ID: 1184295925

View in Genome Browser
Species Human (GRCh38)
Location 22:43525541-43525563
Sequence AAGGAGGAGGAGAAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 10167
Summary {0: 3, 1: 64, 2: 391, 3: 2053, 4: 7656}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184295925_1184295933 9 Left 1184295925 22:43525541-43525563 CCTTCCTCTTTCTCCTCCTCCTT 0: 3
1: 64
2: 391
3: 2053
4: 7656
Right 1184295933 22:43525573-43525595 TTAAAAATGATGGACCCTCAAGG No data
1184295925_1184295930 -1 Left 1184295925 22:43525541-43525563 CCTTCCTCTTTCTCCTCCTCCTT 0: 3
1: 64
2: 391
3: 2053
4: 7656
Right 1184295930 22:43525563-43525585 TCTTCAACCCTTAAAAATGATGG No data
1184295925_1184295934 21 Left 1184295925 22:43525541-43525563 CCTTCCTCTTTCTCCTCCTCCTT 0: 3
1: 64
2: 391
3: 2053
4: 7656
Right 1184295934 22:43525585-43525607 GACCCTCAAGGCTGCTGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184295925 Original CRISPR AAGGAGGAGGAGAAAGAGGA AGG (reversed) Intergenic
Too many off-targets to display for this crispr