAGG No data
1184274127_1184274133 -10 Left 1184274127 22:43400521-43400543 CCCATCCTGCTGGCCTGGTGGCT No data
Right 1184274133 22:43400534-43400556 CCTGGTGGCTGTGGAGCGGCCGG No data
1184274127_1184274139 30 Left 1184274127 22:43400521-43400543 CCCATCCTGCTGGCCTGGTGGCT No data
Right 1184274139 22:43400574-43400596 GCTGCTGCTGGTGCTCCCTCTGG No data
1184274127_1184274137 18 Left 1184274127 22:43400521-43400543 CCCATCCTGCTGGCCTGGTGGCT No data
Right 1184274137 22:43400562-43400584 GCGTGTGCCAAAGCTGCTGCTGG No data
1184274127_1184274135 -4 Left 1184274127 22:43400521-43400543 CCCATCCTGCTGGCCTGGTGGCT No data
Right 1184274135 22:43400540-43400562 GGCTGTGGAGCGGCCGGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184274127 Original CRISPR AGCCACCAGGCCAGCAGGAT GGG (reversed) Intergenic
No off target data available for this crispr