ID: 1184276576

View in Genome Browser
Species Human (GRCh38)
Location 22:43412244-43412266
Sequence CGACGCCCGCGGCGCTGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 133}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184276573_1184276576 -6 Left 1184276573 22:43412227-43412249 CCTCTCCAGGCGCTGGGCGACGC No data
Right 1184276576 22:43412244-43412266 CGACGCCCGCGGCGCTGCGCAGG 0: 1
1: 0
2: 0
3: 14
4: 133
1184276567_1184276576 18 Left 1184276567 22:43412203-43412225 CCGGGCGCGGGGCGCGGCCGGGA 0: 1
1: 0
2: 12
3: 73
4: 458
Right 1184276576 22:43412244-43412266 CGACGCCCGCGGCGCTGCGCAGG 0: 1
1: 0
2: 0
3: 14
4: 133
1184276569_1184276576 1 Left 1184276569 22:43412220-43412242 CCGGGACCCTCTCCAGGCGCTGG 0: 1
1: 0
2: 5
3: 22
4: 399
Right 1184276576 22:43412244-43412266 CGACGCCCGCGGCGCTGCGCAGG 0: 1
1: 0
2: 0
3: 14
4: 133
1184276572_1184276576 -5 Left 1184276572 22:43412226-43412248 CCCTCTCCAGGCGCTGGGCGACG 0: 1
1: 0
2: 0
3: 6
4: 117
Right 1184276576 22:43412244-43412266 CGACGCCCGCGGCGCTGCGCAGG 0: 1
1: 0
2: 0
3: 14
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184276576 Original CRISPR CGACGCCCGCGGCGCTGCGC AGG Intronic
900101594 1:964384-964406 CCACGCCCGCTGAGCTGCGTCGG - Exonic
900171993 1:1273795-1273817 CGGCGGCGGCGGCGCTGCGGCGG - Exonic
904171016 1:28592377-28592399 CGACGCCCTCGGTGCCCCGCCGG + Exonic
904831089 1:33307231-33307253 CGTTGCACGCGGCGCTGGGCGGG - Exonic
905449324 1:38046756-38046778 CGGCGGCGGCGGCGCGGCGCAGG - Exonic
906508028 1:46394419-46394441 CGGCGGCCGTGGCCCTGCGCTGG + Exonic
906961362 1:50421186-50421208 CGGCGCAGGTGGCGCTGCGCAGG - Exonic
907012694 1:50978115-50978137 CAGCTCCCGGGGCGCTGCGCCGG - Intergenic
908714285 1:67053743-67053765 CGGCGGCGGCGGCGCGGCGCCGG - Intronic
910934978 1:92480308-92480330 CGCCGCGCGCGGCCCTGCTCGGG - Intronic
912305182 1:108560045-108560067 CGACCCCCGAGGCGCTGAGGCGG + Intergenic
912576364 1:110675325-110675347 CGGCGCCCGCGGGGCCGCGGCGG - Intergenic
915165697 1:153946642-153946664 CGGCGCCCGCGGCCCGGAGCGGG - Exonic
915559224 1:156676759-156676781 GGAGGCCCGCGGGGCGGCGCGGG + Exonic
916144448 1:161726743-161726765 GGAGGCCCGCGGCGCGGCGCTGG + Exonic
917837806 1:178954564-178954586 CGACACCCGCCTCGCTGCGTGGG + Intergenic
919892100 1:201982929-201982951 TGACGGCGGCGGCGCTGCGGCGG + Exonic
920260541 1:204685273-204685295 CGGCGGCGGCGGCGCTGCCCAGG + Intronic
921604759 1:217139699-217139721 CGGCGGCGGCGGCGGTGCGCGGG + Intergenic
922196628 1:223364666-223364688 CCCAGCCCGCGGCGCGGCGCGGG + Intergenic
922831267 1:228555702-228555724 CGAGCCCCGCGGCCCTGGGCGGG + Intergenic
1069651541 10:70053243-70053265 CGACGCCCCCGGCCCCTCGCTGG - Intronic
1070895827 10:79982315-79982337 CGCCGCCCGAGGCGCTGGGCTGG - Intronic
1080012498 11:27472565-27472587 CGCGGCCCCCGCCGCTGCGCCGG - Exonic
1081700138 11:45147352-45147374 GGACGCCCTCGGCCCCGCGCCGG + Exonic
1083741395 11:64713321-64713343 CGACGCGCGCCGCACGGCGCTGG - Exonic
1091263564 11:134253357-134253379 CGACCCCCGCGGCGCTTGGTGGG + Intronic
1092045943 12:5431983-5432005 GGGCGCGCGCGGCGCGGCGCGGG + Intergenic
1093435472 12:19130206-19130228 CGGGGCCCGCGGCGCGGGGCAGG - Intronic
1094051674 12:26226999-26227021 CTCCGCCCGCTGCGCAGCGCCGG + Intronic
1094199210 12:27780077-27780099 GGACGCCCGCCGCGCTCCGCCGG + Exonic
1097262298 12:57726584-57726606 CCACGCTAGCGGCGCTGCTCCGG + Exonic
1097929570 12:65169491-65169513 AGATGCCCGCGGCGCTGGGAGGG + Intergenic
1101144800 12:101830875-101830897 CCACGCCCTCGGCGCGGCGGAGG + Exonic
1102010281 12:109614109-109614131 CGGCCCCCGCTGCGCTCCGCCGG + Intergenic
1102053614 12:109880401-109880423 CGACGCCCGCGGCGCCGGCTGGG - Exonic
1103320005 12:120086970-120086992 CTACAGCCGCGGCGCAGCGCCGG - Intronic
1103604710 12:122078421-122078443 CGACTCCCGGGGCGCGGAGCGGG + Intergenic
1105054032 12:133080885-133080907 CGACGCCCGCGGAGGGGCCCTGG + Exonic
1115235787 14:31207655-31207677 CGTCGCCCGCAGCACCGCGCGGG - Intronic
1117478306 14:56118759-56118781 CCCCGCCCGCGCCGCTGCCCGGG - Intronic
1123023984 14:105415047-105415069 GGCCGCCCGTGGCGCTGCGGAGG - Intronic
1128547571 15:68578636-68578658 GGACGGCCGAGGCGCTGCGCGGG - Intergenic
1129710598 15:77818784-77818806 CTAGGCCCGCGGCGCCGCGCTGG - Intronic
1131517555 15:93089159-93089181 CGCCGCCCGAGCCGCTGGGCCGG - Intronic
1131735475 15:95326962-95326984 CGGCGGCTGCGGCGCTCCGCGGG + Intergenic
1132365124 15:101251562-101251584 CGGCGGCGGCGGCGCTGCCCGGG - Exonic
1132741310 16:1414650-1414672 CGGCGGCAGCGGCGCTGAGCGGG - Exonic
1142958304 17:3535639-3535661 CGGCGCCGGCGGCGATGAGCAGG + Exonic
1143483903 17:7242397-7242419 CGACGACGGCGGCGACGCGCGGG + Exonic
1143697600 17:8631379-8631401 CGTCACCCCCGGGGCTGCGCGGG + Intergenic
1146793198 17:35764469-35764491 CGACGACCGCCGCGCCGCGGGGG + Exonic
1148111000 17:45144585-45144607 CTACGCCCGGGGCGCGGAGCTGG - Intergenic
1150168362 17:62966217-62966239 CGACGCCCCCAGCGCGGCGGCGG + Intergenic
1152628650 17:81399799-81399821 CGGCGGCAGCGGCGCTGCGGTGG - Exonic
1152782199 17:82231410-82231432 CGACGCCCGCTGGGCGGCGGTGG + Intronic
1153457567 18:5296406-5296428 CCGCGTCCCCGGCGCTGCGCCGG - Intronic
1154411989 18:14146559-14146581 CGACACTCGCGGTGCTGCCCAGG - Intergenic
1155053230 18:22165718-22165740 CGAGGCCCGGCGCGTTGCGCAGG - Intergenic
1157613961 18:48976052-48976074 CGCCTCCCGGGGCGCCGCGCGGG + Intergenic
1158505541 18:58044036-58044058 TGACCCCCGCCGCGCCGCGCTGG + Intergenic
1161016477 19:1986140-1986162 GGACGCCCGCGGCGCACCGCCGG + Exonic
1161494971 19:4581619-4581641 CCGGGCCCACGGCGCTGCGCTGG + Intergenic
1161562893 19:4983577-4983599 CGATGCCAGAGGCGCTGCCCAGG - Intronic
1161736926 19:5997167-5997189 CGAAGCTGGCAGCGCTGCGCAGG + Exonic
1162901004 19:13795574-13795596 CGATGCCCGCTCCGCTTCGCCGG - Exonic
1162932315 19:13963229-13963251 CGAAGCTGGCGGCGCTGCGCAGG + Exonic
1163167599 19:15508617-15508639 GCGCGGCCGCGGCGCTGCGCTGG + Intronic
1163606941 19:18280875-18280897 CGCCGCCCGCGTAGCTGCTCAGG + Exonic
1166536077 19:43575597-43575619 CGACGCCGGCGCCGGCGCGCCGG - Exonic
1167307402 19:48716928-48716950 GCTGGCCCGCGGCGCTGCGCTGG - Intronic
1167425717 19:49428741-49428763 CGACCCCCGCGGGGCGGCGGGGG - Exonic
931711160 2:64989731-64989753 GGACGCGCACGGCGTTGCGCGGG + Exonic
945189024 2:207166922-207166944 CGGCGCCCGCGGGGCGGGGCGGG - Intronic
946966441 2:225042287-225042309 CGGCGGACGCGGCGCTGTGCCGG + Exonic
947538539 2:230957549-230957571 CGGCGCCGGCGGTGCTGGGCGGG + Intronic
948116093 2:235494887-235494909 GGACGCCCGCGGCGCGGCGGGGG + Intronic
948216690 2:236237726-236237748 CCAGGCCCTCGGCGCTGAGCAGG + Exonic
948503236 2:238409984-238410006 TGCAGCCCGCGGCGCTGTGCAGG + Intergenic
1171972544 20:31573210-31573232 CGGCCCCCGCGGGGCGGCGCGGG - Intronic
1175267153 20:57709794-57709816 CGACGCCCCCGGGGCTGCCGAGG - Exonic
1176077127 20:63253766-63253788 CGATGCCCGGGGCGCAGCGCGGG - Intronic
1176566765 21:8392109-8392131 CCCCGCCGGCGGCGCGGCGCAGG - Intergenic
1179879076 21:44286011-44286033 CGACGGACGCGGCGCTACGCCGG + Exonic
1183546294 22:38456053-38456075 CGGGGCCCGCGGCGCGGAGCAGG + Intergenic
1184086615 22:42269864-42269886 CGAGGCCAGCGGGGCTGGGCCGG - Intronic
1184276576 22:43412244-43412266 CGACGCCCGCGGCGCTGCGCAGG + Intronic
1184523797 22:45009848-45009870 GGGCGCGCGCGGGGCTGCGCGGG - Intronic
951881285 3:27483818-27483840 GGATGCCCGCGGCGCGCCGCCGG + Intronic
961735810 3:129001610-129001632 CGAGGCGCGCGGCGCAGCGATGG + Exonic
962259922 3:133895742-133895764 TTACGCCCGAGGCGCGGCGCTGG + Exonic
963503888 3:146161185-146161207 AGGCGCCCGGGGCGCTGCGGAGG + Intronic
969075609 4:4575465-4575487 TGCGGCCCGCGGCGCTGAGCGGG + Intergenic
969715916 4:8868037-8868059 CGGCGCGCTCGGCGCTGCTCAGG + Exonic
976431350 4:84966317-84966339 CGACGTCCGCGGCGGGGCCCGGG + Exonic
982573284 4:157076443-157076465 GGACGCGCGCTGCCCTGCGCGGG + Intronic
985556098 5:558735-558757 CGCCTCCCGGGGCGCTGAGCAGG + Intergenic
985556117 5:558808-558830 CGCCTCCCGGGGCGCTGAGCAGG + Intergenic
985556174 5:559027-559049 CGCCGCCCGGGGCGCTGAGCAGG + Intergenic
985556194 5:559100-559122 CGCCGCCTGGGGCGCTGAGCAGG + Intergenic
986132225 5:4942345-4942367 CGGCGCCCGCGCGGCTGCCCAGG + Intergenic
986813630 5:11385047-11385069 CGCTGCCCGCGCCGCCGCGCGGG - Exonic
990210892 5:53480655-53480677 CGGCGAGCGCGGGGCTGCGCCGG + Exonic
992105782 5:73448196-73448218 CGCCGCCGCCGCCGCTGCGCGGG + Exonic
993500475 5:88660900-88660922 CGAGCCCCGCAGCGCGGCGCCGG + Intergenic
1002139805 5:177132189-177132211 GGACCCCAGCGGAGCTGCGCCGG - Intergenic
1002638331 5:180618986-180619008 CGCCGCCCGCGGCGCCCCGCAGG + Intronic
1003212310 6:4079044-4079066 CGAAGCCCGCGGGCCGGCGCAGG + Exonic
1005516751 6:26562026-26562048 CCAGGCCCGAGGCGCGGCGCCGG + Intergenic
1006547493 6:34792049-34792071 GGGCGGCCGCGGCGCCGCGCTGG + Intronic
1006932765 6:37697614-37697636 CGGCGCCCGCGCCGCAGCCCCGG - Exonic
1007473315 6:42104518-42104540 CGCCGCCCGGGGCGCCGCGGAGG - Exonic
1011610437 6:89145973-89145995 GGCCGCCCCCGGCGCCGCGCGGG - Intergenic
1013514766 6:110875489-110875511 CGCCGCCCGCCGCCCAGCGCGGG - Intronic
1015149437 6:130020550-130020572 CGACGCCCCCAGCCCTCCGCGGG - Intronic
1018458345 6:163972653-163972675 GGACACCAGCGCCGCTGCGCAGG - Intergenic
1019293110 7:259985-260007 CGCCGGCCGCTGCGCTGCCCGGG + Exonic
1019576265 7:1739140-1739162 GGACGCCCTCAGGGCTGCGCGGG + Intronic
1022207489 7:28179437-28179459 CCGGGCCCGGGGCGCTGCGCAGG + Intronic
1022427944 7:30285528-30285550 CGCCGCCGGAGGCGCTGGGCTGG - Exonic
1022698023 7:32728738-32728760 CGCCGCCCGAGGCGCTGGGCTGG - Intergenic
1022715066 7:32891602-32891624 CCACGCCCCCGCCGCCGCGCCGG - Exonic
1022739715 7:33109398-33109420 CAACCCCCGCGGCGCGGCTCCGG + Intronic
1023000345 7:35801531-35801553 CGGAGGCCGCGGCTCTGCGCCGG - Intronic
1030262484 7:107580257-107580279 CGGCGGCCGCGGAGCAGCGCAGG + Intronic
1033390725 7:140924837-140924859 CTCCGCCCGCGGCGCCGCCCGGG - Intergenic
1034446213 7:151115481-151115503 CGACGCCCCGCGCGCAGCGCCGG + Intronic
1035404433 7:158588258-158588280 CGACGCGCGCGGGGCCCCGCGGG - Intergenic
1038304037 8:26383287-26383309 CGCCGCCACCGGCGCGGCGCGGG + Intronic
1038808069 8:30812659-30812681 CGACTCCCGCGGCGCGCGGCCGG - Exonic
1039454603 8:37698407-37698429 CGGCGGCGGCGGCGCTGCCCAGG - Exonic
1041690051 8:60679267-60679289 CGACGCCGGCGACACTACGCGGG - Intronic
1045489091 8:102655753-102655775 CCCCGCCCGCGGCGCGGGGCAGG - Exonic
1048833375 8:138497062-138497084 CTGCGCCCGCGCCGCTGGGCTGG + Intergenic
1050230891 9:3525490-3525512 CGCCGGCCCCGGCCCTGCGCCGG - Intronic
1053050566 9:34958081-34958103 CGCCGCCCGCGGAGCCGCGAGGG + Intronic
1055321626 9:75088307-75088329 CGCGGCCCGCGGCACTGCACTGG + Intergenic
1058467517 9:105244492-105244514 AGACGCGCGCGGCGCTGAGGAGG + Intergenic
1059134831 9:111795089-111795111 CGAGGACCTCGGCGCTGCCCAGG - Intergenic
1059471102 9:114505325-114505347 GGACGCCCGCGCCGCTTCACCGG - Intronic
1060812885 9:126619763-126619785 CGACTCCCCGGGCGCTGGGCTGG + Intronic
1061158891 9:128882167-128882189 CGCCGGCCGCAGCGCTGCTCCGG - Intronic
1062584023 9:137240935-137240957 CGCCGGCCGCGGCACTGCGGCGG + Intergenic
1185761290 X:2691360-2691382 CATGGCCCGCGGGGCTGCGCTGG + Exonic
1190320286 X:49176019-49176041 CGTGGCCTGCGGCGCTGGGCCGG + Exonic
1192624548 X:72714124-72714146 CGGCGCCTGGGGCGCTGCGGCGG - Intronic
1199772643 X:150984155-150984177 CGGCGCCCGCGGCCCGGGGCGGG + Intronic
1200229481 X:154436993-154437015 CGTCGCCCGCGGAGCCGCGCTGG + Exonic