ID: 1184294976

View in Genome Browser
Species Human (GRCh38)
Location 22:43517387-43517409
Sequence CCGTGGCACACAATGTGTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184294969_1184294976 11 Left 1184294969 22:43517353-43517375 CCAGTGCCACAGTAACTGTGTGA No data
Right 1184294976 22:43517387-43517409 CCGTGGCACACAATGTGTTTAGG No data
1184294968_1184294976 19 Left 1184294968 22:43517345-43517367 CCTGTTATCCAGTGCCACAGTAA No data
Right 1184294976 22:43517387-43517409 CCGTGGCACACAATGTGTTTAGG No data
1184294970_1184294976 5 Left 1184294970 22:43517359-43517381 CCACAGTAACTGTGTGACAGCCC No data
Right 1184294976 22:43517387-43517409 CCGTGGCACACAATGTGTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184294976 Original CRISPR CCGTGGCACACAATGTGTTT AGG Intergenic
No off target data available for this crispr