ID: 1184294968

View in Genome Browser
Species Human (GRCh38)
Location 22:43517345-43517367
Sequence TTACTGTGGCACTGGATAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184294968_1184294971 2 Left 1184294968 22:43517345-43517367 CCTGTTATCCAGTGCCACAGTAA No data
Right 1184294971 22:43517370-43517392 GTGTGACAGCCCCGTCTCCGTGG No data
1184294968_1184294977 20 Left 1184294968 22:43517345-43517367 CCTGTTATCCAGTGCCACAGTAA No data
Right 1184294977 22:43517388-43517410 CGTGGCACACAATGTGTTTAGGG No data
1184294968_1184294976 19 Left 1184294968 22:43517345-43517367 CCTGTTATCCAGTGCCACAGTAA No data
Right 1184294976 22:43517387-43517409 CCGTGGCACACAATGTGTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184294968 Original CRISPR TTACTGTGGCACTGGATAAC AGG (reversed) Intergenic
No off target data available for this crispr