ID: 1184294970

View in Genome Browser
Species Human (GRCh38)
Location 22:43517359-43517381
Sequence GGGCTGTCACACAGTTACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184294970_1184294979 20 Left 1184294970 22:43517359-43517381 CCACAGTAACTGTGTGACAGCCC No data
Right 1184294979 22:43517402-43517424 TGTTTAGGGCTCCCACATCTGGG No data
1184294970_1184294981 28 Left 1184294970 22:43517359-43517381 CCACAGTAACTGTGTGACAGCCC No data
Right 1184294981 22:43517410-43517432 GCTCCCACATCTGGGGTCCGCGG No data
1184294970_1184294977 6 Left 1184294970 22:43517359-43517381 CCACAGTAACTGTGTGACAGCCC No data
Right 1184294977 22:43517388-43517410 CGTGGCACACAATGTGTTTAGGG No data
1184294970_1184294980 21 Left 1184294970 22:43517359-43517381 CCACAGTAACTGTGTGACAGCCC No data
Right 1184294980 22:43517403-43517425 GTTTAGGGCTCCCACATCTGGGG No data
1184294970_1184294983 30 Left 1184294970 22:43517359-43517381 CCACAGTAACTGTGTGACAGCCC No data
Right 1184294983 22:43517412-43517434 TCCCACATCTGGGGTCCGCGGGG No data
1184294970_1184294982 29 Left 1184294970 22:43517359-43517381 CCACAGTAACTGTGTGACAGCCC No data
Right 1184294982 22:43517411-43517433 CTCCCACATCTGGGGTCCGCGGG No data
1184294970_1184294978 19 Left 1184294970 22:43517359-43517381 CCACAGTAACTGTGTGACAGCCC No data
Right 1184294978 22:43517401-43517423 GTGTTTAGGGCTCCCACATCTGG No data
1184294970_1184294976 5 Left 1184294970 22:43517359-43517381 CCACAGTAACTGTGTGACAGCCC No data
Right 1184294976 22:43517387-43517409 CCGTGGCACACAATGTGTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184294970 Original CRISPR GGGCTGTCACACAGTTACTG TGG (reversed) Intergenic
No off target data available for this crispr