ID: 1184274910

View in Genome Browser
Species Human (GRCh38)
Location 22:43404667-43404689
Sequence CACCGCTGATTGGTACTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184274906_1184274910 -2 Left 1184274906 22:43404646-43404668 CCTGCTGGCTGTCCTGGGGACCA No data
Right 1184274910 22:43404667-43404689 CACCGCTGATTGGTACTTGCTGG No data
1184274897_1184274910 29 Left 1184274897 22:43404615-43404637 CCTGTTGTGGTTGGGGAGGCTGG No data
Right 1184274910 22:43404667-43404689 CACCGCTGATTGGTACTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184274910 Original CRISPR CACCGCTGATTGGTACTTGC TGG Intergenic
No off target data available for this crispr