ID: 1184274135

View in Genome Browser
Species Human (GRCh38)
Location 22:43400540-43400562
Sequence GGCTGTGGAGCGGCCGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184274130_1184274135 -9 Left 1184274130 22:43400526-43400548 CCTGCTGGCCTGGTGGCTGTGGA No data
Right 1184274135 22:43400540-43400562 GGCTGTGGAGCGGCCGGAGGTGG No data
1184274120_1184274135 22 Left 1184274120 22:43400495-43400517 CCCATGGCATGGCTGCGGGAGGG No data
Right 1184274135 22:43400540-43400562 GGCTGTGGAGCGGCCGGAGGTGG No data
1184274127_1184274135 -4 Left 1184274127 22:43400521-43400543 CCCATCCTGCTGGCCTGGTGGCT No data
Right 1184274135 22:43400540-43400562 GGCTGTGGAGCGGCCGGAGGTGG No data
1184274122_1184274135 21 Left 1184274122 22:43400496-43400518 CCATGGCATGGCTGCGGGAGGGG No data
Right 1184274135 22:43400540-43400562 GGCTGTGGAGCGGCCGGAGGTGG No data
1184274128_1184274135 -5 Left 1184274128 22:43400522-43400544 CCATCCTGCTGGCCTGGTGGCTG No data
Right 1184274135 22:43400540-43400562 GGCTGTGGAGCGGCCGGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184274135 Original CRISPR GGCTGTGGAGCGGCCGGAGG TGG Intergenic
No off target data available for this crispr