ID: 1184274134

View in Genome Browser
Species Human (GRCh38)
Location 22:43400537-43400559
Sequence GGTGGCTGTGGAGCGGCCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184274127_1184274134 -7 Left 1184274127 22:43400521-43400543 CCCATCCTGCTGGCCTGGTGGCT No data
Right 1184274134 22:43400537-43400559 GGTGGCTGTGGAGCGGCCGGAGG No data
1184274120_1184274134 19 Left 1184274120 22:43400495-43400517 CCCATGGCATGGCTGCGGGAGGG No data
Right 1184274134 22:43400537-43400559 GGTGGCTGTGGAGCGGCCGGAGG No data
1184274122_1184274134 18 Left 1184274122 22:43400496-43400518 CCATGGCATGGCTGCGGGAGGGG No data
Right 1184274134 22:43400537-43400559 GGTGGCTGTGGAGCGGCCGGAGG No data
1184274128_1184274134 -8 Left 1184274128 22:43400522-43400544 CCATCCTGCTGGCCTGGTGGCTG No data
Right 1184274134 22:43400537-43400559 GGTGGCTGTGGAGCGGCCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184274134 Original CRISPR GGTGGCTGTGGAGCGGCCGG AGG Intergenic
No off target data available for this crispr