ID: 1184281186

View in Genome Browser
Species Human (GRCh38)
Location 22:43438388-43438410
Sequence CACTAGGAGTGTTGGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 179}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184281181_1184281186 -3 Left 1184281181 22:43438368-43438390 CCTGGGGTGGGAGCAGAGAGCAC 0: 1
1: 0
2: 5
3: 52
4: 429
Right 1184281186 22:43438388-43438410 CACTAGGAGTGTTGGGAAGTGGG 0: 1
1: 0
2: 3
3: 13
4: 179
1184281180_1184281186 -2 Left 1184281180 22:43438367-43438389 CCCTGGGGTGGGAGCAGAGAGCA 0: 1
1: 0
2: 5
3: 66
4: 483
Right 1184281186 22:43438388-43438410 CACTAGGAGTGTTGGGAAGTGGG 0: 1
1: 0
2: 3
3: 13
4: 179
1184281171_1184281186 27 Left 1184281171 22:43438338-43438360 CCAGGCAGAGGACGCGGAGGCTG No data
Right 1184281186 22:43438388-43438410 CACTAGGAGTGTTGGGAAGTGGG 0: 1
1: 0
2: 3
3: 13
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184281186 Original CRISPR CACTAGGAGTGTTGGGAAGT GGG Intronic
901216574 1:7558572-7558594 CACTAGGGCTGATGGGCAGTGGG + Intronic
902799951 1:18823141-18823163 CACTTGGGGTGTTGTGATGTTGG - Intergenic
904154820 1:28474011-28474033 GAATAGGAGTCATGGGAAGTGGG - Exonic
904812945 1:33175589-33175611 CAGTTGGCGTGTTGGGAAGGAGG + Intronic
904944258 1:34187790-34187812 AACTAGAAGTGTTGGGTGGTGGG - Intronic
905554544 1:38872168-38872190 AACTAGGAAGTTTGGGAAGTGGG - Intronic
905918358 1:41701279-41701301 CCCGAGGAGTGTTTGGAAGTGGG - Intronic
908524645 1:64976065-64976087 CACTGGGAGTGATGGTAAGTGGG + Intergenic
909059615 1:70865266-70865288 CAGTAGGGGTGTGGTGAAGTGGG + Intronic
909843066 1:80354554-80354576 CCCTTGGGGTGTTGGAAAGTGGG + Intergenic
909882038 1:80891797-80891819 CACTTGGAGTGTGGGGGAGATGG + Intergenic
910168898 1:84357254-84357276 CACTGGGAGTGATAGCAAGTGGG + Intronic
912030671 1:105239425-105239447 CACTGGGAGTGATGGTAATTGGG + Intergenic
912965200 1:114230965-114230987 CACTAAGAGAGTGGGCAAGTTGG - Intergenic
912989157 1:114466644-114466666 CACTGGGAGTATTGCCAAGTAGG - Intronic
915530876 1:156501271-156501293 CCCCAGGAGAGTTGGGAGGTGGG + Intergenic
915682156 1:157591597-157591619 CAATAAGAGTGTGGGGAGGTAGG + Intronic
919045528 1:192446848-192446870 CACTGGGCCTGTTGGGGAGTGGG + Intergenic
920825367 1:209419928-209419950 CACTAGGTCTGTTGAGAAATAGG + Intergenic
922177248 1:223206229-223206251 CACTAGGAGTGGAGGGAGCTTGG + Intergenic
1068614373 10:59096457-59096479 CACTAGCAGTGATGGGAAGCAGG + Intergenic
1069615742 10:69805092-69805114 GACTGGGAGTGTGAGGAAGTAGG + Intronic
1070660948 10:78304835-78304857 CACCAGGACTGGTGGGCAGTGGG - Intergenic
1071400489 10:85264138-85264160 CAGTAGGAGTGTGGTGGAGTGGG - Intergenic
1074221827 10:111445559-111445581 AAGCAGGAGTGTTGGGATGTAGG + Intergenic
1074973744 10:118564723-118564745 CATTAGGAGAGTTGGGGAGGGGG - Intergenic
1075747504 10:124737891-124737913 CACTAGGACTGTGGGGAGGCAGG + Intronic
1076608231 10:131703147-131703169 CATTAGAAGTGTTTGGAGGTGGG - Intergenic
1077348021 11:2073305-2073327 CACTGGGAATGATGGGAAGCGGG + Intergenic
1079321444 11:19454796-19454818 CAAGGGGAGTGTTGGGAGGTGGG + Intronic
1082801978 11:57421453-57421475 TACCAGGATTGTTGGGAATTTGG - Intronic
1083594063 11:63910771-63910793 CAGTAGGAGTGTGGGGCAGGAGG - Exonic
1084777773 11:71388671-71388693 CATTAGGACTGTTGGGATGTTGG - Intergenic
1085012772 11:73152824-73152846 CACTGGGAGGGGTGGGGAGTAGG + Intergenic
1088919824 11:114252733-114252755 CACGAGGAATGTAGGGAAGCCGG + Intergenic
1089102942 11:115979194-115979216 TACTCAGGGTGTTGGGAAGTGGG + Intergenic
1089196452 11:116696421-116696443 AACCAAGAGTGTTGGGAAGAGGG - Intergenic
1089806337 11:121094037-121094059 CACTGGGAGTAATGGCAAGTAGG + Intergenic
1091490401 12:927490-927512 CCCTTTGTGTGTTGGGAAGTTGG - Intronic
1095502409 12:42855018-42855040 CAGTAGGTGTGTTTGGGAGTGGG - Intergenic
1095844181 12:46728489-46728511 CACTAGGAGTGATGGTAAGTGGG + Intergenic
1096357036 12:50949911-50949933 CATTAGAAGTGTCTGGAAGTGGG - Intergenic
1099021331 12:77408161-77408183 AACAAGCAGTGTTGGGCAGTGGG + Intergenic
1100364177 12:93904168-93904190 CAGTATGTATGTTGGGAAGTGGG - Intergenic
1100849706 12:98696473-98696495 CTGTGGCAGTGTTGGGAAGTAGG - Intronic
1101059239 12:100953976-100953998 CACGAGCAGTGTTGGGATTTTGG + Intronic
1101067217 12:101034473-101034495 CAATAGGCCTGTTGGGGAGTAGG + Intronic
1101511162 12:105393652-105393674 CAATAGCAGTTTTGGGAATTAGG + Intronic
1101863095 12:108498848-108498870 CTCTAAGAGTCTTGGGAAGGAGG + Intergenic
1101901099 12:108791851-108791873 CATCAGGGGTGTGGGGAAGTGGG + Intronic
1102687707 12:114737099-114737121 CATTAGAAGTCTTGGGAAGGGGG + Intergenic
1102944107 12:116970374-116970396 CACTGGGAGTGTTGCGGAGGTGG - Intronic
1104397090 12:128443716-128443738 GACTAGCAGTGTGGGGAAGCGGG - Intronic
1106507402 13:30383109-30383131 CACCAGGTGTGGTGGGAAGCAGG + Intergenic
1107364329 13:39654233-39654255 GAAGAGGAGTGTTGGGAAGAGGG - Intergenic
1113290097 13:108896022-108896044 CATTAGCAGTGTTGGGGTGTGGG + Intronic
1114171792 14:20280160-20280182 CACTGGGAGTGCTGGACAGTGGG + Intronic
1114650682 14:24282717-24282739 CATGAGGAATGCTGGGAAGTAGG - Intergenic
1115117880 14:29904846-29904868 CAATAGGAGTGTTAGGATTTAGG - Intronic
1116007908 14:39316326-39316348 CACTAGGAGTCTTCAGCAGTAGG + Intronic
1118617856 14:67587249-67587271 CACTAGTGGTGTTGGGGAATCGG - Exonic
1125897026 15:43310995-43311017 AAATAGGAGTTTTGGGGAGTGGG + Intergenic
1126789608 15:52209113-52209135 GACTAGGACTGTTGGGGAGAAGG + Intronic
1127278778 15:57470967-57470989 CTCTAGGAGCTTTGGGACGTTGG + Intronic
1128769497 15:70271236-70271258 CACTAGGAGTGATGGCAACAGGG - Intergenic
1129758665 15:78114021-78114043 CATTAGCAGTGTGGGTAAGTGGG + Intronic
1138033177 16:53577454-53577476 CACTAGGAGTGGTGGTAAAAGGG + Intergenic
1141286992 16:82681831-82681853 CACCTGGAGTGCAGGGAAGTTGG - Intronic
1146609483 17:34291529-34291551 CACTAGGAGTAATGGTAAGTAGG + Intergenic
1148289670 17:46433419-46433441 CATCAGGGGTGTTGGGATGTAGG + Intergenic
1148311838 17:46650991-46651013 CATCAGGGGTGTTGGGATGTAGG + Intronic
1149954411 17:61032416-61032438 CCTTAGGAGTTTTGGGAAGATGG - Intronic
1150629954 17:66872947-66872969 CTCAAAGAGTGTTGGGAAGAAGG - Intronic
1155015613 18:21835846-21835868 CACGAGGAGTATTGGGAAAGAGG + Intronic
1156537772 18:37880425-37880447 CACTAGGGGTGATGGCAAGTGGG - Intergenic
1157402008 18:47396475-47396497 CACTATGAGGGGAGGGAAGTAGG + Intergenic
1164598283 19:29544668-29544690 TACTGGCAGTGTTGGGAAGCTGG + Intronic
1164771092 19:30809589-30809611 CACTGGGAGTGATTGGAAGGGGG - Intergenic
1166259298 19:41626863-41626885 CTCTGGGAGTGGTGGGAAGAGGG - Intronic
925387443 2:3472040-3472062 CTGCAGGAGTGGTGGGAAGTTGG + Intronic
928222725 2:29418275-29418297 CCCAAGGAGTGCTGGGGAGTAGG - Intronic
930404018 2:50931004-50931026 CACTAGAAGGGTTGGTAAGTTGG - Intronic
931428491 2:62192024-62192046 AACTAGGAGTTTGGGGAGGTGGG - Intergenic
931957459 2:67443278-67443300 TACTAGAAGTATTGGGAGGTGGG + Intergenic
932282093 2:70502287-70502309 CACTTTGGCTGTTGGGAAGTAGG - Intronic
932708121 2:74042632-74042654 CACTAAGATTGTTTGGATGTTGG + Intronic
937062677 2:118992122-118992144 GCCTAGGAGTGTTGGGTCGTGGG - Intronic
939475273 2:142678789-142678811 CAGTAGAAGTGCTGGGAGGTTGG + Intergenic
940782334 2:157945983-157946005 CTTTAGGAGTGATGGTAAGTGGG - Intronic
940998125 2:160172304-160172326 CACCAGGATTTTTGAGAAGTTGG + Intronic
941712221 2:168725754-168725776 CACTTTGAGTGATGGCAAGTAGG - Intronic
943199978 2:184810179-184810201 CACTAGGAGAGTTGAGGAGTTGG + Intronic
943240597 2:185378608-185378630 CAATAGGAGTGATGAGAAGAGGG - Intergenic
945930523 2:215850433-215850455 AACCAGGAGTGGTCGGAAGTGGG - Intergenic
947726252 2:232402692-232402714 CCCTAGGTGTGGTGGGGAGTGGG + Intergenic
947735817 2:232454815-232454837 CCCTAGGCGTGGTGGGGAGTGGG + Intergenic
1172198108 20:33105867-33105889 CACTAAGAGTGGTGTGAACTTGG + Intronic
1173465960 20:43281630-43281652 CAGTAGGAGAGAGGGGAAGTGGG - Intergenic
1173516429 20:43667917-43667939 CACGAGGAGTTTTGGGCAGCTGG + Intronic
1178875995 21:36414249-36414271 CACGAGGAGAGCTGGGAAGGGGG + Intronic
1179502569 21:41819479-41819501 AACTGGGAGTGTGGGGAAGGTGG - Intronic
1182234974 22:28867877-28867899 CACCAGGAGTGTTGGCAACATGG + Intergenic
1184281186 22:43438388-43438410 CACTAGGAGTGTTGGGAAGTGGG + Intronic
949138284 3:599325-599347 GAGAAGGAGTTTTGGGAAGTAGG + Intergenic
949804948 3:7944509-7944531 CACTTGTAGTCTTGGGAACTTGG - Intergenic
950063615 3:10093044-10093066 AACTGGGAGTGTTGAGAAGATGG - Intronic
950156270 3:10723761-10723783 GACTCTGAGTGTTGGGAAGGAGG + Intergenic
950656343 3:14439277-14439299 CAATAGGAGTGTTGGAGAATAGG + Intronic
950757341 3:15186779-15186801 CACTAGGAGTGTCAGACAGTGGG + Intergenic
952222072 3:31332836-31332858 AACTAGGAGTGGTGGCAAGATGG + Intergenic
952540042 3:34358025-34358047 CAGTAAGAGTGTGGGTAAGTGGG + Intergenic
957247369 3:77732422-77732444 CACTAGGGGTGATGGTGAGTGGG + Intergenic
959205230 3:103298416-103298438 CAATAGGAGGGATGGGAAGAAGG - Intergenic
959554818 3:107704724-107704746 GAGTAACAGTGTTGGGAAGTAGG - Intronic
959820498 3:110729797-110729819 CAGGAAGAGAGTTGGGAAGTGGG - Intergenic
961861713 3:129921771-129921793 CACGAAGAGTTTTGGGGAGTGGG - Intergenic
961904020 3:130243829-130243851 CACATTGAGTGTTGGGAAGCAGG - Intergenic
962357982 3:134711239-134711261 TTCCAGGAGAGTTGGGAAGTGGG + Intronic
962814365 3:138985031-138985053 AAATAGGAGTGTTGGGGTGTAGG + Intergenic
964542821 3:157798679-157798701 CACTGGGGGTGTTGGGGGGTGGG - Intergenic
964896142 3:161598660-161598682 CTATAGGAGTTTTGGGAAGCAGG + Intergenic
967128502 3:186448252-186448274 CAGTAGTACTGATGGGAAGTGGG + Intergenic
970872632 4:20833959-20833981 AACTGGGAGTGTGGTGAAGTGGG + Intronic
971150481 4:24026218-24026240 AACTGGGACTGGTGGGAAGTGGG - Intergenic
971810535 4:31419883-31419905 GGCTAGGAGTGTGGGGAAATAGG - Intergenic
972375764 4:38468793-38468815 TACCATGAGTGTTGGGAGGTTGG - Intergenic
974496687 4:62638250-62638272 CCCTAGGATTGTTGAGGAGTGGG - Intergenic
975671045 4:76781045-76781067 CTCGAAGAGTGTTGGGAACTGGG - Exonic
977112509 4:92976586-92976608 CAATAGGCAAGTTGGGAAGTGGG - Intronic
977411247 4:96668044-96668066 CAGTGGGTGTGTTGGGAAATGGG + Intergenic
982694293 4:158582105-158582127 TATTAGGAGTATTGGGAGGTGGG - Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
986270812 5:6229048-6229070 CTGTGGGACTGTTGGGAAGTTGG + Intergenic
986303835 5:6500919-6500941 CACTATGAGGGGTGGGACGTTGG - Intergenic
987146981 5:15001285-15001307 GAAGAGGAGTGTTGGGAATTGGG - Intergenic
989651338 5:43694318-43694340 GACTAGGAGTGGTGAGAAGAGGG + Intronic
990510780 5:56487547-56487569 CAATAGGACTAGTGGGAAGTTGG + Intergenic
991137923 5:63205090-63205112 AACCAGCAGTGTTGGGAAGTGGG + Intergenic
993111247 5:83659990-83660012 CCCTGGCAGGGTTGGGAAGTGGG - Intronic
997467113 5:134095652-134095674 CACTAGGATCATTGGGCAGTGGG - Intergenic
998338710 5:141397449-141397471 CACTAGAAATATTGGGGAGTTGG + Intronic
998512954 5:142728866-142728888 CATTAGGAGTAGTGGTAAGTGGG + Intergenic
999151788 5:149431038-149431060 CGCAAGGCGCGTTGGGAAGTGGG - Intergenic
999238488 5:150114112-150114134 CACGGGGAGGGTTGGGAAGGGGG - Exonic
999984540 5:156990730-156990752 CTGTCAGAGTGTTGGGAAGTAGG + Intergenic
1000289845 5:159860149-159860171 CAGTAGGAGATTTGGAAAGTAGG + Intergenic
1003716836 6:8656297-8656319 CAGTAGGAGAGTTACGAAGTTGG - Intergenic
1004973286 6:20935884-20935906 CACCAAGAGTGTGGGGAAGCAGG - Intronic
1005139548 6:22612422-22612444 CACTAGCAGTGAAGGGAATTAGG + Intergenic
1005361986 6:25039643-25039665 CACTAGTATGGATGGGAAGTCGG - Intronic
1006679703 6:35788098-35788120 CACCATGAGTGGAGGGAAGTGGG + Exonic
1007919100 6:45589953-45589975 CACAAGGAGGTGTGGGAAGTGGG - Intronic
1008034621 6:46733402-46733424 CATTAGGAGTGTTGTGAATCTGG - Intronic
1008385037 6:50879609-50879631 AACTAGGAGTGGTGGGAACTGGG + Intergenic
1010175017 6:73017930-73017952 CCCTAGGAGTGCAGGGCAGTAGG + Intronic
1013083469 6:106833388-106833410 CACAAGAAGTTTTGGGAATTTGG + Intergenic
1014349230 6:120318383-120318405 CACTCAGAATATTGGGAAGTAGG - Intergenic
1014613548 6:123574422-123574444 CATTAGGAGTGATGTGAATTTGG - Intronic
1014613743 6:123577044-123577066 CATTAGCACTGTTGAGAAGTAGG + Intronic
1015992287 6:138958502-138958524 CACCAGGCCTGTTGGGGAGTGGG - Intronic
1016665538 6:146635675-146635697 AAGTGGGAGTGTTGGGAGGTGGG - Intronic
1016793707 6:148094983-148095005 CACTATGGGGGTAGGGAAGTTGG + Intergenic
1023562712 7:41492474-41492496 CACAGGGAGTGGTGGGAAGGAGG + Intergenic
1026215284 7:68342966-68342988 CAATGGGAGTGATGAGAAGTGGG + Intergenic
1028893490 7:96014423-96014445 CACACGGTGTGCTGGGAAGTAGG - Intronic
1028903055 7:96122548-96122570 CACTATGTGTGTTGGGGGGTGGG + Intronic
1030683908 7:112463478-112463500 CAAAAGGAGTGTAGGGGAGTTGG - Intronic
1037609162 8:20462003-20462025 CCCTAGGACCGGTGGGAAGTGGG + Intergenic
1039024030 8:33238303-33238325 CAATAGGAGTGATGGGAAGGGGG + Intergenic
1042076536 8:65001453-65001475 CGGTAGCAGTGTTGGGAGGTAGG - Intergenic
1044667628 8:94647254-94647276 GACCAGTAGTGTTGGGAAGAGGG + Intronic
1044694677 8:94910610-94910632 TACTAGGACTGTCGGGAAGATGG + Intronic
1045425748 8:102064299-102064321 CCCTGGCAGTGTTGGGGAGTGGG - Intronic
1051092338 9:13424528-13424550 CACTAGGGGTTTTGAGCAGTGGG + Intergenic
1051201641 9:14633355-14633377 CAGTGGGAATGTTGGGCAGTAGG - Intronic
1055353907 9:75417929-75417951 CACTAGGAGTGGAGGGCTGTGGG + Intergenic
1058098182 9:100887314-100887336 GTCTAGAAGTGTTTGGAAGTTGG + Intergenic
1059222282 9:112635134-112635156 CACTAGCAGAGTTTGGCAGTTGG + Intronic
1060498606 9:124135852-124135874 TACTAGTAATGTTTGGAAGTAGG - Intergenic
1060601715 9:124882463-124882485 CAGGGGGAGTGCTGGGAAGTGGG + Intronic
1061053389 9:128209023-128209045 GACTAGGAGGGTTGGGGAGGCGG + Intronic
1062253938 9:135612344-135612366 CACCAGGGAGGTTGGGAAGTAGG + Intergenic
1186260589 X:7774723-7774745 TACTAGAAGTGTTGGGAATAGGG + Intergenic
1191825106 X:65356070-65356092 CACTAGGATTTTTGGGAATTAGG - Intergenic
1192313996 X:70038017-70038039 CACTAGTAGTTGTGGGAAGCAGG - Exonic
1194020411 X:88683604-88683626 TACTAGGATTGTTGGTAACTAGG + Intergenic
1195537349 X:106023723-106023745 CATTGTGAGGGTTGGGAAGTAGG + Intergenic
1198552639 X:137760844-137760866 CACTAGGGGTGTTCAGAAGTGGG - Intergenic
1199918993 X:152376266-152376288 AAATAAGAGTTTTGGGAAGTGGG - Intronic
1201795203 Y:17889669-17889691 CACTGGGAGTGCTGGGAAGTGGG + Intergenic
1201806352 Y:18016315-18016337 CACTGGGAGTGCTGGGAAGTGGG - Intergenic
1201898858 Y:19025447-19025469 CACTGGGAATGTTGGGCGGTGGG - Intergenic
1202356645 Y:24058751-24058773 ACTTGGGAGTGTTGGGAAGTGGG + Intergenic
1202359903 Y:24096750-24096772 CACTAGGGGTGATGGTGAGTGGG - Intergenic
1202510874 Y:25573364-25573386 CACTAGGGGTGATGGTGAGTGGG + Intergenic
1202514133 Y:25611359-25611381 ACTTGGGAGTGTTGGGAAGTGGG - Intergenic