ID: 1184289351

View in Genome Browser
Species Human (GRCh38)
Location 22:43490146-43490168
Sequence GGCCCCCGGACCCAATGTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184289340_1184289351 26 Left 1184289340 22:43490097-43490119 CCACTTCAGTGCCCTTTCTACCC 0: 1
1: 0
2: 5
3: 24
4: 343
Right 1184289351 22:43490146-43490168 GGCCCCCGGACCCAATGTTGTGG No data
1184289342_1184289351 15 Left 1184289342 22:43490108-43490130 CCCTTTCTACCCAGTAGAGGAAA 0: 1
1: 0
2: 2
3: 16
4: 209
Right 1184289351 22:43490146-43490168 GGCCCCCGGACCCAATGTTGTGG No data
1184289345_1184289351 6 Left 1184289345 22:43490117-43490139 CCCAGTAGAGGAAAACAAGGCAG 0: 1
1: 0
2: 0
3: 31
4: 280
Right 1184289351 22:43490146-43490168 GGCCCCCGGACCCAATGTTGTGG No data
1184289339_1184289351 27 Left 1184289339 22:43490096-43490118 CCCACTTCAGTGCCCTTTCTACC 0: 1
1: 0
2: 11
3: 38
4: 327
Right 1184289351 22:43490146-43490168 GGCCCCCGGACCCAATGTTGTGG No data
1184289343_1184289351 14 Left 1184289343 22:43490109-43490131 CCTTTCTACCCAGTAGAGGAAAA 0: 1
1: 0
2: 4
3: 25
4: 202
Right 1184289351 22:43490146-43490168 GGCCCCCGGACCCAATGTTGTGG No data
1184289346_1184289351 5 Left 1184289346 22:43490118-43490140 CCAGTAGAGGAAAACAAGGCAGG 0: 1
1: 0
2: 2
3: 22
4: 264
Right 1184289351 22:43490146-43490168 GGCCCCCGGACCCAATGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184289351 Original CRISPR GGCCCCCGGACCCAATGTTG TGG Intronic
No off target data available for this crispr