ID: 1184279393

View in Genome Browser
Species Human (GRCh38)
Location 22:43428394-43428416
Sequence CAGGGTGGGCACAGGGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 676
Summary {0: 1, 1: 1, 2: 7, 3: 76, 4: 591}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184279382_1184279393 17 Left 1184279382 22:43428354-43428376 CCAGCTTTGAAACACAACTTTGC 0: 1
1: 0
2: 1
3: 18
4: 206
Right 1184279393 22:43428394-43428416 CAGGGTGGGCACAGGGATGAGGG 0: 1
1: 1
2: 7
3: 76
4: 591
1184279381_1184279393 24 Left 1184279381 22:43428347-43428369 CCGAGCTCCAGCTTTGAAACACA 0: 1
1: 0
2: 1
3: 17
4: 221
Right 1184279393 22:43428394-43428416 CAGGGTGGGCACAGGGATGAGGG 0: 1
1: 1
2: 7
3: 76
4: 591

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184279393 Original CRISPR CAGGGTGGGCACAGGGATGA GGG Intronic
900081992 1:865364-865386 CAGGGTGGGCAGAGAGGAGAGGG - Intergenic
900367525 1:2317360-2317382 CAGGAGGGGCACAGGGAGGTAGG + Intergenic
900370339 1:2329432-2329454 CAGGGAGGGCACTGGGAAGCTGG - Intronic
900534859 1:3171811-3171833 CCGGGTGGCCACAGAGACGAGGG - Intronic
900599993 1:3498823-3498845 CAGGCTGGGGCCAGGGAAGAGGG + Exonic
900718540 1:4160404-4160426 CAGGGCTGGCACAGGGACCATGG + Intergenic
901464572 1:9413115-9413137 CAGGGTGAGGACAGGGCTGCGGG - Intergenic
901638462 1:10681236-10681258 CAGGGTGAGGATGGGGATGAGGG - Intronic
902074809 1:13775860-13775882 CAGGGTGGGTGAAGGGATGGGGG - Intronic
902112964 1:14098600-14098622 CAGTCTGGGCAGAGGGATGCTGG - Intergenic
902408272 1:16198434-16198456 CAGGCTGGACACAGGAATGGGGG - Exonic
902544960 1:17184365-17184387 GGGGGTGGGGACAGGGAGGAGGG + Intergenic
902639408 1:17756975-17756997 CAGGCCGGGCACAGGCATGGTGG + Intronic
903662008 1:24984106-24984128 CTGGGTGGGTTCAGGGATGAGGG + Intergenic
903925367 1:26827392-26827414 CAGGGTGGGGTCAGGGAGAATGG - Intronic
904033556 1:27547651-27547673 CAAGGTGGGTACAGGGCTGCTGG - Exonic
905227235 1:36487219-36487241 CAGGGTGGGTTCAGGGAAGAAGG - Intergenic
905278864 1:36836247-36836269 CATGGTGGGCACTGGGGTCATGG + Intronic
905348405 1:37327566-37327588 AAGGGTGGGCCCAGGGAACATGG + Intergenic
906058260 1:42932259-42932281 CAGGGTGGGGGCAGGGCTGGTGG - Intronic
906095030 1:43217104-43217126 GAGTGTGTGCAGAGGGATGAGGG + Intronic
906176347 1:43776708-43776730 AATGGAGGGCACAGGGAGGAAGG - Intronic
906265278 1:44424304-44424326 GAGGATGGGGACAGGGATGGGGG + Intronic
906535449 1:46548641-46548663 CAGCGTGGACACTGGAATGAGGG - Intronic
906776708 1:48536313-48536335 CAGGGTGCTCACAGGGGTGGAGG + Intronic
907272773 1:53300525-53300547 CAGGGTGGGCACAGCCTGGAAGG - Intronic
907304387 1:53505684-53505706 CAGGGTGGGCACAGGGCTTCTGG + Intergenic
907486028 1:54778725-54778747 CAGTGTGGGAGCAGAGATGAGGG + Intergenic
907801069 1:57766326-57766348 AAGGCTGGGCAGAGGAATGAAGG - Intronic
907919049 1:58895994-58896016 CAGGATGGGCACAGGGCTGGGGG + Intergenic
907925921 1:58955130-58955152 CAGAGAGGGCACCAGGATGAAGG + Intergenic
908565434 1:65351017-65351039 CAGTGTGGACATAGGGATTAGGG - Intronic
908883935 1:68765954-68765976 AAGGGTGGGAGCGGGGATGAGGG + Intergenic
909036970 1:70604408-70604430 CAGTCAGGGCACAGGGATGGTGG - Intergenic
909596696 1:77413818-77413840 CAGGGTTGGGGCAGGGAGGAGGG - Intronic
912190546 1:107334456-107334478 AAGGGTGGGCCAAGAGATGATGG + Intronic
912762744 1:112383467-112383489 CAAGGTGGGAACAGGGAGCAGGG + Intergenic
912948596 1:114105295-114105317 CAGGGGGGGAACAGGGCTGTAGG - Intronic
913547224 1:119881019-119881041 CAGGAAGGGGACTGGGATGAGGG + Intergenic
913556982 1:119977318-119977340 CAGGAAGGGGACTGGGATGAGGG - Intronic
915013634 1:152713169-152713191 GAGGGAGGGCACAGGAATGTTGG - Intergenic
915067602 1:153239491-153239513 CAGGGTTTGCAGAGGCATGAGGG - Intergenic
915146115 1:153796576-153796598 CAGTGTGGGCACTGGGCAGAGGG + Intergenic
915196308 1:154192557-154192579 GAGCTTGGGCACAGGGAAGAGGG + Intronic
915314327 1:155019444-155019466 CTGAGTGGGAACAGAGATGACGG - Intronic
915444431 1:155966788-155966810 CAGGGAGGGCAGAGGGCTGGGGG - Intronic
915626843 1:157119023-157119045 AAGGATGGGCAAAGGGATGAGGG - Intergenic
916046113 1:161000917-161000939 CAGGGTGTGCCCTGGGATAAGGG + Intronic
917002040 1:170370986-170371008 CAGGGTGGGGGGAGGGAGGAGGG - Intergenic
917440622 1:175066072-175066094 CAGGAAGGGTAAAGGGATGAGGG - Intergenic
917514512 1:175696380-175696402 CAGGGTGGGCAGAGAGAAAATGG + Intronic
917697595 1:177542422-177542444 CAGGGTGGAGACTGGGAAGAGGG + Intergenic
919741539 1:200984071-200984093 CAGGGTGGGCCCAGCAATGCTGG + Intronic
919814878 1:201431081-201431103 CAGGCTGGGCACAGGGTGGAGGG - Intergenic
920082282 1:203383554-203383576 AAGGGTGGGTGCAGGGATGATGG + Intergenic
920381526 1:205537171-205537193 CAGGAAGGGCCCAGGGATGCAGG - Intergenic
920916848 1:210264624-210264646 CAGTGTGGGGATAGGGGTGAGGG - Intergenic
924633439 1:245763373-245763395 CAGGGTGGGCAGAGAGCTGTAGG + Intronic
1062836734 10:640657-640679 GAGGGTGCGCGCGGGGATGAGGG + Intronic
1062836753 10:640729-640751 GAGGGTGGGCGCCGGGAAGAGGG + Intronic
1062836760 10:640747-640769 GAGGGTGGGCGCCGGGAAGAGGG + Intronic
1062836767 10:640765-640787 GAGGGTGGGCGCCGGGAAGAGGG + Intronic
1062848812 10:727801-727823 CAGGATATGCTCAGGGATGATGG - Intergenic
1062940201 10:1415107-1415129 ATGGATGGGCAGAGGGATGATGG + Intronic
1063173640 10:3532703-3532725 CAGGGTGGGGACAGGCAGGTGGG - Intergenic
1063898682 10:10709422-10709444 CAGGGTGGGCGTGGGGAGGAAGG - Intergenic
1064240203 10:13620561-13620583 CAGGCTGGGAACAGGCATGAAGG - Intronic
1065895374 10:30158669-30158691 CAAGGTGGCCAGAGAGATGAAGG - Intergenic
1065963866 10:30755048-30755070 CAGGAGGAGCACAGGGATGGAGG - Intergenic
1066502427 10:36007089-36007111 GAGGGTGGGGAAAGGGAGGAGGG - Intergenic
1067046573 10:42988628-42988650 CAGGCTGGGCCCAGGGTGGATGG - Intergenic
1068017573 10:51536791-51536813 CAGGGTGGGGGGAGGGGTGAGGG - Intronic
1069047885 10:63762200-63762222 AAGGGTGGCCACAGGGAAGAGGG + Intergenic
1069605738 10:69737597-69737619 CAGGCTGGGCACAGGGTGGGCGG - Intergenic
1070159652 10:73858531-73858553 GAGGGTGGGCAGAGGGAAGGGGG - Intronic
1070361839 10:75698165-75698187 TGGGGTGGGAACAGGGAGGAAGG - Intronic
1070811885 10:79302219-79302241 CAGGGTGGGGACGGGGGTGAGGG + Intronic
1070828813 10:79406400-79406422 CAGGGGGGTCGCAGGGAGGAAGG + Intronic
1071581489 10:86775436-86775458 AAGGGTGGACACAAGGCTGATGG + Intronic
1072370547 10:94762490-94762512 CAGAGTGGGCACTGGGACGAAGG + Intronic
1073260819 10:102188858-102188880 CAGAGTGGGCACCGGGAGCAGGG + Intergenic
1074141687 10:110679122-110679144 CAAGGTTGGCACTAGGATGAAGG + Intronic
1074568200 10:114600668-114600690 CAGGCAGGGCATAGGAATGAGGG + Intronic
1074757218 10:116632974-116632996 CAGTGTGGGCACAGGGAACGTGG + Intronic
1074763943 10:116686880-116686902 CAGTGTGGGAAGAGGGATGAGGG - Intronic
1075513260 10:123089102-123089124 CAGGGTGGGCTCTGGGGTGGGGG + Intergenic
1075734952 10:124658856-124658878 CAGTGGGGGCACAGGGAGCAGGG - Intronic
1076192674 10:128493897-128493919 CAGTGTGAGCACAGGCCTGAAGG + Intergenic
1076327960 10:129643153-129643175 CAGCATGGGCCCAAGGATGAAGG - Intronic
1076423511 10:130351176-130351198 CAGGGTGGGGGCAGAGATGAGGG + Intergenic
1076857039 10:133122427-133122449 CAGGCTGGGCACGGGGCCGAGGG + Intronic
1076908833 10:133377542-133377564 CTGGGTGGGCACAGCTGTGAGGG - Intergenic
1077092819 11:787436-787458 CAGGGCGGGCACAGCTGTGAGGG + Exonic
1077252575 11:1567125-1567147 CTGTGGGGGCACAGGGAAGATGG - Intronic
1077259322 11:1607383-1607405 CAGGAGGGGCCCAGGGATGTGGG + Intergenic
1077344212 11:2038978-2039000 CATGGAGGGCACAGGGAGGAGGG + Intergenic
1077486185 11:2839333-2839355 CAGGGTGGGGACAGAGGTCATGG - Intronic
1078025891 11:7695389-7695411 CAGGGTGAACTCAGGGTTGAGGG + Intronic
1078081537 11:8207749-8207771 CAGGATAGGGACAGGGATGACGG - Intergenic
1078604306 11:12761638-12761660 GAGGGTGGGCAGAGGGATGATGG + Intronic
1078655875 11:13238575-13238597 GAGGGTGGGCAGCGGGAGGATGG + Intergenic
1079029755 11:16977676-16977698 CAGGTTTGGCACTGGGATGATGG - Intronic
1079279372 11:19073656-19073678 CAGGGTGGCGACAGGGACCAGGG + Intergenic
1080231088 11:30017727-30017749 CAGGGTGGGCCAGGGGCTGAGGG + Intergenic
1080429460 11:32185017-32185039 CAGAGTGGTCACTGGGAAGACGG - Intergenic
1080591006 11:33723186-33723208 CAGGATGGGTTCAGGGATGTAGG - Intronic
1080637895 11:34139501-34139523 CCGGGTGGGGACAGGGAGGAGGG + Intronic
1080691972 11:34565877-34565899 CCTGGTGGGCACAGGGAAGAGGG + Intergenic
1080774125 11:35370021-35370043 CAGTGTGGGCAAAGGCATGAAGG + Intronic
1080852558 11:36082598-36082620 CAGGGTGGTCACAGTCAAGAAGG - Intronic
1081854838 11:46296645-46296667 CGAGGTGGGCCTAGGGATGATGG + Intronic
1082007642 11:47428670-47428692 CAGGTTGATGACAGGGATGAAGG - Intergenic
1082894144 11:58172235-58172257 CTCAGTGGGCACAGGGATGTTGG + Intronic
1083458375 11:62794329-62794351 GAGGGTGGGCACCGGGCTGGAGG + Exonic
1083484315 11:62973859-62973881 CAAGGTGGGACCTGGGATGATGG + Intronic
1083934283 11:65862276-65862298 CAGGGTGAGCACAGGGATCAGGG + Exonic
1084153203 11:67300783-67300805 CAGCCTGGGCCCAGGGAGGAGGG + Intronic
1084444882 11:69197749-69197771 CTGGGTGGCCTCAGGGAAGATGG + Intergenic
1084751318 11:71205896-71205918 CTGGGGGGACACAGGGCTGAGGG - Intronic
1084800240 11:71538883-71538905 CAGGAGGGGCCCAGGGATGTGGG - Exonic
1084932872 11:72570985-72571007 CAGGGTTGGGGCAGGAATGAAGG - Intergenic
1084951222 11:72666652-72666674 CAATGTGAGCACAGGGATGAGGG - Intronic
1086677188 11:89622605-89622627 AACGGTGAGCACAGAGATGATGG - Intergenic
1088187811 11:107193140-107193162 CAGGGTGGGCAGACTGGTGAAGG - Intergenic
1088233331 11:107696628-107696650 AAGGGTGGGCTCAGGGGTGCTGG - Intergenic
1089755290 11:120681746-120681768 CAGGCTGGGAACAGGCAGGAAGG + Intronic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090418211 11:126555568-126555590 CAGGGTAGACACAGGGAGCAGGG + Intronic
1090610642 11:128467552-128467574 GAGGCTGGGCACAGGGATAAGGG - Intronic
1090983834 11:131748556-131748578 GTGGATGGGCACAGGGAGGAGGG - Intronic
1202827198 11_KI270721v1_random:94167-94189 CATGGAGGGCACAGGGAGGAGGG + Intergenic
1091545287 12:1497620-1497642 TAGGCTGGGGACAGGGATGAAGG - Intergenic
1091548269 12:1518855-1518877 CGGGGTGTGAACAGGGGTGACGG + Intergenic
1091568624 12:1665129-1665151 CAGGGCTGGCACAGGGAAGCTGG - Intergenic
1091688547 12:2580595-2580617 CAGGGTGGGCACCTGTGTGAGGG - Intronic
1092230320 12:6772494-6772516 AAGGCCGGGCACAGGGGTGAAGG + Intronic
1093296727 12:17400731-17400753 CATGGTGGGCTCAGCGATGATGG + Intergenic
1095955049 12:47801118-47801140 CTGGCTGGGTCCAGGGATGAGGG - Intronic
1095976956 12:47946517-47946539 CAGGGTGGGCTCAGCCCTGAGGG - Intergenic
1097241765 12:57580573-57580595 CAGGGCGGCCATGGGGATGAGGG - Intronic
1101580970 12:106040493-106040515 CAGGGTGGGCACCAGGAGCAGGG + Intergenic
1101969146 12:109300619-109300641 CAGGGTGTGCCCAGGCGTGATGG + Intronic
1102236812 12:111298774-111298796 CAGGGTGGGCCCAGGGTAGGGGG + Intronic
1102513242 12:113429480-113429502 CAGGGTGGGCAGAGGAAAGTTGG - Intronic
1102516085 12:113447819-113447841 CAGGGTGGCTGCAGGGAAGAGGG + Intergenic
1103037559 12:117668494-117668516 TATGGTGGACACAGCGATGAAGG - Intronic
1103737758 12:123071158-123071180 TAGGGTGGGCAGAGGGCTGCAGG + Intronic
1103781029 12:123398989-123399011 CAGGGTGGGATCAGGGCTGCTGG + Intronic
1103943671 12:124514377-124514399 CAAGGTGGGGACAGGGGTGATGG + Intronic
1104972794 12:132539516-132539538 CTGGGTGGGCACGGGGCTGGAGG - Intronic
1104972942 12:132539938-132539960 CTGGGTGGGCACGGGGCTGGAGG - Intronic
1104972953 12:132539967-132539989 CTGGGTGGGCACGGGGCTGGAGG - Intronic
1104972984 12:132540054-132540076 CTGGGTGGGCACGGGGCTGGAGG - Intronic
1104972995 12:132540083-132540105 CTGGGTGGGCACGGGGCTGGAGG - Intronic
1104973006 12:132540112-132540134 CTGGGTGGGCATCGGGCTGAAGG - Intronic
1105326223 13:19372689-19372711 CAGAGTGGGCCCAGGGGTGGAGG - Intergenic
1105543350 13:21333872-21333894 CAGGGTGTTAACAGGGATGGGGG - Intergenic
1105867283 13:24472380-24472402 CAGAGTGGGCCCAGGGGTGGAGG + Intronic
1106553222 13:30789010-30789032 CTGGGTGGCAGCAGGGATGAGGG + Intergenic
1108002282 13:45915311-45915333 CAGAGTGGGTACAGGGAGCAGGG - Intergenic
1108275140 13:48800718-48800740 CAGGGAGGGAACTGGGAGGAAGG + Intergenic
1108933270 13:55858767-55858789 AAGGATGGGCACAAGGATGCAGG - Intergenic
1109407622 13:61921949-61921971 CAGGGTGGGGAGAGGAAAGAAGG - Intergenic
1109514069 13:63418039-63418061 CAGGGTGGGGAGAGGGGGGAGGG + Intergenic
1110223518 13:73096530-73096552 CAGGGTCGGCAAAGGGACAAGGG + Intergenic
1112175430 13:97018771-97018793 CAGGGTGAGCACAGGGCCCAGGG - Intergenic
1113138147 13:107116839-107116861 CAGGGTGGGCAGAAGGCAGAGGG + Intergenic
1113376837 13:109772130-109772152 GAGGGTGGCCACTGAGATGACGG + Intronic
1113565180 13:111315568-111315590 CAGGGCGGGGCCAGGGAGGAGGG - Intergenic
1113574720 13:111387111-111387133 CAGGGTGTCCACAGTGATGGTGG + Intergenic
1113604560 13:111596058-111596080 CAGGGCTTGCACAGGGATGTAGG + Intronic
1113947354 13:114051639-114051661 CAGTGTGGGCACAGGAAGGGCGG - Intronic
1114257129 14:21012645-21012667 CAGGATGGGAAAAGGGATGAGGG + Intergenic
1114287946 14:21262985-21263007 CAGTGTGGGGAAGGGGATGAGGG + Intronic
1114443553 14:22770504-22770526 CAGGCTGGGCACAGGAAGGTTGG - Exonic
1114566994 14:23639954-23639976 CTTGGTGGGCACAGGCATGCTGG - Intronic
1115734539 14:36310436-36310458 CAGGGTAGGTCAAGGGATGATGG - Intronic
1117547508 14:56805309-56805331 GAGGGTGGGCATGGGGAAGAGGG + Intronic
1119399088 14:74349641-74349663 CTGGGTGGGCCAAGGGATGGAGG - Intronic
1119424572 14:74527384-74527406 CAGCGTGAGCTCAGGGAGGAGGG + Intronic
1119730383 14:76947463-76947485 CAGGGTGGGGGCAGGGGCGAGGG - Intergenic
1119942506 14:78656406-78656428 CAGGGTGAGCAAAGGCATGGAGG + Intronic
1120013727 14:79446615-79446637 CAGGGAGGGGGCAGGGAGGAGGG - Intronic
1120733456 14:88027891-88027913 CAGGGTGGCCCCAGGGAAGGAGG + Intergenic
1121261562 14:92570011-92570033 CAGGGATGGCACAGGAAGGAAGG - Intronic
1121489128 14:94345535-94345557 CATGGTGGGAAGAGGGAAGAAGG - Intergenic
1121560774 14:94873716-94873738 CAGGGGTGGGACAGGGATGTGGG + Intergenic
1121620512 14:95344580-95344602 CAGGGTGGAAACAGGAAGGAGGG + Intergenic
1121690392 14:95874163-95874185 CTGTGTGGCCACAGGGATCATGG + Intergenic
1121823948 14:96995129-96995151 CAGGCTGGGCAGTGGGATGGAGG + Intergenic
1122116020 14:99527679-99527701 CTGGGTGGGCACTGGGCTGAGGG - Intronic
1122122970 14:99564386-99564408 CAAGGTGGGCACAGGCATATGGG - Intronic
1122502629 14:102211445-102211467 CACGATGGGCACAGGGTGGATGG - Intronic
1122718828 14:103710924-103710946 CAGGGTAGGCAAAGGAAGGAAGG + Intronic
1122767740 14:104083402-104083424 CATGGTGCTCACAGGGATGCAGG + Intergenic
1123121818 14:105920276-105920298 CAAGGTGTGAACAGGGAGGATGG - Intronic
1123223227 14:106875710-106875732 CAGGGTGGGGGCAGGGCTGCAGG - Intergenic
1202904165 14_GL000194v1_random:59099-59121 CGAGGTGGGGACAGGGATGGTGG - Intergenic
1202904297 14_GL000194v1_random:59616-59638 CAGGCTGGGCACAGTGGGGAGGG + Intergenic
1123404513 15:20011927-20011949 CAAGGTGTGAACAGGGAGGATGG - Intergenic
1123513846 15:21018574-21018596 CAAGGTGTGAACAGGGAGGATGG - Intergenic
1123937103 15:25199315-25199337 CAGGGTGGGCACCTGGCTGATGG - Intergenic
1124375008 15:29124211-29124233 CAGGCTGGACACTGGGCTGAGGG + Intronic
1124627092 15:31314419-31314441 CAGGGAGATGACAGGGATGATGG - Intergenic
1124873438 15:33566690-33566712 CAGGAAGGCCACATGGATGATGG + Exonic
1125798801 15:42425948-42425970 CAGGGTTGGCTGGGGGATGAAGG - Intronic
1125885196 15:43224170-43224192 CCGCGTGGACACAGGGAAGAGGG - Intergenic
1126194991 15:45921882-45921904 TAGGGTGGGAACAGGGCAGATGG - Intergenic
1127385054 15:58460399-58460421 CAGGGTGGGCACAGTTAAGGTGG + Intronic
1127840913 15:62830804-62830826 CTGGGATGGCACAGGGATGGAGG - Intronic
1127962971 15:63903603-63903625 CAAGGTGGGCACTGGGCTGTTGG - Intergenic
1128139162 15:65286674-65286696 GAGGTTGGGCCCAGGGATAAAGG + Exonic
1128157784 15:65402523-65402545 CAGGGGGGCCACAGGGAGGGTGG + Intronic
1128623415 15:69173421-69173443 AAGGGTTGGCACATGGAAGAAGG + Intronic
1128671016 15:69574866-69574888 GAGCGTGGGCACAGCCATGAAGG - Intergenic
1128793679 15:70450087-70450109 ATGGGTGGACAGAGGGATGAGGG + Intergenic
1128893246 15:71349843-71349865 CAGTGTGGGCCCAGGGAAGGGGG + Intronic
1129727182 15:77907314-77907336 CAGGGTGGCCATGGGGATCAAGG + Intergenic
1129867687 15:78921988-78922010 CAGGCTGGGCACAGAGGTGAGGG + Exonic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1132462572 16:62715-62737 CAGGGTGGACACAGGCAGGAAGG + Intronic
1132553547 16:563318-563340 CCGCGTGGGCACAGGGGCGAGGG + Exonic
1132608163 16:802085-802107 CAGGGCGGGCACTGGGATCAGGG - Intergenic
1132896104 16:2230076-2230098 GAGGGTGGGTACAGGGTGGACGG + Intronic
1133441011 16:5820938-5820960 CAGGGAGGGCACTGTGATGAGGG - Intergenic
1133639829 16:7706008-7706030 CAGGATGTCCACAGGAATGATGG - Intronic
1133848566 16:9480123-9480145 GAGGGTGAGCACTGGGGTGATGG + Intergenic
1134452794 16:14373690-14373712 CAGGCTGGGCTCAGGGTTCACGG - Intergenic
1134815001 16:17198474-17198496 CAGAGAGGGGACAGGGGTGAGGG - Intronic
1135671141 16:24376623-24376645 CATGGTGGGGAGAGGGAAGAAGG - Intergenic
1135732882 16:24909041-24909063 CACGGTGGAGACAGTGATGAGGG - Exonic
1135967658 16:27049282-27049304 ATGGGTGAGCACAGGGATGTGGG - Intergenic
1135992799 16:27228213-27228235 CTGGGTGAGCACAGGAAGGAAGG + Intronic
1136035979 16:27540798-27540820 GAGTGTGTGCACAGGGATTAGGG + Intronic
1136111587 16:28066832-28066854 CAGTGTGGGGACAGGCATGGTGG + Intergenic
1136186377 16:28591098-28591120 CAGGGCTGGCAAAGGGATGGTGG - Intronic
1136552652 16:30989819-30989841 AGGGGTGGGAACAGGGAGGAGGG + Exonic
1136616963 16:31404212-31404234 CAGGGGGTGCGCAGGGGTGAGGG - Intronic
1136902285 16:34051565-34051587 CATGGTGGGAACTGGGATGGAGG + Intergenic
1136957764 16:34804315-34804337 CATGGTGGGAACTGGGATGGAGG + Intergenic
1137430202 16:48412401-48412423 CAAGGTGGGAAGAGGGCTGAAGG - Intronic
1137874789 16:51985856-51985878 CTGGGTGGGCATGGGCATGAGGG - Intergenic
1138832754 16:60395031-60395053 CAGGGTGGGCAGAGAGATGGTGG - Intergenic
1141163913 16:81647816-81647838 CAGGGTGGCCACAGGGATGAGGG - Intronic
1141648238 16:85378702-85378724 CAGGGCAGGCACAGGGCTGCAGG - Intergenic
1141754811 16:85983922-85983944 CGGGGTGGTCACAGGCATGATGG + Intergenic
1141757035 16:85998143-85998165 CAGGGGTGGCAGAGGGAGGAGGG - Intergenic
1142187471 16:88701359-88701381 CAGAGTGGGCACAGCGGGGATGG + Exonic
1142261149 16:89042970-89042992 CTGAGTGGGCCCAGGCATGAGGG + Intergenic
1143016093 17:3892102-3892124 CAGGGCGGGCACAGGAGTGTGGG - Intronic
1143407893 17:6690240-6690262 CTTGGTGAGCACAGGGATAAGGG - Intronic
1143496525 17:7315694-7315716 AAGGGTGGGCGCACGGAAGATGG - Exonic
1145001779 17:19310343-19310365 CAGGGTGGGCGCAGGGATGCAGG + Intronic
1145207968 17:20994751-20994773 CAGGGTGGGTGCTGGGATGCTGG - Intergenic
1145815430 17:27791948-27791970 CAGGGTGGGTGCTGGGGTGAGGG - Intronic
1145877110 17:28327319-28327341 GAGGGTGGGCAAAGGGGTGTGGG + Exonic
1145987603 17:29057639-29057661 CAGGGTGGGTGGAGGGGTGAGGG + Intergenic
1146390120 17:32414379-32414401 CAGGGTGGGTACAGGGAGAATGG - Intergenic
1146483798 17:33227294-33227316 CAGGGTGGCCACATGGAGAAGGG - Intronic
1146793312 17:35765011-35765033 CAGGTTTGTCAGAGGGATGAGGG - Exonic
1148217416 17:45840565-45840587 GGGGGTGGGCACAGGGATGGGGG + Intergenic
1148682227 17:49481043-49481065 CAGAGTGGGCAGAGGGGTGAAGG + Intergenic
1148703454 17:49606452-49606474 CAGGCTGGGCACAGTGGTGCTGG - Intronic
1148864996 17:50623783-50623805 CTGGGAGGGCACGGGGGTGAGGG + Intronic
1149010427 17:51850975-51850997 CAGGGCAGGCACTGGGAAGAAGG - Intronic
1150201606 17:63362726-63362748 CAGAGTGGGCACTGGGAACAGGG + Intronic
1150431342 17:65120224-65120246 CAGGGTGGTCAGTGGGATGGAGG + Intergenic
1150483517 17:65528517-65528539 CAGGGTGGGAACAGGGCCGAGGG - Intergenic
1150608501 17:66714365-66714387 AACGGTGGGCACAGGCCTGAGGG - Intronic
1150859864 17:68790380-68790402 TAGGGTGGGGAGAGGCATGAGGG + Intergenic
1151360108 17:73583714-73583736 CAGGGTGAGCACACGGGTGGTGG + Intronic
1151447220 17:74175195-74175217 CAAGGTGGGCACAAGGATGTTGG - Intergenic
1151576241 17:74953895-74953917 AGGGATGGGCACAGGGATGGGGG - Intronic
1151579760 17:74971468-74971490 CAGGGTGGGGAAAGGGGTGAGGG + Intronic
1151615363 17:75206673-75206695 CAGGGTAGGTAGAGGGATTATGG + Intronic
1151717106 17:75836527-75836549 CTCGGTGGGGTCAGGGATGAGGG - Intronic
1151760819 17:76101792-76101814 CTGCTTGTGCACAGGGATGATGG + Exonic
1152065885 17:78112355-78112377 GGGGGTGGGCACAGGGATTCGGG - Exonic
1152185681 17:78855138-78855160 CATGGTGGGCACCGGGGCGATGG + Exonic
1152238374 17:79149948-79149970 CAGGGTGGGGATGGGGATGGGGG + Intronic
1152573302 17:81129775-81129797 CAGGGTCAGCACAGGGCTCAGGG + Intronic
1152854875 17:82659007-82659029 CAGGGAGGGCCCAGGGTTGCTGG + Intronic
1152881045 17:82815452-82815474 CAGGGTGGGAACTGGGGTGGAGG + Intronic
1152941005 17:83172908-83172930 CTGGGTGAGCACTGGGGTGAGGG + Intergenic
1153354575 18:4121310-4121332 CAGGATGGGCAAGAGGATGAAGG + Intronic
1154005775 18:10526242-10526264 GAGGGAGGGCTCAGGGCTGAGGG + Intronic
1154493681 18:14940366-14940388 CAGAGTGGCCACAGGGATAGAGG + Intergenic
1155269418 18:24125177-24125199 CAGGGTGGGGCCAGGCATGGTGG - Intronic
1155389755 18:25322382-25322404 CATGGTGGGGAAAGGGAAGAAGG - Intronic
1155918322 18:31577782-31577804 GAAGGTGGGCACAGGCATGTGGG + Intergenic
1156030255 18:32704842-32704864 CACAGTGGGCTCTGGGATGAAGG - Intronic
1156306745 18:35884728-35884750 CAGGATGGGCACATGGCTTAAGG - Intergenic
1156411243 18:36829497-36829519 CAGGGTGGGCAGAGGGACCTCGG - Intronic
1156575825 18:38313932-38313954 CAGGGTGGGAGGAGGGGTGATGG - Intergenic
1156733357 18:40223149-40223171 CAGGTTTGGCACAGGGAACAGGG - Intergenic
1157299214 18:46467640-46467662 CAGGCTGGGCACAGCAATCAGGG + Intergenic
1157546323 18:48549146-48549168 CAGGGTGCACATAGGGGTGATGG + Intronic
1158723339 18:59945635-59945657 AAGCGTGGGGACAGGCATGAAGG + Intergenic
1160142947 18:76341651-76341673 CAGGATGGGAACTGGGCTGAAGG - Intergenic
1160663866 19:313778-313800 CAGGAGGAGCACAGGGATGGCGG - Intronic
1160820889 19:1057238-1057260 CAGGGTGGGAACAGGGCTGAGGG + Intronic
1161236660 19:3201635-3201657 CGGGGTGGGCAGGGGGATGGGGG + Intronic
1161284908 19:3463944-3463966 CTGGGGGGGCACGGCGATGAGGG - Intronic
1161770848 19:6230027-6230049 CAGGGTGGGCGCAGGGCTGGTGG - Intronic
1161849573 19:6731525-6731547 GAGGGTGGGCACAGAGAGGGCGG + Intronic
1162029131 19:7909862-7909884 CGGGGTGTGAACAGGGTTGACGG - Exonic
1162141828 19:8589774-8589796 CCGGGTGGGGACAGGGCTCAGGG + Intronic
1162174616 19:8822067-8822089 GAGGCTGGGAACAGGGAAGACGG + Exonic
1162327107 19:10005986-10006008 CTGGGTGGGCAGAGGGAACAAGG + Intronic
1163290552 19:16376737-16376759 CAGAGTGGCCACAGGGCTGCCGG + Intronic
1163437047 19:17302187-17302209 CAGGGTGTCCACAGGGAAGGTGG + Intronic
1163476078 19:17526937-17526959 CAGGGTAGGCACAGTGCTGGTGG + Intronic
1163801443 19:19368155-19368177 CAGTGGGGGCAGAAGGATGATGG - Intergenic
1164650151 19:29885633-29885655 CAGGTAGGTCACAGAGATGAAGG - Intergenic
1164670103 19:30067574-30067596 CAGGCTGGGCAGAGGGATCCTGG + Intergenic
1164715259 19:30386127-30386149 CAGCGTAGGCAAAGGGCTGAGGG - Intronic
1164918905 19:32073890-32073912 AAGGGTGGGGTCAGGGAAGATGG + Intergenic
1165311851 19:35033342-35033364 CAGGGAGGGCACAGGGGTGGGGG - Intronic
1165346221 19:35250055-35250077 CAGGCTGGGAAGAGGGATGGCGG + Intronic
1165554300 19:36616901-36616923 CAGGGTGGACAGAGGGATGGAGG + Intronic
1166034619 19:40158782-40158804 AAGGGTGGCCACAGGGATTCAGG + Intergenic
1166192335 19:41183310-41183332 CAGGATGAGCAGTGGGATGAGGG + Intergenic
1166342353 19:42146305-42146327 CAGGGTGGGCAAGGGTTTGAGGG - Intronic
1166643430 19:44513329-44513351 CGGGCTGGGAGCAGGGATGAGGG - Intronic
1166657455 19:44622772-44622794 CAAGGTGGGCATAGAGAGGAGGG - Intronic
1166748954 19:45155679-45155701 CAGGCTGGCCACAGGGGTGGGGG + Intronic
1166856271 19:45783965-45783987 CATGCTGGGGACAGGGATGAGGG + Exonic
1166866149 19:45838605-45838627 CAGGTTGGGCTCTGGGATGAGGG + Exonic
1166872919 19:45882004-45882026 CAGGGTGGGGCCAGGGTGGAGGG - Intergenic
1166976902 19:46610108-46610130 AAGGGTGGGGAGAGGGAAGATGG + Exonic
1167052145 19:47085751-47085773 CTGGGTCGGGACAGGGATGAAGG + Intronic
1167077418 19:47257892-47257914 CAGGATGAGCACAGGGAGGTGGG + Intronic
1167153415 19:47723131-47723153 CAGGGTGGGCAGGGGGATCCAGG - Intronic
1167351533 19:48978063-48978085 CTAGGAGGGCACAGGGCTGAGGG + Intronic
1167606152 19:50482045-50482067 CACGGTGGGGACCGGCATGAGGG - Intronic
1168126533 19:54286410-54286432 CAGGGTCTGCACTGGGCTGAGGG + Intergenic
1168175360 19:54624453-54624475 CAGGGTCTGCACTGGGCTGAGGG - Intronic
1168284287 19:55322688-55322710 CTGGGTGAGCTCAGGGAAGAAGG + Exonic
1168287575 19:55342208-55342230 CAGGGGGGGCACAGGGCTGGGGG - Exonic
925079932 2:1056040-1056062 CAGAGTGGACACAGGGAGAAGGG + Intronic
925333650 2:3077544-3077566 CAGGGAGGTCGCAGGGATGGCGG - Intergenic
925900433 2:8505486-8505508 GGGGGTGGGCACAGCGATGCGGG - Intergenic
926148526 2:10411655-10411677 CAGGCTGAGCACTGGGATGCCGG - Intronic
926488643 2:13495864-13495886 GAGGGTGGGGAGTGGGATGAGGG + Intergenic
926747013 2:16167095-16167117 CCAGGTTAGCACAGGGATGAGGG + Intergenic
927856286 2:26529847-26529869 CGAGGTGGGCACAGGGCGGAGGG + Intronic
927889852 2:26741503-26741525 GAGTGTGAGCACAGGGCTGATGG + Intergenic
928316815 2:30252813-30252835 CAGGGCTGGCAGAGGGAGGAAGG + Intronic
929546232 2:42856713-42856735 CAGGGTGGTTACAGGGTGGAGGG - Intergenic
931064689 2:58572104-58572126 CAGGAGGGGCAAAGGGAAGATGG - Intergenic
932400260 2:71475602-71475624 CAGAGTGGGCACAGAGGGGAGGG + Intronic
932456523 2:71852945-71852967 CTGGATGGGCACAGGGCTGGGGG - Intergenic
934151611 2:89152877-89152899 CAGGATGGGAGCAGGGATTAAGG - Intergenic
934215649 2:90029029-90029051 CAGGATGGGAGCAGGGATTAAGG + Intergenic
934502344 2:94870781-94870803 CAGGCTGGGCACAGCGGGGAGGG - Intergenic
936472522 2:112811685-112811707 CAGGGAGGCCACAAGGCTGATGG + Intergenic
937016493 2:118610893-118610915 GTGGGTGGGCACAGGGAGGGAGG - Intergenic
937469396 2:122162383-122162405 CAGGGTGAGCCTCGGGATGAAGG + Intergenic
938248919 2:129798809-129798831 CAGGGAGGACACAGGGAGTAAGG - Intergenic
938299308 2:130198853-130198875 CTGGGTGGGAACAGGGAAGAGGG - Intergenic
938436226 2:131285154-131285176 CAGGGTGGGCAGTGGGGTGCAGG + Intronic
938457407 2:131475684-131475706 CTGGGTGGGAACAGGGAAGAGGG + Intronic
938518098 2:132037564-132037586 CATGGTGGGAACTGGGATGGAGG - Intergenic
938558325 2:132446820-132446842 GATTGTGGGGACAGGGATGAAGG + Intronic
938932690 2:136100584-136100606 CACGCTGAACACAGGGATGAAGG + Intergenic
939107389 2:137964711-137964733 CAGGCTGGGCACAGGGATAAGGG + Intronic
940005238 2:149003946-149003968 CAGGGTGGGCGCAGGTGTTAAGG + Intronic
940169826 2:150816322-150816344 GAGGTTGGGGTCAGGGATGAAGG + Intergenic
940183224 2:150956991-150957013 CAGGGTGAGAACAGGAAAGAAGG - Intergenic
942447647 2:176088589-176088611 CCGGCAGGGCAAAGGGATGAAGG - Intergenic
942919661 2:181356380-181356402 CAGTGTGGGTTCAGGGATGGGGG - Intergenic
943761252 2:191611888-191611910 AAGTGTGTGCACAGGGATGGCGG + Intergenic
943927424 2:193803071-193803093 CAGGGTGAGCGCAGGCAAGATGG + Intergenic
946037348 2:216754707-216754729 GTGGGTGGGCAGAGGGATGTAGG + Intergenic
946154159 2:217796284-217796306 CAGGAGGGGCAGAGGGATGGCGG - Intergenic
946315488 2:218908842-218908864 GACCGTGGGCACAGGGTTGAAGG + Intergenic
946965362 2:225031441-225031463 CAATGTGGGCACAGGGCCGAAGG + Intronic
947435586 2:230069300-230069322 CAGGGTGGAAACAAGAATGAGGG - Intergenic
947524399 2:230869557-230869579 CAGGCTGAGAACAGGGAAGATGG - Intronic
947864502 2:233386890-233386912 CAGGAAGGGCACAGTGAGGATGG + Intronic
947874195 2:233457718-233457740 CAGGGCAGGCACATGGAGGATGG + Intronic
948218931 2:236253902-236253924 CTGGGTGGGTGCAGGGATGCCGG + Intronic
948355284 2:237372732-237372754 TAGGGTGGGCTCAGAGAGGATGG + Intronic
948453457 2:238093013-238093035 CAGGGTGGGAAGAGGGTTGGAGG - Intronic
1168793569 20:596195-596217 AAGGGTGGGCCCAGGGCTCAGGG - Intergenic
1169422643 20:5472182-5472204 CAGGGTGGGCACAGTGACCAGGG + Intergenic
1169426827 20:5503600-5503622 CAGGGTGGGCACAGTGACCAGGG - Intergenic
1170451552 20:16489114-16489136 CAGGAGGGGCAAAGGCATGAGGG + Intronic
1171946386 20:31381961-31381983 GTGGGTGGGGACAGGGAAGAGGG + Intronic
1172230850 20:33334499-33334521 GAGGGTGGGCAGATGGATGGTGG + Intergenic
1172487135 20:35305084-35305106 CAGGGAGGGCAGAGTGCTGAAGG - Intronic
1172880506 20:38196679-38196701 CACAGAGGGCACAGGGAGGAAGG - Intergenic
1173259723 20:41422878-41422900 CAGTGTGGGTTCAGGGCTGATGG - Intronic
1173361569 20:42349336-42349358 CAGTGTGAGCACAGGCATGGAGG - Intronic
1173559539 20:43993091-43993113 CAGGCTGGCCATAGCGATGAGGG + Intronic
1173575872 20:44112768-44112790 CAGGGTGGGAAGAGGGGTTAAGG - Exonic
1173619217 20:44423888-44423910 CAGTGTGGGCACAAGGATTCAGG - Intronic
1174299180 20:49569127-49569149 CAGGGTGGGAATGGGGATGGTGG - Intergenic
1174451589 20:50624192-50624214 CAGGGAGGGCAAGGGGAAGAGGG - Intronic
1175727940 20:61332241-61332263 CAGGGTGGGCGGAGCGGTGACGG + Intronic
1175890560 20:62314063-62314085 GCGGGTGGGCACAGAGACGAGGG + Intronic
1175933394 20:62503891-62503913 CAAGGTGGGCACAGGCACCAGGG + Intergenic
1175974216 20:62702285-62702307 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1175974240 20:62702355-62702377 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1175978198 20:62724077-62724099 CAGGCCTGGCACAGGGTTGAGGG + Intronic
1176026342 20:62987515-62987537 AGGGGTGGGCACAGGGGGGATGG + Intergenic
1176075227 20:63245284-63245306 CAGGGTGGGAGCAGCGGTGAGGG + Intronic
1176376581 21:6089684-6089706 CATGGCAGGCACAGGGTTGAGGG - Intergenic
1176583432 21:8550949-8550971 CGTGGTGGGAACTGGGATGAAGG + Intergenic
1176623532 21:9073866-9073888 CGAGGTGGGGACAGGGATGGTGG - Intergenic
1176623670 21:9074383-9074405 CAGGCTGGGCACAGCGGGGAGGG + Intergenic
1178007243 21:28235179-28235201 CAGGGTGGTCACAGGGGTGTAGG + Intergenic
1178319590 21:31595205-31595227 CCGGGAGGGGACAGGGATGCTGG + Intergenic
1179418456 21:41216876-41216898 GACAGTGGGCACAGGGAGGAAGG + Intronic
1179439477 21:41382971-41382993 CAGGAGAGGCACAGGGGTGAGGG + Intronic
1179640614 21:42745228-42745250 CGGGGTGGGCGCAGGGAGGAAGG + Intronic
1179654677 21:42837787-42837809 CAGGGTTGGCAGAGGGCGGAGGG - Intergenic
1179746894 21:43448560-43448582 CATGGCAGGCACAGGGTTGAGGG + Intergenic
1179785604 21:43728128-43728150 CAGGGGTGGGTCAGGGATGAGGG + Intronic
1180011435 21:45053995-45054017 CTGGGTGGGAACAGGGGTCAGGG + Intergenic
1180078573 21:45475664-45475686 CTGGCTGGGGACAGGGATGCTGG + Intronic
1180168118 21:46040516-46040538 CAGGCTGGGCGCAGGGACCAGGG + Intergenic
1180266242 22:10527879-10527901 CGTGGTGGGAACTGGGATGAAGG + Intergenic
1181407020 22:22692308-22692330 CAAGGCGGGCACTGGGAGGACGG + Intergenic
1181415004 22:22753073-22753095 CAAGGTGAGCACTGGGAGGACGG + Intronic
1181530517 22:23514536-23514558 CTGGGTGGGCAGAGGGGAGAGGG - Intergenic
1181668738 22:24415777-24415799 GAGGGTGGGCACAGGGGGCATGG - Exonic
1181770126 22:25119181-25119203 CAGGGTGGACACAAGAATGAAGG - Intronic
1182023997 22:27103034-27103056 CAGGGAGGGGGCAGGGAGGATGG + Intergenic
1182476554 22:30579704-30579726 CAGCGTGGGCCCAGGGGTCAAGG + Intronic
1182476967 22:30581670-30581692 CAGTGTGGGTGCAGGGATGGGGG + Intronic
1182497344 22:30718820-30718842 CAGCATGGGAACAGGGCTGATGG + Intronic
1183058212 22:35319837-35319859 CACGGTGGGGAAAGGGATGGTGG - Intronic
1183058607 22:35321845-35321867 CAGGTGGGGCACAGGGAGGATGG + Intronic
1183281351 22:36934296-36934318 CTGGGTGGGCACAGAGATGTGGG + Intronic
1183483627 22:38077931-38077953 CTGGGCGGGCACAGGGCTCAGGG - Intergenic
1183487391 22:38096928-38096950 CAGGGAGGGAAGAGGGAAGAAGG + Intronic
1183588416 22:38766413-38766435 CAGGCTGGGCCCAGGGAAGGGGG + Intronic
1184033074 22:41906064-41906086 CATGCTGGGCACAGGCCTGAGGG - Exonic
1184205469 22:42999698-42999720 CCTGGTGGGCACAGGACTGATGG + Intronic
1184217140 22:43075279-43075301 CAGGGTGAACACAGTGATGTGGG + Intronic
1184279393 22:43428394-43428416 CAGGGTGGGCACAGGGATGAGGG + Intronic
1184333791 22:43841548-43841570 CCTGGGGGGCACAGGGCTGAGGG - Intronic
1184689425 22:46110706-46110728 CAGGGTGGGGTGAGGGCTGAAGG - Intronic
1184982752 22:48105825-48105847 CAGGGAGAGCAGAGGGATGTGGG - Intergenic
1185041285 22:48505733-48505755 GAGGGTGGTCTCAGGGATGCTGG - Intronic
1185250630 22:49799850-49799872 CATGGTGAGGACAGGGCTGAGGG - Intronic
950024425 3:9810491-9810513 GAGGGTGGGCATCTGGATGAAGG + Intronic
950441702 3:13014477-13014499 CAGCGTGGGGGCAGGGGTGAAGG + Intronic
950447328 3:13045797-13045819 CAGGGTGGCCCCAGGGAAGGAGG - Intronic
951624529 3:24645147-24645169 CAGCCTGGGCACAGGGCTCAGGG + Intergenic
951922484 3:27871681-27871703 CTGGGAAGACACAGGGATGAGGG + Intergenic
952165101 3:30739322-30739344 GAGGATGGGCACAGGAAGGAGGG - Intronic
952329971 3:32355823-32355845 CAGCGTGGGCAAAGGTCTGAAGG - Intronic
953386662 3:42510185-42510207 CAGCGTGTGCACAGGCATGGAGG - Intronic
953868978 3:46609755-46609777 CGGGGTGGGCAGAGGGAGCAGGG + Intronic
954285667 3:49617381-49617403 CAGGAAGGGCAGAGAGATGAAGG - Intronic
954396467 3:50295928-50295950 CAAGGTGGGCAGAGGAAAGAAGG - Intronic
954660384 3:52223941-52223963 CAGGGTGGGCACAGCCAAGAAGG + Exonic
954698943 3:52441779-52441801 CAGGGTGAGAACAGGGAGGGTGG - Intronic
954713132 3:52514682-52514704 CAGGCTGGGGAGAGGGATGGAGG - Exonic
955322040 3:57981510-57981532 CAGGGAGGTCCCAGGGTTGAAGG + Intergenic
955695583 3:61632798-61632820 CAGGGAGGGGAGGGGGATGAAGG - Intronic
955918442 3:63929819-63929841 CAGGGCGGGCACAAGGCCGATGG + Intronic
956621005 3:71221494-71221516 AAGGGAGGGCAGAAGGATGAAGG - Intronic
956847338 3:73195671-73195693 CAGGGTGGGGAGTGGGAGGAAGG - Intergenic
958085363 3:88798739-88798761 CATGGTGGGTAGAGGGATGCTGG - Intergenic
960702692 3:120452310-120452332 CAGGGTGGGCCCAGTAATGCAGG - Intergenic
961094207 3:124140794-124140816 CGGGGGGGGCACAGGGAGTAGGG + Intronic
961301568 3:125925263-125925285 CAGGGTGGGCTCGGGGCTGGGGG + Intergenic
961387937 3:126534906-126534928 CCGGCTGGGGACAGGGATGCTGG - Intronic
961387953 3:126534970-126534992 CCGGCTGGGGACAGGGATGCTGG - Intronic
961664255 3:128486392-128486414 CAGGGTGGGCAGAAAGATCAGGG + Intronic
961817343 3:129558001-129558023 AGGGGTGGGCAGAGGGGTGATGG - Intronic
962376545 3:134863101-134863123 CAGTGTGTGCACAGGCATGGGGG - Intronic
962941099 3:140125402-140125424 CCGGGTGGGCATGGGGAGGAGGG + Intronic
965017582 3:163177705-163177727 CAGGGTGGAGAGTGGGATGAGGG + Intergenic
966716579 3:183018734-183018756 CAGAGAGGGAAGAGGGATGAGGG + Intronic
967657855 3:192072855-192072877 CAGGGTGTGGACAGGAAAGAAGG + Intergenic
967807416 3:193728145-193728167 CAGTGTGGGCAAAGGTATGCGGG + Intergenic
967948722 3:194824104-194824126 CATGGTGGGCACAGGGTAGCGGG - Intergenic
967984770 3:195086657-195086679 CTGGGTGGGCACTGGCATGGAGG + Intronic
968585390 4:1413927-1413949 CAGGGTGGGTGCGGGGAGGAAGG + Intergenic
968601050 4:1509483-1509505 CAGGCAGGGCACAGGCATCAGGG + Intergenic
968601481 4:1512007-1512029 CAGAGCGGGCATAGGGAGGAAGG + Intergenic
968886260 4:3335432-3335454 GAGGGTGGGCTTAGGGCTGAGGG - Intronic
969444834 4:7238909-7238931 CAGCGAGGGCACAGGGGTGATGG - Intronic
969519289 4:7666450-7666472 CAGGGTGGGAGGAGGGAGGAAGG - Intronic
969715417 4:8865928-8865950 CAGGGTGGGGACTGGGTTGGGGG + Intronic
971185240 4:24369154-24369176 CAGGGTGAGAACATGGATAACGG + Intergenic
973216058 4:47670667-47670689 CAGCATGGGCACAGGGAGGCAGG + Intronic
973533021 4:51851655-51851677 CAGGTGGGGCACAGGGAGGGAGG + Intronic
974133295 4:57783471-57783493 AAGGGTGGGAGGAGGGATGAGGG - Intergenic
974752651 4:66160767-66160789 CAGGATGGCAACAGGGATGATGG + Intergenic
975299635 4:72774872-72774894 CAGAGTGGGCACTGGGAGCAGGG - Intergenic
979203622 4:118008634-118008656 CTGGGTGGGCACAGGTATTTTGG - Intergenic
979876635 4:125899565-125899587 CAGGGTGGCCAGAGAGATAATGG - Intergenic
981037182 4:140184121-140184143 CAAGAAAGGCACAGGGATGAAGG - Intergenic
981274646 4:142884272-142884294 CCAGGTGGGCCCAGGGGTGAAGG - Intergenic
983784498 4:171715237-171715259 CAGAGTGGGCACCGGGATTGGGG - Intergenic
985422827 4:189801654-189801676 CAGAAGGGACACAGGGATGATGG - Intergenic
985487126 5:158192-158214 CAGGATGGGCAGGGGGAGGAGGG - Intronic
985487145 5:158233-158255 CAGGATGGGCAGGGGGAGGAGGG - Intronic
985487255 5:158552-158574 CAGGACGGGCAGAGGGAGGAGGG - Intronic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
985662670 5:1165103-1165125 CAGGGAGGGCACAGGGCTCTCGG + Intergenic
985930741 5:3055737-3055759 CTGGGTGGGAAAAGGGATGTTGG - Intergenic
986127403 5:4895705-4895727 CATGGTGGGAGCAGGGATAAGGG - Intergenic
986257050 5:6109349-6109371 GAGGGTAGGCACAGGGAATAGGG - Intergenic
986293489 5:6418545-6418567 CAGGGGTGCCACAGGTATGAGGG - Intergenic
986450355 5:7857475-7857497 CAGGGTTGGCCCAGGGAGGGAGG - Intronic
986703913 5:10439826-10439848 CAGGGTGAACACAGAGGTGATGG - Exonic
987638005 5:20570684-20570706 CAGGGCTGGCTCAAGGATGAAGG + Intronic
988737587 5:34038267-34038289 TAAGGTGAGCACAGGGAGGATGG + Intronic
991430265 5:66537299-66537321 CTGGCTGGGAACAGGGTTGATGG - Intergenic
992048844 5:72925549-72925571 CTGGGTGGGCACAGGGTCCACGG + Intergenic
992376930 5:76197496-76197518 TAGGCTGGGGACAGGGCTGAGGG + Intronic
993074128 5:83205806-83205828 CAGGGTGAGAATAAGGATGAGGG + Intronic
993432087 5:87843914-87843936 CAGGGAGGGAACAGTGATGGTGG + Intergenic
993975656 5:94476475-94476497 CATGGTGGGAACAGGGCTCAGGG + Intronic
998441321 5:142164822-142164844 AGGGGTGGGGGCAGGGATGATGG - Intergenic
998516306 5:142757677-142757699 CAGAGTGGGCAGAGGGAGAAGGG + Intergenic
998537549 5:142948547-142948569 CAGCATGGCCACAGGGATGCTGG - Intronic
999307343 5:150528262-150528284 CAAGGAGGGCACACGCATGAAGG + Exonic
999380146 5:151115730-151115752 CATTGTGGGCACATGGATGGGGG - Intronic
1001639746 5:173236066-173236088 CAGGGAGGGCACGGGAAGGAGGG - Intergenic
1001670378 5:173468616-173468638 AGGGGTGGTCACATGGATGAAGG + Intergenic
1001855982 5:175011270-175011292 CAGAGTGTGCACAGGGATGTTGG + Intergenic
1002377021 5:178796104-178796126 CAGGCTGGGCCCAGGGCTGCAGG + Intergenic
1002504281 5:179668263-179668285 AAGGTTGGGAACAAGGATGAGGG - Intergenic
1002635041 5:180603125-180603147 CAGGGCGGGCAGAGGGCTGGAGG - Exonic
1003165093 6:3670592-3670614 CTGGGTGGACTCAGGGCTGAGGG + Intergenic
1003542608 6:7031768-7031790 TAGGGTGAGCACTGGGCTGATGG - Intergenic
1003557650 6:7155200-7155222 CAGGGCAGGCAGATGGATGATGG - Intronic
1003661556 6:8067024-8067046 CAGGGTGGGGACAGGGAGGAAGG - Intronic
1004235165 6:13868564-13868586 CGGGGGGGGCACTGGGGTGAAGG + Intergenic
1006042649 6:31268986-31269008 CAGTGTGGGGACAGGGGTCACGG + Exonic
1006056046 6:31385228-31385250 CAGGGTGGGAACATGCATGCAGG - Intergenic
1006093951 6:31644386-31644408 CAGGGAGGGCAGCTGGATGAGGG + Intronic
1006285430 6:33089796-33089818 AAGGAGGGGCACAGGGATGCTGG + Intergenic
1006335586 6:33418885-33418907 CAGGATGGGGACAGTGGTGATGG + Intergenic
1006351444 6:33524196-33524218 CAGGGAGGGGAGAGGGCTGAAGG + Intergenic
1006449446 6:34097721-34097743 CCGGGTGGGCACTGAGATGCTGG - Intronic
1006900003 6:37493854-37493876 CAGGCTGTGCACAGGGCTCAGGG - Intronic
1006902241 6:37510727-37510749 CATGGTGTGCACAGGGAGGAGGG + Intergenic
1007038861 6:38702952-38702974 CAAGGTGGGCACAGGACCGAAGG - Exonic
1007239361 6:40413944-40413966 CAGGAAGGGGACAGGGTTGAAGG + Intronic
1007663604 6:43501437-43501459 CAGAGTGGGCTCAGGAAGGAAGG - Intronic
1007725829 6:43915071-43915093 CAGCCTGGGCACATGGAGGAGGG + Intergenic
1007742530 6:44021645-44021667 GAGGGTGTGCAGAGGGATTAGGG + Intergenic
1011629691 6:89311711-89311733 CAGGGCCTGCACAGGGAGGAGGG - Intronic
1012231222 6:96762809-96762831 CAGAGTGGGCACCGGGAGCAGGG + Intergenic
1012543988 6:100395711-100395733 CAGGGTGGGCCTAGTGGTGAGGG - Intronic
1013602545 6:111718593-111718615 CACGGTAGGCACAAGGATGGGGG + Intronic
1014384639 6:120785801-120785823 CAGAGTGGGCACCGGGAGCAGGG - Intergenic
1015121100 6:129702501-129702523 AAGGGTGGGCACAGGACAGAGGG + Intronic
1015763073 6:136685882-136685904 CAAGGTGCTCACAGGGAGGAGGG - Intronic
1016156771 6:140820428-140820450 GAGGGTGTGCACAGGCATGCTGG + Intergenic
1017122690 6:151039232-151039254 CAGTGTTGGCACAGGGAGAAGGG + Intronic
1017492758 6:154958781-154958803 CAGGGTGGGCAGCAGGATGAAGG - Intronic
1018051927 6:160016650-160016672 CAGGGTGTGGTGAGGGATGATGG - Intronic
1019062010 6:169263443-169263465 GAGGGTGGGTGCAGGGATGGAGG - Intergenic
1019183420 6:170207261-170207283 CAGGAGTGGCACAGGGATGAAGG + Intergenic
1019200864 6:170313922-170313944 CACTCTGGACACAGGGATGAGGG - Intronic
1019329455 7:455467-455489 CAGGCCTGGCACAGGGAGGAGGG - Intergenic
1019540432 7:1548767-1548789 CAGGGTGGGGACCAGGCTGAGGG - Intronic
1019621259 7:1993289-1993311 CAGGGAGGGCACAGGGCTTCTGG + Intronic
1019742562 7:2682140-2682162 CAGGCTGGGCACAGGGAGGCTGG + Intronic
1020035078 7:4959469-4959491 CAGGGAGGGCACCGGGAAAAGGG - Intergenic
1021081171 7:16367216-16367238 CACAGTGGGCACAGGGAGCAAGG - Intronic
1021898406 7:25259118-25259140 CAGGATGGCCCTAGGGATGACGG + Intergenic
1021968463 7:25945076-25945098 CAGGGTGTGGGCAGGGTTGAGGG - Intergenic
1022385467 7:29894828-29894850 CAGAGTGGAGACAGTGATGATGG - Intronic
1022564734 7:31386397-31386419 AAGGGTGGGAGCAGGGGTGAGGG - Intergenic
1022909327 7:34884878-34884900 CAGTGAGGGCACAGGCAGGAAGG - Intergenic
1024024402 7:45399100-45399122 AATGGAGGGCACAGTGATGACGG + Intergenic
1024242785 7:47448236-47448258 GAGGGGGAGCACAGGGAGGAGGG + Intronic
1024606860 7:51028699-51028721 CTGCGTGGGCACAGGGGTGGAGG + Exonic
1026149623 7:67776921-67776943 CAGGATGTGCAAAGGGCTGAAGG - Intergenic
1026809568 7:73451529-73451551 CAGACTGGGGAGAGGGATGAGGG + Intronic
1027267355 7:76501678-76501700 CAGAGTGGGCACCCGGAAGAGGG - Intronic
1027319168 7:77001543-77001565 CAGAGTGGGCACCCGGAAGAGGG - Intergenic
1027516677 7:79150137-79150159 CACGGTGGGGACAGGTAAGAAGG + Intronic
1029438682 7:100575877-100575899 AGGGGAGGGCACATGGATGAAGG + Exonic
1029492838 7:100881740-100881762 CAGGGTGGCCCCAGGGCTGAGGG - Exonic
1029804967 7:102986459-102986481 CAGCTTGGGCACAGGGACCATGG - Intronic
1030667351 7:112294069-112294091 CAAAGTGGTGACAGGGATGAAGG - Intronic
1031232909 7:119133553-119133575 CAGGGTGAGCACTGGGAAAAGGG - Intergenic
1031523673 7:122797713-122797735 CAGGGTGGAGGCAGGGAGGAGGG + Intronic
1031643246 7:124191018-124191040 CAGAGGGGGCAGGGGGATGATGG - Intergenic
1031850710 7:126859104-126859126 GGGGGTGGGCACAGGGGTGTGGG - Intronic
1031979392 7:128115042-128115064 CAGGCTGGACACAGGGAGGGAGG - Intergenic
1032070881 7:128805968-128805990 CGGGGTGGGCACAGTGAGTATGG + Intronic
1032658400 7:133955876-133955898 CAGAGTGGGCACTGGGAGCAGGG + Intronic
1033133747 7:138767827-138767849 GATGGTGGGGACAGGGATGAGGG - Intronic
1033290747 7:140080656-140080678 CGGGCTGTGCACAGGTATGATGG + Intergenic
1033503022 7:141972880-141972902 CAGTAGGGGCACAGAGATGAAGG + Exonic
1035260666 7:157659451-157659473 GAGGATGGTCACAGGGATGGGGG + Intronic
1035335447 7:158124988-158125010 CAGGGTGGGAGAAGGGAAGAGGG + Intronic
1035523276 8:292190-292212 CAGGGTGGGCAGAGAGGAGAGGG + Intergenic
1035765948 8:2105526-2105548 CATGGTGGGCACATGGCTGCTGG + Intronic
1035859217 8:3010013-3010035 CAGGATAGGCCCAGGGAAGAAGG - Intronic
1036258488 8:7222829-7222851 CATGGTGGGCAAGGGGAGGAAGG + Intergenic
1036308132 8:7616679-7616701 CATGGTGGGCAAGGGGAGGAAGG - Intergenic
1036310543 8:7681425-7681447 CATGGTGGGCAAGGGGAGGAAGG + Intergenic
1036358988 8:8064680-8064702 CATGGTGGGCAAGGGGAGGAAGG - Intergenic
1037724272 8:21470304-21470326 CAGGATGGTCACAGTTATGATGG - Intergenic
1037776242 8:21837810-21837832 TAGGGTGGGCAGAGGGAAGGAGG - Intergenic
1037920187 8:22800548-22800570 CAGGGTGGGCACAGCAATGAGGG - Intronic
1038241963 8:25818266-25818288 CAGGGTGGGCTCAGGTATCCTGG + Intergenic
1038328702 8:26591113-26591135 CAGAGTAGGAACTGGGATGAGGG - Intronic
1038350234 8:26769973-26769995 CGGGTAGGGCACAGGGAAGAGGG - Intronic
1038455528 8:27669965-27669987 CAGGGTTGGCACAGCTATGAGGG + Intronic
1039474000 8:37829825-37829847 CAGGGTGGGCAGAGGGGTCACGG - Intronic
1039475411 8:37837107-37837129 TTTGGAGGGCACAGGGATGAGGG + Intronic
1039598092 8:38809068-38809090 CAGGCTGGGCAGAGGGCTGAAGG - Intronic
1039988255 8:42466114-42466136 CACAGAGGGGACAGGGATGATGG + Intronic
1040601635 8:48890475-48890497 CACGCTGGGCGCAGGGATGCGGG + Intergenic
1042512993 8:69630959-69630981 CAGGGTGGGGGCAGGGGGGAGGG - Intronic
1043912679 8:85881140-85881162 CAGGGTGGGGACAGGATTGAAGG + Intergenic
1043923726 8:86013341-86013363 GAGGGGGGTGACAGGGATGATGG - Intronic
1044257182 8:90078392-90078414 CAGTATGGGCAAAGAGATGATGG - Exonic
1045287716 8:100806344-100806366 AAGGCTGGGCACAGGGACTATGG - Intergenic
1048573353 8:135672557-135672579 CAGGCTGGGGCCAGGGCTGAGGG - Intergenic
1049069792 8:140347488-140347510 CAGGCTGAGGACAGGGCTGAAGG - Intronic
1049392975 8:142381504-142381526 CAGGGTGGGCTCAGGGACGGTGG + Intronic
1049708883 8:144054934-144054956 CAGAGTGGGCACAGGGGAGCAGG + Intronic
1049850974 8:144829984-144830006 CAGGAGGGGCAAGGGGATGACGG - Intronic
1050018328 9:1259312-1259334 GAGGGAGGGTTCAGGGATGAGGG - Intergenic
1051894242 9:21971237-21971259 CAGGGTGGGGGCCGGCATGACGG + Intronic
1052605149 9:30689477-30689499 CGGGGAGGACACATGGATGACGG + Intergenic
1053152845 9:35753941-35753963 CAGAGAGGGCACAGGGAGGATGG - Exonic
1053299220 9:36936741-36936763 CAGGGTGGGGACAGGGAGGTGGG + Intronic
1055407455 9:75989542-75989564 CAGACGGGGCCCAGGGATGATGG + Intronic
1055894192 9:81157092-81157114 TGGGGTTGGAACAGGGATGAAGG + Intergenic
1056335541 9:85564923-85564945 TGGGATGGGAACAGGGATGAAGG + Intronic
1057460145 9:95253788-95253810 CAGGGCGGGGGCAGGGATGGGGG + Intronic
1058566558 9:106291664-106291686 CAATGTGGCCACAGGGTTGATGG + Intergenic
1059613670 9:115925739-115925761 CAGGGAGGGAACAGGGAGTATGG - Intergenic
1060265844 9:122111068-122111090 CAGCCTGGGCAAGGGGATGAGGG + Intergenic
1060822434 9:126669245-126669267 GAGGGTGGAGACAGGGATGAGGG + Intronic
1060869292 9:127026816-127026838 CAGGGTGGGGACTGGCATGCAGG + Intronic
1061239946 9:129364123-129364145 CAGGGTGGGGGCAGGAAAGAGGG - Intergenic
1061265723 9:129503838-129503860 GAGGGTGGGGGCAGGAATGAGGG + Intergenic
1061436408 9:130565540-130565562 CAGGTTGGCCACAGGAAAGAAGG + Intergenic
1061804680 9:133131351-133131373 CAGGGTGAGTACAGGGAGGTAGG - Intronic
1061951772 9:133940211-133940233 CAGAGTGGGCACTGGGGTGTGGG + Intronic
1062215301 9:135385894-135385916 CAGGGTGGGCACGGGGAGGGTGG - Intergenic
1062241980 9:135545795-135545817 CTGGGAGGGCTCAGGGGTGAGGG + Intergenic
1062344409 9:136108294-136108316 CAGGCCAGGCACAGGGATGCTGG - Intergenic
1062427488 9:136512621-136512643 CAGGGTGGGCGCCGGGAGCACGG + Intronic
1062504335 9:136865694-136865716 CAGGGTGGGCACTGGGAACGGGG - Intronic
1062702180 9:137913052-137913074 CAGTGGGGACACAGGAATGAAGG + Intronic
1203746716 Un_GL000218v1:44294-44316 CGAGGTGGGGACAGGGATGGTGG - Intergenic
1203746854 Un_GL000218v1:44811-44833 CAGGCTGGGCACAGCGGGGAGGG + Intergenic
1203563254 Un_KI270744v1:74669-74691 CAGGCTGGGCACAGTGGGGAGGG - Intergenic
1186636066 X:11406255-11406277 CAGAGTGGGTACTGGGATGGGGG + Intronic
1186724930 X:12347087-12347109 CAGACTGGGCACAGGAATGCAGG + Intronic
1186754964 X:12660978-12661000 CATGGTGGTCACAGGGTTGTTGG + Intronic
1187121165 X:16407687-16407709 CAATGTGGGCACAGTGAGGAAGG + Intergenic
1187338644 X:18402201-18402223 TAGGATGGCCTCAGGGATGAGGG + Intergenic
1187586076 X:20663326-20663348 CACGGTGGGGAAGGGGATGAAGG + Intergenic
1187644155 X:21328501-21328523 CAGGGAGGGCACAGGCAGGTTGG - Intergenic
1189177584 X:38973399-38973421 CAGGGAGGGGACAGGGAAGGAGG - Intergenic
1189612213 X:42749289-42749311 CATGGTTGACACAGGGATAAGGG - Intergenic
1190247392 X:48699666-48699688 CAGGGTGGTGGCAGTGATGATGG + Intronic
1190275059 X:48893975-48893997 CATGGTGGGCTCAGCAATGATGG - Exonic
1196232847 X:113244396-113244418 CAGAATGGGCATAGGAATGAGGG - Intergenic
1196441508 X:115723427-115723449 CAGGGCGGGCAGAGGGAGAAGGG + Intergenic
1196445039 X:115841416-115841438 CAGGGCGGGCAGAGGGAGAAGGG + Intergenic
1196865753 X:120069232-120069254 CAGGTTGGGTGCAGGGATGTTGG - Intergenic
1196877342 X:120167048-120167070 CAGGTTGGGTGCAGGGATGTTGG + Intergenic
1200057830 X:153470770-153470792 CAGGGCGGACACAGGGAAGGGGG + Intronic
1200954926 Y:8934514-8934536 CAGGCTGCCAACAGGGATGAAGG - Intergenic
1201160045 Y:11159308-11159330 CGAGGTGGGGACAGGGATGGTGG - Intergenic
1201160178 Y:11159825-11159847 CAGGCTGGGCACAGTGGGGAGGG + Intergenic