ID: 1184274232

View in Genome Browser
Species Human (GRCh38)
Location 22:43401056-43401078
Sequence TGCTTCTCTAGAACGAACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184274232_1184274236 23 Left 1184274232 22:43401056-43401078 CCCATGTTCGTTCTAGAGAAGCA No data
Right 1184274236 22:43401102-43401124 ATTGTTTATCAAGGGTGCAGAGG No data
1184274232_1184274234 14 Left 1184274232 22:43401056-43401078 CCCATGTTCGTTCTAGAGAAGCA No data
Right 1184274234 22:43401093-43401115 GCTGCTGTGATTGTTTATCAAGG No data
1184274232_1184274235 15 Left 1184274232 22:43401056-43401078 CCCATGTTCGTTCTAGAGAAGCA No data
Right 1184274235 22:43401094-43401116 CTGCTGTGATTGTTTATCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184274232 Original CRISPR TGCTTCTCTAGAACGAACAT GGG (reversed) Intergenic
No off target data available for this crispr