ID: 1184274133

View in Genome Browser
Species Human (GRCh38)
Location 22:43400534-43400556
Sequence CCTGGTGGCTGTGGAGCGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184274115_1184274133 30 Left 1184274115 22:43400481-43400503 CCTGCACTGATACTCCCATGGCA No data
Right 1184274133 22:43400534-43400556 CCTGGTGGCTGTGGAGCGGCCGG No data
1184274120_1184274133 16 Left 1184274120 22:43400495-43400517 CCCATGGCATGGCTGCGGGAGGG No data
Right 1184274133 22:43400534-43400556 CCTGGTGGCTGTGGAGCGGCCGG No data
1184274122_1184274133 15 Left 1184274122 22:43400496-43400518 CCATGGCATGGCTGCGGGAGGGG No data
Right 1184274133 22:43400534-43400556 CCTGGTGGCTGTGGAGCGGCCGG No data
1184274127_1184274133 -10 Left 1184274127 22:43400521-43400543 CCCATCCTGCTGGCCTGGTGGCT No data
Right 1184274133 22:43400534-43400556 CCTGGTGGCTGTGGAGCGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184274133 Original CRISPR CCTGGTGGCTGTGGAGCGGC CGG Intergenic
No off target data available for this crispr