ID: 1184298799

View in Genome Browser
Species Human (GRCh38)
Location 22:43543007-43543029
Sequence CTGCTTACGATGTAGAAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184298793_1184298799 8 Left 1184298793 22:43542976-43542998 CCTGAGAAAGACACCACCATGGG 0: 1
1: 0
2: 3
3: 16
4: 189
Right 1184298799 22:43543007-43543029 CTGCTTACGATGTAGAAAAGTGG No data
1184298790_1184298799 18 Left 1184298790 22:43542966-43542988 CCAGCTGAACCCTGAGAAAGACA 0: 1
1: 0
2: 0
3: 29
4: 284
Right 1184298799 22:43543007-43543029 CTGCTTACGATGTAGAAAAGTGG No data
1184298791_1184298799 9 Left 1184298791 22:43542975-43542997 CCCTGAGAAAGACACCACCATGG 0: 1
1: 0
2: 0
3: 15
4: 207
Right 1184298799 22:43543007-43543029 CTGCTTACGATGTAGAAAAGTGG No data
1184298795_1184298799 -5 Left 1184298795 22:43542989-43543011 CCACCATGGGTTCCCACTCTGCT 0: 1
1: 0
2: 1
3: 45
4: 492
Right 1184298799 22:43543007-43543029 CTGCTTACGATGTAGAAAAGTGG No data
1184298788_1184298799 28 Left 1184298788 22:43542956-43542978 CCTTGAGCCACCAGCTGAACCCT 0: 1
1: 0
2: 1
3: 20
4: 200
Right 1184298799 22:43543007-43543029 CTGCTTACGATGTAGAAAAGTGG No data
1184298796_1184298799 -8 Left 1184298796 22:43542992-43543014 CCATGGGTTCCCACTCTGCTTAC 0: 1
1: 0
2: 0
3: 27
4: 214
Right 1184298799 22:43543007-43543029 CTGCTTACGATGTAGAAAAGTGG No data
1184298789_1184298799 21 Left 1184298789 22:43542963-43542985 CCACCAGCTGAACCCTGAGAAAG No data
Right 1184298799 22:43543007-43543029 CTGCTTACGATGTAGAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184298799 Original CRISPR CTGCTTACGATGTAGAAAAG TGG Intronic
No off target data available for this crispr