ID: 1184274235

View in Genome Browser
Species Human (GRCh38)
Location 22:43401094-43401116
Sequence CTGCTGTGATTGTTTATCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184274232_1184274235 15 Left 1184274232 22:43401056-43401078 CCCATGTTCGTTCTAGAGAAGCA No data
Right 1184274235 22:43401094-43401116 CTGCTGTGATTGTTTATCAAGGG No data
1184274233_1184274235 14 Left 1184274233 22:43401057-43401079 CCATGTTCGTTCTAGAGAAGCAG No data
Right 1184274235 22:43401094-43401116 CTGCTGTGATTGTTTATCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184274235 Original CRISPR CTGCTGTGATTGTTTATCAA GGG Intergenic
No off target data available for this crispr