ID: 1184274139

View in Genome Browser
Species Human (GRCh38)
Location 22:43400574-43400596
Sequence GCTGCTGCTGGTGCTCCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184274128_1184274139 29 Left 1184274128 22:43400522-43400544 CCATCCTGCTGGCCTGGTGGCTG No data
Right 1184274139 22:43400574-43400596 GCTGCTGCTGGTGCTCCCTCTGG No data
1184274130_1184274139 25 Left 1184274130 22:43400526-43400548 CCTGCTGGCCTGGTGGCTGTGGA No data
Right 1184274139 22:43400574-43400596 GCTGCTGCTGGTGCTCCCTCTGG No data
1184274127_1184274139 30 Left 1184274127 22:43400521-43400543 CCCATCCTGCTGGCCTGGTGGCT No data
Right 1184274139 22:43400574-43400596 GCTGCTGCTGGTGCTCCCTCTGG No data
1184274132_1184274139 17 Left 1184274132 22:43400534-43400556 CCTGGTGGCTGTGGAGCGGCCGG No data
Right 1184274139 22:43400574-43400596 GCTGCTGCTGGTGCTCCCTCTGG No data
1184274136_1184274139 -2 Left 1184274136 22:43400553-43400575 CCGGAGGTGGCGTGTGCCAAAGC No data
Right 1184274139 22:43400574-43400596 GCTGCTGCTGGTGCTCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184274139 Original CRISPR GCTGCTGCTGGTGCTCCCTC TGG Intergenic
No off target data available for this crispr