ID: 1184274128

View in Genome Browser
Species Human (GRCh38)
Location 22:43400522-43400544
Sequence CAGCCACCAGGCCAGCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184274128_1184274139 29 Left 1184274128 22:43400522-43400544 CCATCCTGCTGGCCTGGTGGCTG No data
Right 1184274139 22:43400574-43400596 GCTGCTGCTGGTGCTCCCTCTGG No data
1184274128_1184274135 -5 Left 1184274128 22:43400522-43400544 CCATCCTGCTGGCCTGGTGGCTG No data
Right 1184274135 22:43400540-43400562 GGCTGTGGAGCGGCCGGAGGTGG No data
1184274128_1184274134 -8 Left 1184274128 22:43400522-43400544 CCATCCTGCTGGCCTGGTGGCTG No data
Right 1184274134 22:43400537-43400559 GGTGGCTGTGGAGCGGCCGGAGG No data
1184274128_1184274137 17 Left 1184274128 22:43400522-43400544 CCATCCTGCTGGCCTGGTGGCTG No data
Right 1184274137 22:43400562-43400584 GCGTGTGCCAAAGCTGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184274128 Original CRISPR CAGCCACCAGGCCAGCAGGA TGG (reversed) Intergenic
No off target data available for this crispr