ID: 1184294969

View in Genome Browser
Species Human (GRCh38)
Location 22:43517353-43517375
Sequence TCACACAGTTACTGTGGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184294969_1184294976 11 Left 1184294969 22:43517353-43517375 CCAGTGCCACAGTAACTGTGTGA No data
Right 1184294976 22:43517387-43517409 CCGTGGCACACAATGTGTTTAGG No data
1184294969_1184294977 12 Left 1184294969 22:43517353-43517375 CCAGTGCCACAGTAACTGTGTGA No data
Right 1184294977 22:43517388-43517410 CGTGGCACACAATGTGTTTAGGG No data
1184294969_1184294978 25 Left 1184294969 22:43517353-43517375 CCAGTGCCACAGTAACTGTGTGA No data
Right 1184294978 22:43517401-43517423 GTGTTTAGGGCTCCCACATCTGG No data
1184294969_1184294980 27 Left 1184294969 22:43517353-43517375 CCAGTGCCACAGTAACTGTGTGA No data
Right 1184294980 22:43517403-43517425 GTTTAGGGCTCCCACATCTGGGG No data
1184294969_1184294971 -6 Left 1184294969 22:43517353-43517375 CCAGTGCCACAGTAACTGTGTGA No data
Right 1184294971 22:43517370-43517392 GTGTGACAGCCCCGTCTCCGTGG No data
1184294969_1184294979 26 Left 1184294969 22:43517353-43517375 CCAGTGCCACAGTAACTGTGTGA No data
Right 1184294979 22:43517402-43517424 TGTTTAGGGCTCCCACATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184294969 Original CRISPR TCACACAGTTACTGTGGCAC TGG (reversed) Intergenic
No off target data available for this crispr