ID: 1184278103

View in Genome Browser
Species Human (GRCh38)
Location 22:43421769-43421791
Sequence ACTGATGAAGTATTTGTGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 217}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184278097_1184278103 4 Left 1184278097 22:43421742-43421764 CCCTGCCTCCATCCATCCACTAA 0: 1
1: 0
2: 28
3: 569
4: 4077
Right 1184278103 22:43421769-43421791 ACTGATGAAGTATTTGTGATAGG 0: 1
1: 0
2: 2
3: 18
4: 217
1184278096_1184278103 7 Left 1184278096 22:43421739-43421761 CCTCCCTGCCTCCATCCATCCAC 0: 1
1: 4
2: 54
3: 441
4: 3178
Right 1184278103 22:43421769-43421791 ACTGATGAAGTATTTGTGATAGG 0: 1
1: 0
2: 2
3: 18
4: 217
1184278095_1184278103 8 Left 1184278095 22:43421738-43421760 CCCTCCCTGCCTCCATCCATCCA 0: 3
1: 37
2: 473
3: 14958
4: 25243
Right 1184278103 22:43421769-43421791 ACTGATGAAGTATTTGTGATAGG 0: 1
1: 0
2: 2
3: 18
4: 217
1184278099_1184278103 -1 Left 1184278099 22:43421747-43421769 CCTCCATCCATCCACTAATACTA 0: 1
1: 0
2: 1
3: 20
4: 162
Right 1184278103 22:43421769-43421791 ACTGATGAAGTATTTGTGATAGG 0: 1
1: 0
2: 2
3: 18
4: 217
1184278101_1184278103 -8 Left 1184278101 22:43421754-43421776 CCATCCACTAATACTACTGATGA 0: 1
1: 1
2: 0
3: 9
4: 104
Right 1184278103 22:43421769-43421791 ACTGATGAAGTATTTGTGATAGG 0: 1
1: 0
2: 2
3: 18
4: 217
1184278092_1184278103 24 Left 1184278092 22:43421722-43421744 CCATCCATCCGTTTCTCCCTCCC No data
Right 1184278103 22:43421769-43421791 ACTGATGAAGTATTTGTGATAGG 0: 1
1: 0
2: 2
3: 18
4: 217
1184278094_1184278103 16 Left 1184278094 22:43421730-43421752 CCGTTTCTCCCTCCCTGCCTCCA 0: 1
1: 2
2: 146
3: 1911
4: 12669
Right 1184278103 22:43421769-43421791 ACTGATGAAGTATTTGTGATAGG 0: 1
1: 0
2: 2
3: 18
4: 217
1184278091_1184278103 27 Left 1184278091 22:43421719-43421741 CCTCCATCCATCCGTTTCTCCCT 0: 1
1: 0
2: 22
3: 229
4: 2827
Right 1184278103 22:43421769-43421791 ACTGATGAAGTATTTGTGATAGG 0: 1
1: 0
2: 2
3: 18
4: 217
1184278093_1184278103 20 Left 1184278093 22:43421726-43421748 CCATCCGTTTCTCCCTCCCTGCC 0: 1
1: 4
2: 96
3: 2016
4: 14036
Right 1184278103 22:43421769-43421791 ACTGATGAAGTATTTGTGATAGG 0: 1
1: 0
2: 2
3: 18
4: 217
1184278100_1184278103 -4 Left 1184278100 22:43421750-43421772 CCATCCATCCACTAATACTACTG No data
Right 1184278103 22:43421769-43421791 ACTGATGAAGTATTTGTGATAGG 0: 1
1: 0
2: 2
3: 18
4: 217
1184278098_1184278103 3 Left 1184278098 22:43421743-43421765 CCTGCCTCCATCCATCCACTAAT 0: 1
1: 0
2: 5
3: 70
4: 638
Right 1184278103 22:43421769-43421791 ACTGATGAAGTATTTGTGATAGG 0: 1
1: 0
2: 2
3: 18
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184278103 Original CRISPR ACTGATGAAGTATTTGTGAT AGG Intronic
902964753 1:19991817-19991839 ACTCATGTAGTTTTTGTCATTGG + Intergenic
905049152 1:35034153-35034175 ACTTATGAATTATTTGTTACTGG - Intergenic
908197814 1:61762507-61762529 ACTGAGTAAGTATTTGTGAGTGG + Intronic
909220033 1:72946307-72946329 CCTGATTAAATATTTGTTATAGG + Intergenic
909419219 1:75444806-75444828 ACAGATGATATACTTGTGATGGG + Intronic
909801372 1:79812934-79812956 TCTGATGAAGAATTTGTTAATGG + Intergenic
910572269 1:88718743-88718765 ACTGGGGAAGTAATTGTGAAAGG - Intronic
911073292 1:93848769-93848791 ACTGATGCATTGTTTGTAATAGG - Intergenic
919890705 1:201972018-201972040 ACAGATGGGGTATTTCTGATGGG + Intergenic
920773175 1:208909236-208909258 AATGCTGAAGTATTTGACATTGG - Intergenic
922123915 1:222703593-222703615 ACTGATAAAGTATCTCTGGTTGG - Intronic
1063072060 10:2676530-2676552 ACTCATGAAGAATTTAGGATGGG - Intergenic
1064658069 10:17576213-17576235 ACTGATGTAGTTTTTGTGGGAGG + Intergenic
1065229641 10:23583916-23583938 CCAGGTGAAGTCTTTGTGATTGG + Intergenic
1065602897 10:27387795-27387817 ACTGATGAAGTATTTTGTAATGG + Intergenic
1065782642 10:29184618-29184640 GCTGATGAAGTCTATGTCATTGG + Intergenic
1070062087 10:72993766-72993788 ACTGATGTGGTTTTTGTCATTGG - Intergenic
1071900171 10:90112271-90112293 ACTGATGTAATTTTTGTGAGAGG - Intergenic
1072428746 10:95352799-95352821 AATGATAAAGTATTTGCAATGGG + Intronic
1072556820 10:96523522-96523544 ACTAATGAATTATTTGAGCTAGG + Intronic
1073238752 10:102039512-102039534 ACTGAGGAATTATTAGTAATTGG - Intronic
1077608940 11:3632026-3632048 ACTCATGAGGAATTTATGATTGG - Intergenic
1079584561 11:22109865-22109887 ACTGATAAACTATTGTTGATTGG + Intergenic
1079648169 11:22893396-22893418 ACTGTTTCAATATTTGTGATTGG - Intergenic
1079873098 11:25824347-25824369 ACTGATGTAGTCTTTGGGAAAGG + Intergenic
1079899185 11:26160141-26160163 ACTGAGAAAGTGTCTGTGATTGG - Intergenic
1081096209 11:38939398-38939420 ATTGATGAAGTAATTTTTATAGG + Intergenic
1088384773 11:109241519-109241541 AATGATGAAGTAATTTTGAGTGG + Intergenic
1089115548 11:116092270-116092292 ACTGGTGAATTATATGGGATAGG + Intergenic
1090215184 11:124955616-124955638 ACTCATGAAGTATTTATGAAAGG + Intronic
1091216276 11:133904298-133904320 ACTGATGAAGAGCTGGTGATAGG + Intergenic
1092300155 12:7240407-7240429 TCTGATGAAATTTTTGTCATGGG + Intergenic
1092819887 12:12343749-12343771 ACTGATGAAGCAGTAGTAATAGG + Intronic
1094293231 12:28875184-28875206 TTTGTTGAAGTAATTGTGATGGG - Intergenic
1095184205 12:39182409-39182431 ACTTTTGAAGTATATGTTATTGG + Intergenic
1097449977 12:59725481-59725503 ACTGATGAACCATTTTTAATAGG - Intronic
1098037836 12:66323520-66323542 ACTGAAGAAGTGGTGGTGATAGG - Intronic
1099243466 12:80165882-80165904 ACTGAAGAAGGATTAGTGAAGGG - Intergenic
1099500655 12:83410221-83410243 ACTGTTGAAGTCATTGGGATAGG - Intergenic
1099913933 12:88868231-88868253 AATGATGATGTAATTGAGATGGG - Intergenic
1101523225 12:105504121-105504143 ATGGAAGAAGGATTTGTGATGGG + Intergenic
1101806980 12:108072593-108072615 CCTGATGAAGCATTTGTCATGGG - Intergenic
1102457686 12:113081062-113081084 ACTGATGAAATATTTGAGGCGGG + Intronic
1103342195 12:120226658-120226680 GCTGGTGAAGTATTGGTGAGAGG + Intronic
1103446777 12:120999869-120999891 AATGATGAAGTAATTGTTAGAGG + Intronic
1103811765 12:123620045-123620067 ACTGAAGAAGAATTTGAGAAGGG + Exonic
1105785180 13:23741056-23741078 ACTGATGAGGTATTTGTCCTGGG - Intronic
1105982977 13:25537671-25537693 AATGCTGAAGTATTTGTAAATGG + Intronic
1106026026 13:25956010-25956032 ACTCATGTAGTTTTTGTCATTGG - Intronic
1109067611 13:57718974-57718996 ACAGATAAAGAATTTGTGATGGG + Intronic
1110959925 13:81608740-81608762 ACTGATGAAGTAGTCATTATTGG + Intergenic
1116176657 14:41479380-41479402 CTGGATGAAGTATTTGTGAGTGG + Intergenic
1116816002 14:49584386-49584408 ACTGATGAAGTATTTGCTCAGGG + Intronic
1120545064 14:85801002-85801024 ACTGTTGAAGTAGTTTTGAAAGG - Intergenic
1120678135 14:87446601-87446623 AATAATGAATGATTTGTGATTGG + Intergenic
1125336202 15:38628793-38628815 ACTGAAGAAGCCTTTGTGAAGGG + Intergenic
1125388635 15:39167369-39167391 ACTGATGCAATATTTGAAATGGG + Intergenic
1125480871 15:40079281-40079303 ACAAATACAGTATTTGTGATGGG + Intergenic
1127223675 15:56908031-56908053 ACACATTAAGTTTTTGTGATTGG - Intronic
1128220166 15:65963401-65963423 ACTGATGAAATATATGTGGCTGG - Intronic
1129044700 15:72724235-72724257 ACTTATGAAGTATGAGTCATAGG + Intronic
1129990467 15:79958102-79958124 TCTGATAAAGGACTTGTGATAGG - Intergenic
1130175899 15:81570506-81570528 ACAGATGAAGAATTTTAGATGGG - Intergenic
1133713132 16:8420730-8420752 ACTAATGAAATAATTGTGGTAGG - Intergenic
1133995280 16:10743666-10743688 ACTGCAGAAGTATTTATGATAGG + Intergenic
1134047306 16:11110199-11110221 GCTGAAGAAGTATTTGTGGATGG - Intronic
1141247609 16:82324508-82324530 ATTTATGGAGTATTTGTCATAGG + Intergenic
1141368373 16:83464812-83464834 AGTGATAATGTATTTTTGATGGG + Intronic
1143269868 17:5667587-5667609 ACTGATGAAGAATTTTAGAAAGG - Intergenic
1147815592 17:43207658-43207680 AGAGATGAAGTATATGAGATGGG - Intronic
1150519923 17:65855493-65855515 CCTGATGAAGTAACTGTGAAAGG + Intronic
1151623884 17:75264411-75264433 ACTGATGAAGCATCAGTTATCGG - Intronic
1152788749 17:82266437-82266459 ACTGATGAAAGATGTGTGACCGG - Intronic
1203167501 17_GL000205v2_random:111327-111349 AATGATGAAGTACTTGAGACTGG - Intergenic
1153344896 18:4014814-4014836 ACTGCGGAAGTATTTTTGATTGG + Intronic
1154530538 18:15339764-15339786 ACAGAGGACATATTTGTGATAGG + Intergenic
1155524999 18:26706982-26707004 GCTGATGAAGTACTTATGCTCGG + Intergenic
1156277019 18:35593392-35593414 CCTGAGGAAGTATTTGGGAGAGG + Intronic
1158837286 18:61344241-61344263 ACTGATGAAGTGCTTTTGACAGG - Intronic
1160377544 18:78424613-78424635 ACTGATGAAGTGATTGTAGTGGG - Intergenic
1163771675 19:19194889-19194911 ACTGAGGATTTATTTTTGATTGG + Intronic
1165530808 19:36399224-36399246 ACTCATGAAGTATTTAGCATTGG + Intronic
1166248970 19:41552529-41552551 AGTACTGAAGTAGTTGTGATGGG + Intronic
926603751 2:14875919-14875941 CCTGATGCAGTATTTTTGCTAGG - Intergenic
927405317 2:22759617-22759639 ATTGATGAAGAATTTGTGATTGG - Intergenic
928600343 2:32898258-32898280 TCAGAGGAAGTATTTGTGGTGGG + Intergenic
929068038 2:37999918-37999940 ACGGATGAAGAATTTGAGAGTGG - Intronic
931599148 2:63985370-63985392 ACAGATGAACTATTTGTCATGGG - Intronic
931961426 2:67487420-67487442 AGAGATGAAGTATATGTGTTAGG + Intergenic
935089031 2:99876414-99876436 ACTGATGAAGTGAATGTGAGAGG - Intronic
935346792 2:102115666-102115688 AGTGGTGCAGTATTTGGGATAGG + Intronic
935456418 2:103273257-103273279 ACTGTTTAAGTATTTGTCATTGG + Intergenic
935502020 2:103853138-103853160 ACTGATTATTTATTTGTGTTGGG + Intergenic
938529645 2:132171232-132171254 ACAGAGGACATATTTGTGATAGG + Intronic
939267812 2:139896714-139896736 ACTTTTGAAATATTTGTGAATGG - Intergenic
940278571 2:151965460-151965482 ACTGATGAATTATTGGTTTTAGG + Intronic
941507236 2:166361941-166361963 GCTGATGAAATATTCCTGATGGG + Intronic
942020558 2:171863765-171863787 TCTGATGAAGGACTTATGATAGG + Intronic
942542770 2:177031824-177031846 ACTGCTGAAGGCTTGGTGATAGG - Intergenic
942623924 2:177878440-177878462 CCTGATGAAATATGTGTGCTTGG + Intronic
942758642 2:179372053-179372075 ACTGTTGGAGTTTTAGTGATTGG + Intergenic
942839997 2:180348851-180348873 ACTAGTGTAGCATTTGTGATTGG - Intergenic
942994356 2:182243361-182243383 AATGAGGAAGTATTAGTTATAGG + Intronic
943407575 2:187509051-187509073 ACTCATGAGGTTTTTGTCATTGG + Intronic
945849400 2:214987259-214987281 ACTTTTCCAGTATTTGTGATGGG + Intronic
1170146482 20:13180753-13180775 ACTCATTAAGTATTTGTGTAGGG - Intergenic
1171222495 20:23412247-23412269 ACTGATGAAGTATGAGTGGAAGG - Intronic
1174228105 20:49021428-49021450 ACTTATGATGTATTTGACATGGG + Intronic
1175448752 20:59044625-59044647 ACTGATATAGTATGTGTGTTGGG - Intergenic
1176404257 21:6347808-6347830 AATGATGAAGTACTTGAGACTGG + Intergenic
1176432900 21:6641296-6641318 AATGATGAAGTACTTGAGACTGG - Intergenic
1178997783 21:37421285-37421307 ATTGGTGTAGTTTTTGTGATTGG + Intronic
1179142349 21:38736975-38736997 ACTTGTGAAGTATTTGGGATAGG + Intergenic
1182133176 22:27874093-27874115 ACTGTTGAAAGATTTGTTATTGG - Intronic
1183638837 22:39081261-39081283 ACTGCTTAAGTGTCTGTGATGGG + Intronic
1184278103 22:43421769-43421791 ACTGATGAAGTATTTGTGATAGG + Intronic
951051804 3:18102084-18102106 AATTATAATGTATTTGTGATAGG - Intronic
951660656 3:25060935-25060957 ACAGATGAAGCATTTGTGTAAGG + Intergenic
956554812 3:70508117-70508139 ACTGATGAAATATTTTTAATGGG - Intergenic
957555329 3:81759400-81759422 ACTGGTTATGTATTTGTGTTAGG + Intronic
958451256 3:94275700-94275722 AGTGATACAGCATTTGTGATGGG - Intergenic
959953080 3:112203322-112203344 ACTGATGAATTAATTCTGATAGG - Intronic
960576608 3:119236223-119236245 ACTGAGGAACTATTTCAGATTGG + Intronic
962635751 3:137329929-137329951 ACTGATGTAGTTTGTGTGTTAGG - Intergenic
962705670 3:138041415-138041437 ATTGATGAATTCTTTGTCATTGG - Intergenic
963098208 3:141569226-141569248 GGGGATGAAGTATTTGTAATGGG + Intronic
963349576 3:144136055-144136077 AATGATAAAGTAATTGAGATAGG + Intergenic
963835289 3:150052334-150052356 ACTGATGAAGTGCTTCAGATTGG + Intergenic
965538188 3:169846867-169846889 ACTGATGAAGTGTTTGAGTGCGG + Intronic
965883633 3:173416788-173416810 AGTGATGAAATCTTTGTGCTTGG - Intronic
965945567 3:174236706-174236728 AATGGTGAAGAATTTGTGACTGG - Intronic
966036657 3:175425157-175425179 ACTGATACCGTATTTGTGAATGG - Intronic
968070472 3:195781378-195781400 ACTGAGGAAGTGTTGGTGACAGG + Exonic
968070808 3:195783250-195783272 ACTGAGGAAGTGTTGGTGACAGG + Exonic
969339968 4:6534468-6534490 ACTGTTGGAGTATGTGTGTTAGG - Intronic
970445833 4:16122699-16122721 ACTCATGAAGGATTTTTGCTGGG + Intergenic
972167648 4:36307137-36307159 ACTGAAGAAGAATTTGAGAATGG + Intronic
973310369 4:48703344-48703366 ACTGTTGTAGTAATTGTGAAAGG - Intronic
974811542 4:66952696-66952718 ATTGATCAATTATTTGTGTTGGG - Intergenic
974956025 4:68642484-68642506 AATCATGTGGTATTTGTGATTGG + Intronic
976071238 4:81242126-81242148 ATTGATACAGTATTTGAGATAGG - Intergenic
977634796 4:99284930-99284952 ACAAATGACATATTTGTGATTGG - Intronic
978855655 4:113391360-113391382 ACTAATGAACTATTTTTGCTTGG - Intergenic
979577242 4:122308140-122308162 ACCTGTGCAGTATTTGTGATAGG - Exonic
979640652 4:123009854-123009876 TCTGATTAAGTATTTCTGAAGGG - Intronic
979797936 4:124870616-124870638 ATTTATCATGTATTTGTGATGGG + Intergenic
982359427 4:154503864-154503886 ACCTATGAAGTATTTGTATTAGG + Intergenic
984287338 4:177748647-177748669 CCTGATGAAGTTTTTCTTATTGG - Intronic
984475837 4:180233356-180233378 ATTGATGCAGTATTTGTCAGAGG - Intergenic
987688794 5:21240775-21240797 ACTAATGACATATTTGTGATAGG - Intergenic
987914287 5:24191304-24191326 ACTGATGAAGAATATGTGCGTGG + Intergenic
988441143 5:31234658-31234680 ACTGATGAAATACTTGTGGTAGG - Intronic
990647440 5:57860226-57860248 ACTGATGAAGAATAAGTGATAGG - Intergenic
991091489 5:62697774-62697796 ATTGATGGAGTCTTTGTGCTTGG + Intergenic
991128648 5:63095807-63095829 ACTGAGAAAGCATTTGTAATGGG + Intergenic
994055274 5:95407156-95407178 ACAGTTGAAGTATGTGGGATGGG + Intronic
995465392 5:112445454-112445476 ACTGGTTAAGGATTTTTGATAGG - Intergenic
996005079 5:118410131-118410153 TCTGATAAAGTATTTGCAATTGG - Intergenic
996479421 5:123957431-123957453 ACTGATGTAGTAAATGTGTTGGG + Intergenic
997680468 5:135746628-135746650 ACTGCCGAAGTATGTATGATAGG - Intergenic
997877124 5:137559522-137559544 TATGTTGATGTATTTGTGATGGG - Intronic
998994402 5:147854643-147854665 ACTGGTGAAGTCTCTGTGCTAGG + Intergenic
999148922 5:149413866-149413888 ACTTATGACGCAGTTGTGATGGG + Intergenic
1000835952 5:166154220-166154242 TGTGATAAAGTATTTGTGAAGGG - Intergenic
1003805988 6:9726382-9726404 GCTGATTAAGGATTTTTGATAGG - Intronic
1004698804 6:18059218-18059240 ACTGATCAAGTATCTCTGTTAGG + Intergenic
1007217793 6:40253987-40254009 ACTGAATAAGTATTTGTGGTGGG - Intergenic
1007581988 6:42965303-42965325 ACTCAGGATGTGTTTGTGATTGG - Exonic
1007827285 6:44610102-44610124 TCTGATGAAGTTCTTGTCATTGG + Intergenic
1008938324 6:57016969-57016991 ATTTATGAGGTATTTGTTATAGG - Intronic
1009261965 6:61502780-61502802 TCTGAGAAATTATTTGTGATGGG - Intergenic
1009262043 6:61503976-61503998 TCTGAGAAATTATTTGTGATGGG - Intergenic
1009262096 6:61504835-61504857 CCTGAGAAATTATTTGTGATGGG - Intergenic
1009954494 6:70436221-70436243 TCTGATTAAGCATTGGTGATTGG + Intronic
1011452138 6:87504671-87504693 GGTGATGAAGTAGATGTGATGGG - Intronic
1012603007 6:101121079-101121101 CCAGATGAAGTATTTGAAATAGG - Intergenic
1014175452 6:118326576-118326598 ACTCAAGAAGTATTTCTGACAGG + Intergenic
1015549984 6:134402150-134402172 AATGAAGGAATATTTGTGATGGG + Intergenic
1017557252 6:155584537-155584559 TCTTATGAAGTATGTGTAATGGG - Intergenic
1018223068 6:161600979-161601001 ACTGATGAATTATGAGTGAATGG - Intronic
1020452939 7:8340448-8340470 AATGATAAAGGATTTGTGGTTGG + Intergenic
1020883565 7:13794186-13794208 AATGGTGAAGTATTCTTGATTGG + Intergenic
1024763875 7:52632883-52632905 ACTGATGAATAAATTGAGATTGG + Intergenic
1025584158 7:62760853-62760875 TCTGAAAAAGTGTTTGTGATGGG - Intergenic
1026376326 7:69754581-69754603 ACTGCTGCAGTATTTCAGATGGG + Intronic
1028400534 7:90420638-90420660 ACAGATGATGTATTTTTTATAGG - Intronic
1028422143 7:90645225-90645247 ACTGAGGATGTATTTATGAGTGG - Intronic
1030280651 7:107771203-107771225 AGTGATGCAGTGATTGTGATAGG + Intronic
1030531941 7:110722017-110722039 ACTGATGAAGGTTTAGTGAGAGG + Intronic
1030759637 7:113334515-113334537 AATCATGAAGTTTTTGTCATTGG - Intergenic
1030839521 7:114331014-114331036 TCTTATGAAGTCTTTGTGTTTGG + Intronic
1032860287 7:135871691-135871713 ACTGATGAATTAAATTTGATTGG + Intergenic
1033911592 7:146269621-146269643 ACTGTTGAAGTCTTTGTGTTGGG + Intronic
1034649330 7:152676982-152677004 ACCAATGAAGTATTTCTCATGGG + Intergenic
1037323055 8:17661962-17661984 ACTCATGAAGTATTTTTTAAAGG + Intronic
1040132357 8:43812084-43812106 ACTATTGGAGGATTTGTGATGGG + Intergenic
1041479959 8:58308774-58308796 AATGAAGAATCATTTGTGATAGG + Intergenic
1041575071 8:59384714-59384736 AATCATGAGGTTTTTGTGATTGG - Intergenic
1042057402 8:64780535-64780557 AATGTAGAAGTATTTGGGATGGG - Intronic
1042711661 8:71724085-71724107 ACTGCTGAGGGATGTGTGATGGG - Intergenic
1043119008 8:76298557-76298579 ACTGAAGAAGTATTCCTGAAGGG - Intergenic
1044473629 8:92601347-92601369 ACGTATGAAGTATTTGGTATAGG - Intergenic
1044867049 8:96581804-96581826 GCTGATGAAGTATTTGTCATTGG + Intronic
1046209687 8:111053058-111053080 ACTGATTAAAAATTTGTTATAGG - Intergenic
1047814191 8:128444894-128444916 AGTGATAAATTATTTGTGAAAGG - Intergenic
1048869631 8:138786472-138786494 ACTAATGAAATATTTGAGTTAGG - Intronic
1048908417 8:139110773-139110795 ACTGATAAAGTATTTTTTCTGGG - Intergenic
1050224460 9:3436011-3436033 ACTGATTAAGTAGTAGTGATAGG + Intronic
1051873719 9:21768521-21768543 AGGGTTGTAGTATTTGTGATTGG + Intergenic
1052393311 9:27907064-27907086 ATAAATGAAGTATTTGTGAAAGG + Intergenic
1052610321 9:30764536-30764558 ACTGATAAAGTAATGGTGGTAGG - Intergenic
1053614207 9:39746383-39746405 ACCGAGGAAGAATTTCTGATGGG + Intergenic
1053708243 9:40777501-40777523 ACAGAGGACATATTTGTGATAGG + Intergenic
1053872235 9:42504324-42504346 ACCGAGGAAGAATTTCTGATTGG + Intergenic
1054239309 9:62596009-62596031 ACCGAGGAAGAATTTCTGATGGG - Intergenic
1054418152 9:64898291-64898313 ACAGAGGACATATTTGTGATAGG + Intergenic
1054553440 9:66630531-66630553 ACCGAGGAAGAATTTCTGATGGG - Intergenic
1056050507 9:82763558-82763580 AATGATAAAGCATTTCTGATTGG - Intergenic
1056440410 9:86615429-86615451 ACTCATGAAATATTTGTGGAAGG - Intergenic
1056562435 9:87743321-87743343 ACTGATGAAGTGCTTCAGATGGG + Intergenic
1056778133 9:89528979-89529001 ACCAATGGTGTATTTGTGATGGG + Intergenic
1058189804 9:101899479-101899501 ACTGAGCAATTATTTGAGATGGG + Intergenic
1059472910 9:114520546-114520568 ACCTATGAAGTCTTTTTGATAGG - Intergenic
1061525085 9:131153956-131153978 AGAAAAGAAGTATTTGTGATAGG + Intronic
1203438635 Un_GL000195v1:167374-167396 AATGATGAAGTACTTGAGACTGG + Intergenic
1188332335 X:28890311-28890333 CCTGATAAAATATTTGTAATTGG + Intronic
1188634082 X:32406508-32406530 AATCATGTGGTATTTGTGATTGG + Intronic
1189051835 X:37653433-37653455 ACAGAGGAAGTTTTTGTGGTAGG - Intronic
1189758296 X:44294918-44294940 ACTGATTAAGTACTTATAATGGG + Intronic
1190452764 X:50597518-50597540 TCTCATCAAGTATTTGAGATTGG - Intronic
1191175570 X:57497424-57497446 ACTTATGAAGTTTCTTTGATGGG - Intergenic
1192459210 X:71302791-71302813 ACTAAGGATGTATTTGTGAGGGG - Intronic
1193077671 X:77372616-77372638 ACTGATGGAGAATATGTGCTAGG + Intergenic
1194933464 X:99917858-99917880 ACTGATGAAGTATTGTTTCTGGG + Intergenic
1195079973 X:101361528-101361550 ACTTCTGAAGTGTTAGTGATAGG + Intronic
1198994382 X:142557540-142557562 ACTGGTGAAATATTTATGAGAGG - Intergenic
1200380003 X:155826255-155826277 ACTGATCATTTATTTGTGTTAGG - Intergenic
1201167732 Y:11225575-11225597 AATCATGAAGTTTTTGTCATTGG + Intergenic