ID: 1184278091

View in Genome Browser
Species Human (GRCh38)
Location 22:43421719-43421741
Sequence AGGGAGAAACGGATGGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3079
Summary {0: 1, 1: 0, 2: 22, 3: 229, 4: 2827}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184278091_1184278103 27 Left 1184278091 22:43421719-43421741 CCTCCATCCATCCGTTTCTCCCT 0: 1
1: 0
2: 22
3: 229
4: 2827
Right 1184278103 22:43421769-43421791 ACTGATGAAGTATTTGTGATAGG 0: 1
1: 0
2: 2
3: 18
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184278091 Original CRISPR AGGGAGAAACGGATGGATGG AGG (reversed) Intronic
Too many off-targets to display for this crispr