ID: 1184285436

View in Genome Browser
Species Human (GRCh38)
Location 22:43468466-43468488
Sequence CCTGATGAGTAGACAGTTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 92}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184285436_1184285440 -3 Left 1184285436 22:43468466-43468488 CCCTAAACTGTCTACTCATCAGG 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1184285440 22:43468486-43468508 AGGCATGTCCTACCAGAGGCTGG 0: 1
1: 0
2: 1
3: 7
4: 164
1184285436_1184285444 24 Left 1184285436 22:43468466-43468488 CCCTAAACTGTCTACTCATCAGG 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1184285444 22:43468513-43468535 TGTTCAGACATCTCTGAGGCAGG 0: 1
1: 0
2: 0
3: 16
4: 224
1184285436_1184285445 27 Left 1184285436 22:43468466-43468488 CCCTAAACTGTCTACTCATCAGG 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1184285445 22:43468516-43468538 TCAGACATCTCTGAGGCAGGAGG 0: 1
1: 0
2: 5
3: 22
4: 274
1184285436_1184285439 -7 Left 1184285436 22:43468466-43468488 CCCTAAACTGTCTACTCATCAGG 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1184285439 22:43468482-43468504 CATCAGGCATGTCCTACCAGAGG 0: 1
1: 0
2: 1
3: 17
4: 203
1184285436_1184285443 20 Left 1184285436 22:43468466-43468488 CCCTAAACTGTCTACTCATCAGG 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1184285443 22:43468509-43468531 TCATTGTTCAGACATCTCTGAGG 0: 1
1: 0
2: 2
3: 15
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184285436 Original CRISPR CCTGATGAGTAGACAGTTTA GGG (reversed) Intronic
904437671 1:30509146-30509168 CCTGAAGAGTAGATAATTAAAGG - Intergenic
905947544 1:41916763-41916785 CCTGCTGAGCAGCCAGTGTAGGG - Intronic
908175615 1:61552543-61552565 CCTGATGACTAGAGAGCCTATGG - Intergenic
908343674 1:63208862-63208884 CGGGATGAGAAGACACTTTAAGG - Intergenic
910556420 1:88539367-88539389 CATGATGAGTGGAAAGTTTGGGG + Intergenic
914844856 1:151277213-151277235 CATGATGAGGAGAGAGTTGATGG - Intergenic
916385666 1:164264975-164264997 CCTGATGACTAGAAAGTTGAGGG - Intergenic
918055604 1:181019165-181019187 CAGGTGGAGTAGACAGTTTAGGG - Intronic
918698361 1:187574896-187574918 CCTTATGAGTGTACAGTTTCTGG - Intergenic
918774896 1:188614818-188614840 CAGAATGAGTAGACAGTCTATGG + Intergenic
920274636 1:204795094-204795116 CCTTAAGAATAGTCAGTTTAAGG + Intergenic
921568224 1:216746797-216746819 TCTGATGAACAGACAGTTTTTGG - Intronic
1062796928 10:351710-351732 CCTGCTGAGAAGACAGATTTGGG + Intronic
1063055348 10:2498250-2498272 CTGGATGAGGAGACAATTTAAGG + Intergenic
1069476868 10:68742399-68742421 GCTGAGGAGTAGACAGGCTAAGG - Exonic
1078493847 11:11796420-11796442 CCTGATGAGAAGAGTGTTTTAGG - Intergenic
1083413830 11:62512503-62512525 CCTAATAAAGAGACAGTTTATGG - Intronic
1086324152 11:85681548-85681570 CCTGAAGAGCTCACAGTTTAAGG + Intronic
1089002885 11:115067040-115067062 CCTCAGGAGCAGACAGTGTACGG - Intergenic
1091258909 11:134218210-134218232 CCTGGTGAGCAGATGGTTTAGGG - Intronic
1092695682 12:11169091-11169113 CCTGATGAAAAGTCAGTTAAAGG + Intronic
1093392524 12:18639727-18639749 GCTGAGGAGGAGAGAGTTTAAGG + Intronic
1095197772 12:39342739-39342761 CCTGAACATTAGACAGTTTTTGG - Intronic
1097086868 12:56475320-56475342 CTAGATGACTAGACAGTTTGGGG - Exonic
1108358502 13:49648859-49648881 CCTCATGATTAGACAGTTATGGG - Intergenic
1110206686 13:72922942-72922964 CCAGCTGAGTAGATAGTATAAGG + Intronic
1110493394 13:76136034-76136056 CCAGCTGAGAAGACAGGTTAAGG + Intergenic
1111269022 13:85855317-85855339 CCTGTTGAGGAGACAGTGCAGGG - Intergenic
1119557606 14:75565702-75565724 CCTGTGGAGAAGACAGTCTATGG - Intergenic
1125253710 15:37737431-37737453 TCTGATGAGTAGAAAGACTAAGG - Intergenic
1128250225 15:66158678-66158700 CCTAATGAGTAGCCAGGCTAGGG + Intronic
1128515954 15:68342044-68342066 TGTGAGGAGTAGACAGGTTAAGG + Intronic
1129748403 15:78041443-78041465 CCTGATGAACTGACATTTTAAGG - Intronic
1130171159 15:81516093-81516115 CCTGATGAGCAGCCAGGTTTAGG + Intergenic
1135407001 16:22206087-22206109 CCTGCTGAGTACACAGTGTCCGG - Intergenic
1135460444 16:22637675-22637697 CCTGATGATTGGTCAGTGTATGG - Intergenic
1135479024 16:22805519-22805541 GATGCTGAATAGACAGTTTAGGG + Intergenic
1139190580 16:64858375-64858397 CCTGCTGAGAAGACAGGTTCAGG + Intergenic
1141286610 16:82678696-82678718 CTTGAAGAGTACACAGTTTAAGG + Intronic
1145085719 17:19937863-19937885 TCTGATAAATAGCCAGTTTAGGG - Intronic
1155706205 18:28817044-28817066 TCTAAGGAGTAGACAATTTAAGG - Intergenic
1157851948 18:51062820-51062842 CCAGATTACTAGACTGTTTAGGG - Intronic
1164615399 19:29664456-29664478 CCTGAGGAGGTGACAGTTTGAGG + Intergenic
924970205 2:119420-119442 GCTGATGACTAGACTCTTTAAGG - Intergenic
929170016 2:38922368-38922390 CCAGAAGGGTAGATAGTTTAGGG + Intronic
933081522 2:77993742-77993764 CCTGGTAAGCAGCCAGTTTATGG - Intergenic
933220435 2:79681364-79681386 GCTGTTGAGTAGACAGCTTTTGG + Intronic
936658980 2:114521678-114521700 CCTGATGAATAGAAAGTCTGTGG + Intronic
941321474 2:164060796-164060818 CCGGATGAGTAAAAATTTTAAGG - Intergenic
941526783 2:166615690-166615712 TCTGATCTGTAGACAGTTTTAGG + Intergenic
942665542 2:178312787-178312809 CCTGATCAGTATATATTTTATGG + Intronic
1169981921 20:11394302-11394324 CCTGATGAGTAGGCAATATGGGG - Intergenic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1184285436 22:43468466-43468488 CCTGATGAGTAGACAGTTTAGGG - Intronic
957259829 3:77886620-77886642 CCTGATGAATAGACATTCTGAGG + Intergenic
957353263 3:79052864-79052886 ACTGATGAGTAGTCTGTGTATGG + Intronic
959274326 3:104258459-104258481 GCTGATGAGTAGAGAGGTAAAGG + Intergenic
959811494 3:110625435-110625457 CCTTATGAGAAGAAAGTCTAGGG + Intergenic
960598652 3:119432766-119432788 CATGGTGGGTAAACAGTTTAAGG - Intronic
960953232 3:123012992-123013014 CATGAGGAGGAGACAGTGTAAGG + Intronic
964291482 3:155185698-155185720 CCAGATGAGGATACAGTGTATGG + Intergenic
970033192 4:11701262-11701284 CCAGATCAGCAGAGAGTTTAGGG - Intergenic
970622053 4:17832537-17832559 CATGATAAGTTTACAGTTTAAGG + Intronic
970757033 4:19439012-19439034 CCTGATGTGTTGAAAGTTTATGG + Intergenic
973019534 4:45185326-45185348 GCTGATGATTAGACACTTTAGGG - Intergenic
975079847 4:70263607-70263629 ACTGACCAGTAAACAGTTTATGG - Intergenic
982494334 4:156071361-156071383 CCTGATGATTTTACTGTTTAAGG + Intergenic
983571154 4:169209394-169209416 CCTGATGCCAAGTCAGTTTAAGG + Intronic
983918754 4:173321483-173321505 TTTCATGAGGAGACAGTTTAAGG - Intronic
987356768 5:17070221-17070243 CATGATGAGTAGGCAGATTGGGG + Intronic
1001827055 5:174753435-174753457 CCAGATGATTATACAGCTTAAGG + Intergenic
1006154214 6:32005605-32005627 CCTGCTGTGTAGACTGTTTTGGG - Intergenic
1006160518 6:32038339-32038361 CCTGCTGTGTAGACTGTTTTGGG - Exonic
1007002198 6:38324530-38324552 CCTGCTGAGCAGACAGACTATGG + Intronic
1018181758 6:161229420-161229442 CCAGAGGAGGAGACAGTTTGTGG - Intronic
1020757629 7:12223514-12223536 TCTGATGAGCAGTCACTTTAGGG + Intronic
1023067435 7:36391993-36392015 CGTTATGAGTAGTGAGTTTATGG - Intronic
1023620688 7:42068859-42068881 CCTGATGGGAAGACACTTTGAGG - Intronic
1027120571 7:75516135-75516157 CCTGATGAGAAGATAGCATACGG - Intergenic
1028636447 7:92994572-92994594 ACTGATGCATAGCCAGTTTAGGG + Intergenic
1029722217 7:102375886-102375908 CCTGATGAGAAGATAGCATACGG + Exonic
1029949887 7:104572751-104572773 ACTGCTGAGTAGGCATTTTAGGG + Intronic
1031366720 7:120909662-120909684 CCTGATGAGTTGATAATTTGGGG - Intergenic
1032149928 7:129419801-129419823 CATAATGAGTGGCCAGTTTATGG + Intronic
1033131431 7:138748882-138748904 CCTGATGAGGTTGCAGTTTAAGG + Intronic
1039212492 8:35233820-35233842 TCTGAAGAATAAACAGTTTAAGG - Intergenic
1042327454 8:67543294-67543316 GCTGAAGAATAGACAGTTTTTGG + Intronic
1044710505 8:95052833-95052855 TCTGATGCGTAGACAGGTTTGGG + Intronic
1050419184 9:5445255-5445277 TCAGATGAGTAGATAGATTAAGG + Intergenic
1053242404 9:36506786-36506808 CCTGATGAGAACACAGCTTTGGG + Intergenic
1055606505 9:77976332-77976354 CCTGTTGAGTGGATAGTTTTTGG - Intronic
1056584969 9:87921836-87921858 CCTGCTGAGTACACAGCTCAAGG - Intergenic
1056815975 9:89801186-89801208 CCTGATGAGTAGCAACTATATGG - Intergenic
1061804638 9:133131200-133131222 CCAGCTGAGCAGACAGTTCAGGG + Intronic
1188822913 X:34797202-34797224 ACTGATGAGTAGTCTGTGTATGG + Intergenic
1190087751 X:47410502-47410524 ACAGATGAGTAATCAGTTTAGGG + Intronic
1198423273 X:136489579-136489601 CCTGATCAGTGGACAGATTTAGG - Intronic