ID: 1184278201

View in Genome Browser
Species Human (GRCh38)
Location 22:43422382-43422404
Sequence CTGGAGGCCTACAGCTCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 167}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184278201_1184278211 1 Left 1184278201 22:43422382-43422404 CCCTGTGAGCTGTAGGCCTCCAG 0: 1
1: 0
2: 0
3: 11
4: 167
Right 1184278211 22:43422406-43422428 TGCAAGAGGCCACCGGGGGCCGG 0: 1
1: 0
2: 1
3: 14
4: 184
1184278201_1184278207 -5 Left 1184278201 22:43422382-43422404 CCCTGTGAGCTGTAGGCCTCCAG 0: 1
1: 0
2: 0
3: 11
4: 167
Right 1184278207 22:43422400-43422422 TCCAGGTGCAAGAGGCCACCGGG 0: 1
1: 0
2: 1
3: 30
4: 266
1184278201_1184278206 -6 Left 1184278201 22:43422382-43422404 CCCTGTGAGCTGTAGGCCTCCAG 0: 1
1: 0
2: 0
3: 11
4: 167
Right 1184278206 22:43422399-43422421 CTCCAGGTGCAAGAGGCCACCGG 0: 1
1: 0
2: 3
3: 20
4: 204
1184278201_1184278216 22 Left 1184278201 22:43422382-43422404 CCCTGTGAGCTGTAGGCCTCCAG 0: 1
1: 0
2: 0
3: 11
4: 167
Right 1184278216 22:43422427-43422449 GGCCTGTGTGGCTCAAGTAGAGG 0: 1
1: 0
2: 4
3: 18
4: 179
1184278201_1184278213 10 Left 1184278201 22:43422382-43422404 CCCTGTGAGCTGTAGGCCTCCAG 0: 1
1: 0
2: 0
3: 11
4: 167
Right 1184278213 22:43422415-43422437 CCACCGGGGGCCGGCCTGTGTGG 0: 1
1: 0
2: 1
3: 13
4: 158
1184278201_1184278210 -3 Left 1184278201 22:43422382-43422404 CCCTGTGAGCTGTAGGCCTCCAG 0: 1
1: 0
2: 0
3: 11
4: 167
Right 1184278210 22:43422402-43422424 CAGGTGCAAGAGGCCACCGGGGG 0: 1
1: 0
2: 0
3: 13
4: 174
1184278201_1184278209 -4 Left 1184278201 22:43422382-43422404 CCCTGTGAGCTGTAGGCCTCCAG 0: 1
1: 0
2: 0
3: 11
4: 167
Right 1184278209 22:43422401-43422423 CCAGGTGCAAGAGGCCACCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184278201 Original CRISPR CTGGAGGCCTACAGCTCACA GGG (reversed) Intronic
903352671 1:22727390-22727412 CTGAAGCCCCACAGCTCCCAGGG + Intronic
909048969 1:70745601-70745623 CTGGTGACCTACAGCTCCCTGGG + Intergenic
913389194 1:118291588-118291610 CTGCAGGCCAACAACTTACAGGG + Intergenic
914992426 1:152510595-152510617 CTAGAGGCCTGCAGTTCTCAGGG + Intergenic
917869750 1:179230174-179230196 CTGGAGGCCTGCTGCTGACAAGG - Intergenic
918997737 1:191783990-191784012 CAGGAGGCCTTCAGATCGCATGG + Intergenic
919805753 1:201380171-201380193 CTGGAGGCCTTCACCTGGCAGGG - Intronic
920372806 1:205490160-205490182 TTGGAGGCCCCCAGCTCCCAGGG - Intergenic
922898529 1:229118997-229119019 CTGGGGACCCAGAGCTCACAAGG + Intergenic
924107442 1:240663136-240663158 CTTGAGGCCTAAAGCTTCCAGGG - Intergenic
924287077 1:242498418-242498440 ATAGAGGACTACATCTCACAGGG - Intronic
924794086 1:247279857-247279879 CTGGAGTCAGACATCTCACATGG + Intergenic
1062862674 10:822641-822663 ATGGTGGGTTACAGCTCACAAGG + Intronic
1064277054 10:13915849-13915871 CAGGAGGCCAACCGCCCACAGGG - Intronic
1066822997 10:39519491-39519513 TTTGAGGCCTACAGCTGAAACGG + Intergenic
1067058401 10:43065360-43065382 CTGCAGGCCTAGAGCTCACCAGG + Intergenic
1067851428 10:49757040-49757062 CTTGAGGACCACAGCTCTCAGGG + Intronic
1067908188 10:50316371-50316393 CTGGAGACCTACAGCAGATAGGG - Intronic
1069915221 10:71783029-71783051 CAGGAAGCACACAGCTCACAGGG - Intronic
1070706420 10:78642406-78642428 CTGGAGGCCCACGGATCATAAGG + Intergenic
1070770432 10:79079278-79079300 CTGGGGGCCCACAGCCCCCATGG - Intronic
1070807251 10:79277789-79277811 CTGGAGGCCGACAGCACCGAGGG + Intronic
1071037020 10:81259530-81259552 GTGGAGGCCAACATCTTACATGG - Intergenic
1072922899 10:99591666-99591688 CTGGAGGCGGGCAGATCACAAGG - Intergenic
1073445237 10:103576469-103576491 CTGGAAGCTTTCAGCTCTCATGG - Intronic
1075085689 10:119412965-119412987 TTGGAGGCCTCCTGCTCACCTGG + Intronic
1076846642 10:133072435-133072457 CGGGAGGCCTGCAGCTGCCACGG + Intronic
1077220512 11:1413522-1413544 TGGGAGCCCTACAGCCCACATGG + Intronic
1079078221 11:17396650-17396672 CTGGACTCCCCCAGCTCACACGG - Intronic
1082156103 11:48816377-48816399 TTTGAGGCCTACAGCTGAAAAGG + Intergenic
1082156686 11:48828404-48828426 CTGGAGGCCTATAGGTGAAAAGG + Intergenic
1082163434 11:48910734-48910756 TTTGAGGCCTACAGCTGAAACGG - Intergenic
1082315889 11:50720946-50720968 TTTGAGGCCTACAGCTGAAAAGG - Intergenic
1082316603 11:50733199-50733221 TTCGAGGCCTACAGCTGAAAAGG + Intergenic
1082316658 11:50734465-50734487 TTTGAGGCCTACAGCTGAAATGG + Intergenic
1082316695 11:50735319-50735341 TTTGAGGCCTACAGCTGAAAAGG + Intergenic
1082316888 11:50739419-50739441 TTTGAGGCCTACAGCTGAAAAGG + Intergenic
1082317905 11:50751987-50752009 TTTGAGGCCTACAGCTGAAAAGG - Intergenic
1082581748 11:54878813-54878835 ATGGAGGCCTACAGTTAAAAAGG - Intergenic
1082890210 11:58131113-58131135 CTGCAGGGCTAGAGCTCAGAAGG + Intronic
1084492726 11:69487324-69487346 CTGGTGGCCTGCAGCCCTCACGG - Intergenic
1085159086 11:74324540-74324562 CTGGAGGACAAGAGATCACATGG + Intergenic
1087175511 11:95091520-95091542 CTGCACCCCTAGAGCTCACAGGG + Intronic
1087369199 11:97259847-97259869 CTGCATGCCTACAGCACACAAGG - Intergenic
1087470586 11:98569072-98569094 ATGAAGGCCTACCTCTCACAGGG + Intergenic
1088953158 11:114590533-114590555 CTGGAAACCTAAAGCTCAAAAGG + Intronic
1089134068 11:116235352-116235374 CCTGAGGCCTGCAGCTCACCTGG + Intergenic
1089685741 11:120145621-120145643 CAGGAGGCCCAGAGCTTACATGG + Intronic
1091626983 12:2128911-2128933 CTTCAGGGCTACATCTCACAGGG - Intronic
1093515473 12:19981233-19981255 CTGGATGCCTATGGATCACAGGG + Intergenic
1097354499 12:58586395-58586417 ATGGAGGCCTTCAGGTCTCAGGG + Intronic
1101048575 12:100836928-100836950 CTGCAGGTCTAGAACTCACAAGG + Intronic
1102982060 12:117249868-117249890 CTGTAGGTCTAGACCTCACAGGG + Intronic
1107757490 13:43640469-43640491 CTGCATGCCTACAACTCACCAGG + Intronic
1110544109 13:76737342-76737364 GTGGAGGCCAGCGGCTCACAAGG - Intergenic
1113261651 13:108571610-108571632 CTGCAGACCTCCTGCTCACATGG - Intergenic
1115034207 14:28837730-28837752 CTCGAGGCCTCAAGCCCACATGG + Intergenic
1115372466 14:32633464-32633486 CAGGAGGCCTGCAAGTCACATGG - Intronic
1117377668 14:55130234-55130256 CTGAACGCCTACTGCTCAGAGGG - Intronic
1118733531 14:68685986-68686008 CTGGAGGCCTCTTGCTGACAGGG - Intronic
1119437714 14:74609078-74609100 CTGGCTGTCTGCAGCTCACAAGG + Intronic
1122667821 14:103345830-103345852 ATGGAAGCCTACAGCGCAAAGGG - Intergenic
1122929014 14:104924923-104924945 CTGCAGGCCCTCAGCTCACGGGG - Exonic
1125328588 15:38561957-38561979 CTTGAGGCTTACAGCCCAGAAGG + Intronic
1125588102 15:40836233-40836255 CTGGAGGCTTACTTATCACATGG + Intergenic
1126914193 15:53447478-53447500 GTGCAGGCCTTCAGTTCACAGGG - Intergenic
1129060862 15:72859348-72859370 CTGCTGGCCCACGGCTCACAGGG + Intergenic
1129766725 15:78174356-78174378 CTGGGGGGCTCCAGCTCAGAAGG - Intronic
1129856927 15:78831190-78831212 CACCAGGCCTACAGCGCACAGGG - Intronic
1135588564 16:23689673-23689695 CTGGTGACCTCCAGCTCACCTGG - Exonic
1136623054 16:31442833-31442855 CAGGACGCCTCCAGCTCCCAGGG - Exonic
1147934044 17:44001442-44001464 CTGTAGGCCTTCAACTCAGAGGG + Intronic
1148636989 17:49156551-49156573 CTGGAGGCCTGGAGGACACAGGG - Exonic
1148735821 17:49864389-49864411 CAGGAGCCCTCCAGCTTACAGGG - Intergenic
1150208558 17:63428256-63428278 CTGGAGGCCCACTGCTTCCAGGG + Intergenic
1151476680 17:74348078-74348100 CGGGAAGCCGACAGCTCCCAAGG + Intronic
1157037602 18:43994414-43994436 CTGCAGGAATACAGCTCACCAGG - Intergenic
1158980521 18:62756278-62756300 CTAGAGGGCTTCAGCTCACTTGG + Intronic
1159604181 18:70457944-70457966 CTGGAGTCCTGCAACTCAGAAGG + Intergenic
1162477906 19:10911943-10911965 CCGGAGGCCTGCAGGCCACAGGG + Intronic
1162738981 19:12763221-12763243 CTGGCTTCCTCCAGCTCACATGG - Exonic
1163897151 19:20069149-20069171 CTGGATGTGTACAGGTCACAGGG + Intergenic
1164348724 19:27303787-27303809 TTGGAGGCCTGCAGCTGAAAAGG + Intergenic
1165072852 19:33265513-33265535 CTGGAGGCCAGCAGCACAGAGGG + Intergenic
1165448998 19:35871606-35871628 CTACAGGCCTGCAGCTCCCAGGG + Exonic
1167748105 19:51364607-51364629 TTGGAGTCCTACAGCTCCCTGGG - Intronic
925015933 2:524037-524059 CTGGAGCCCCTCAGCCCACATGG - Intergenic
928094814 2:28397972-28397994 CTAGAGGCCTGCAGGACACAGGG - Intronic
929077923 2:38093705-38093727 CTGGAGGGAGTCAGCTCACAGGG - Intronic
929831259 2:45348590-45348612 CTGGAGGCCCTCAACTCACAGGG - Intergenic
930036513 2:47088917-47088939 CAGGGGGCCTGCATCTCACAAGG + Intronic
930169078 2:48232570-48232592 CCGCAGGCCAACAACTCACAAGG + Intergenic
932834252 2:75020600-75020622 CTGCTGGCCTGCAGCTCCCACGG - Intergenic
935255256 2:101304527-101304549 CTCAAGGCCTACACCTCTCATGG + Intronic
936158782 2:110068854-110068876 CTGCCAGCCCACAGCTCACAGGG - Intergenic
936185878 2:110302478-110302500 CTGCCAGCCCACAGCTCACAGGG + Intergenic
942752663 2:179305556-179305578 CTGGAGGTCCACAGCACATAGGG - Intergenic
944202452 2:197122021-197122043 CTGGAGTCCGACACCTCACCAGG + Intronic
947921115 2:233875205-233875227 CTGCAGGCTTACAGTTCACCAGG + Intergenic
948776760 2:240293224-240293246 CTGGAGGCCTGCAGTGCCCAGGG + Intergenic
949073144 2:242038913-242038935 CTGGATGCCTCCAGCCCACCTGG - Intergenic
1168941426 20:1714711-1714733 TTGGAAGCCTAAAACTCACAGGG + Intergenic
1169230240 20:3883471-3883493 CTCCAGGCCCACAGCTCCCAGGG - Intergenic
1173812600 20:45965490-45965512 CTGGAGGCCTGCAGGTGACCCGG + Intronic
1173948109 20:46967842-46967864 CTGGAGGCCTCCAATACACAAGG - Intronic
1175195068 20:57237378-57237400 CTGGAGGGCTACAGCTCATCTGG + Intronic
1175608780 20:60332922-60332944 CCTGAGGCCTAAAGCACACAAGG + Intergenic
1176038635 20:63052594-63052616 CTGGAGTCCTGGAGCTCAGAGGG + Intergenic
1181875916 22:25940719-25940741 CTGGAAGCCTGGAGTTCACAGGG - Intronic
1183868031 22:40719684-40719706 CTGGAGCCCTCCTGCGCACATGG - Intergenic
1183983335 22:41555429-41555451 CTGGAGGCCTATGGCCCAGAGGG + Intergenic
1184278201 22:43422382-43422404 CTGGAGGCCTACAGCTCACAGGG - Intronic
1185110533 22:48897853-48897875 CTGGAGGCCCACATGTCACCAGG - Intergenic
950408599 3:12820018-12820040 CTGGAGGCTCACAGATCAGAAGG - Intronic
954641991 3:52106224-52106246 CTGGAGGTCCACAGTCCACACGG + Intronic
959950329 3:112174350-112174372 CAGGGGGCCAAAAGCTCACAGGG + Intronic
961724708 3:128919832-128919854 CTGGAGGCCTAGAGGTACCAGGG - Intronic
961821569 3:129578067-129578089 CTGGGGGCCAACAGCTGCCAAGG - Intronic
964691555 3:159455331-159455353 CTGGAGGACTTCAGCTAACTGGG + Intronic
968292245 3:197547731-197547753 CTGGAGGCCCCTAGCTCACTGGG + Intronic
971416845 4:26439628-26439650 CTCGATCCCTACAGTTCACAGGG - Intergenic
975210756 4:71697252-71697274 CTGAAATCCTGCAGCTCACATGG - Intergenic
982100229 4:151960059-151960081 CTGGATGTCAAGAGCTCACAGGG - Intergenic
982600655 4:157444224-157444246 CTGAAGGACTGCAGATCACAAGG - Intergenic
984015534 4:174421563-174421585 CTGCAGTCCTAGAGCTCTCATGG - Intergenic
984670848 4:182485753-182485775 TTGGATCCCAACAGCTCACATGG - Intronic
985153866 4:186968831-186968853 CTGGACGCCAACATTTCACATGG + Intergenic
985813722 5:2111070-2111092 CTGGAGGCAGACAGCTCACTGGG + Intergenic
988297969 5:29390710-29390732 CCGGAGGCCTACAGATGAGAGGG - Intergenic
994280134 5:97891903-97891925 CTAGAGGCCTACAGACTACAAGG - Intergenic
996388486 5:122934198-122934220 CTGGAGGCCGCCACCTCACGAGG + Intronic
996912543 5:128671279-128671301 CTGGATGTGTACAGGTCACAGGG + Intronic
999796409 5:154993648-154993670 TTTGAGGCCTAAAGCCCACAGGG + Intergenic
1001246799 5:170111066-170111088 AAGGAAGCCTACAGCTCAGAGGG + Intergenic
1001432443 5:171673590-171673612 CAGGGAGCCTGCAGCTCACAGGG + Intergenic
1002368503 5:178730846-178730868 CTGGGGCCCTCCAGCTCACAGGG - Intergenic
1004270473 6:14190870-14190892 CTGGAGGATTACTGCTCCCAAGG - Intergenic
1007664482 6:43506302-43506324 CTGGAGGGCAACAGCTCATGCGG - Exonic
1009253053 6:61333599-61333621 TTTGAGGCCTACAGCTGAAAAGG + Intergenic
1009257739 6:61435420-61435442 TTTGAGGCCTACAGCTGAAAAGG + Intergenic
1011806607 6:91079612-91079634 CAGGAGGCCACCAGCTCACTTGG - Intergenic
1015106919 6:129547712-129547734 GTGGAGGCTTACAGATCATAGGG + Intergenic
1018027163 6:159815560-159815582 CTGGAGGCAGACAGCACTCATGG - Intronic
1018857306 6:167683917-167683939 CTGGAGGCCTGGAGCTCCAAGGG + Intergenic
1024109838 7:46133947-46133969 ATGCAGCCCCACAGCTCACATGG - Intergenic
1028755239 7:94426568-94426590 CTGAAGGCCTTCAGCTCAGAAGG + Intronic
1029472775 7:100765059-100765081 CTGCGGGCCAACAGCTCACCTGG + Intronic
1029529517 7:101116020-101116042 CTGGTGGCGTACGGCTCACATGG - Intergenic
1032012690 7:128357302-128357324 CAGGAGGCCTATAGCTCTCCTGG + Intronic
1034996136 7:155578266-155578288 CTGCGGGCCCACAGCACACAAGG + Intergenic
1038215119 8:25554891-25554913 CTGGAAGCCAAAAGTTCACAAGG - Intergenic
1039807128 8:41009824-41009846 CTGGAGGCTTAATGCTCACCTGG + Intergenic
1040274121 8:45995060-45995082 TTAGAGGCCTACAGCTGAAAAGG + Intergenic
1041899372 8:62964111-62964133 CTGGATGCCACCAGCTGACATGG + Intronic
1048248048 8:132830948-132830970 CTGGAGGCCGAGAGCTAAGACGG - Intronic
1049183756 8:141237788-141237810 CCTGAGGCCTCCAGCTCACTTGG - Intronic
1049202782 8:141350039-141350061 CTGGATGCCTGCAGTACACAGGG + Intergenic
1050375412 9:4967465-4967487 CTGGATGCCTATACCTTACAGGG + Intergenic
1050783225 9:9365728-9365750 CTGTAGGTCGACAGCACACAAGG - Intronic
1051515060 9:17921298-17921320 CTGAAGCCCTACAGGCCACATGG + Intergenic
1053282105 9:36827079-36827101 ATGGTGTCCCACAGCTCACAAGG + Intergenic
1055633975 9:78256179-78256201 GGGGAAGCCTACAGCTCAGAGGG + Intronic
1056452909 9:86734072-86734094 CTGGAGGCCCAAAGCTCCCTGGG + Intergenic
1058893973 9:109383958-109383980 CTGGAGGCCTCCCCCTCAAAAGG - Intronic
1060968936 9:127727081-127727103 CTGCAGGCCGGCAGCCCACAAGG + Exonic
1061039019 9:128128877-128128899 CTGGGGACCTGCAGCTCTCACGG - Intergenic
1061045129 9:128160665-128160687 CTGGTGACCTGCAGCTCTCACGG - Intronic
1061783415 9:133008674-133008696 CTGGAGCCCTACAACTCAGGGGG + Intergenic
1061826007 9:133258554-133258576 CTGGAAGCCAGCAGCCCACAAGG - Intronic
1062359798 9:136182312-136182334 CTGTAGGGGCACAGCTCACAGGG + Intergenic
1062422986 9:136492972-136492994 CTCGAGGCCTGCAGTTCCCAGGG + Intergenic
1190286140 X:48962566-48962588 CAGCAGGCCTACCCCTCACAGGG + Exonic
1192567509 X:72177711-72177733 CTGAAGGCCAACAGCTCCAAGGG - Intergenic
1194114006 X:89873573-89873595 CTGGAGGCCTAAAGATGACAAGG + Intergenic
1199983346 X:152933227-152933249 CTGGAGGCCCAGCCCTCACATGG + Intronic
1200466746 Y:3528929-3528951 CTGGAGGCCTAAAGATGACAAGG + Intergenic
1201311068 Y:12598512-12598534 CTGGAGGCCTAGAGGCCAGAGGG + Intergenic
1201347781 Y:13004079-13004101 CAGGTGGCCTGCAGGTCACAAGG + Intergenic
1201417058 Y:13757753-13757775 CTGGAGTCCTGCATATCACAGGG + Intergenic