ID: 1184299713

View in Genome Browser
Species Human (GRCh38)
Location 22:43550246-43550268
Sequence ATCCAGCTGTGTGACCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 5, 3: 29, 4: 258}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184299713_1184299717 22 Left 1184299713 22:43550246-43550268 CCTCCAGGGTCACACAGCTGGAT 0: 1
1: 0
2: 5
3: 29
4: 258
Right 1184299717 22:43550291-43550313 CCTAAGTCCACCTGCCTGAAGGG 0: 1
1: 0
2: 0
3: 9
4: 145
1184299713_1184299715 21 Left 1184299713 22:43550246-43550268 CCTCCAGGGTCACACAGCTGGAT 0: 1
1: 0
2: 5
3: 29
4: 258
Right 1184299715 22:43550290-43550312 ACCTAAGTCCACCTGCCTGAAGG 0: 1
1: 0
2: 2
3: 33
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184299713 Original CRISPR ATCCAGCTGTGTGACCCTGG AGG (reversed) Intronic
900637676 1:3673984-3674006 GACCAGCTGTGTGCCCATGGAGG + Intronic
903283186 1:22261797-22261819 AGCTTGCTGTGTGGCCCTGGGGG + Intergenic
903308452 1:22432052-22432074 ATGCTGCTTTGTGACTCTGGGGG + Intergenic
904461332 1:30682106-30682128 AACCAGCTGGGTGGCCTTGGGGG + Intergenic
904761337 1:32806560-32806582 ATCGTGCTGTGTGACCACGGAGG + Exonic
905871141 1:41405242-41405264 AGCAGGCTGTGAGACCCTGGCGG + Intergenic
907914706 1:58858022-58858044 ATCCAGCTCTGTGCCCCTGGAGG - Intergenic
908083814 1:60609092-60609114 AACCAGCTGTGTGACCTTATGGG + Intergenic
908329112 1:63052886-63052908 TTCCAGCTGTGTGACCTTGGAGG - Intergenic
908899999 1:68945674-68945696 ATGCAGCTGTGTGAAGCTGATGG + Intergenic
910771413 1:90835881-90835903 ATCCAGGGGAGTGACACTGGAGG + Intergenic
911200243 1:95036914-95036936 AGCCAGCTGTGGGATCATGGTGG - Intronic
915569086 1:156734234-156734256 ATGAAGCTGAGTGACCCTGGCGG + Exonic
915598419 1:156908099-156908121 ACCTAGCTGAGTGAGCCTGGCGG - Intronic
916527629 1:165626603-165626625 ATTTAGCTGTGTGACTTTGGGGG - Intergenic
916570365 1:166020258-166020280 TTCCAACTGTGTGATCTTGGGGG - Intergenic
917229355 1:172819306-172819328 TTCTAGCTGTGTGTCCCTTGAGG + Intergenic
919798073 1:201333237-201333259 TACAAGCTGTGTGACCCTGGGGG - Intergenic
921394626 1:214655624-214655646 ATCTTGCTGTGTCACCCAGGTGG + Intronic
921862740 1:220056248-220056270 ATCCACCTGTGTGACTTTTGTGG - Intergenic
922932707 1:229402925-229402947 ATCCAGATGTGTGTTCTTGGGGG - Intergenic
923080402 1:230647980-230648002 AGTTAGCTGTGTGACTCTGGGGG - Intronic
1063036439 10:2290753-2290775 ATCCTCCTGTGTGGCCCAGGTGG + Intergenic
1067048490 10:42999153-42999175 ACCCTCCTGGGTGACCCTGGAGG - Intergenic
1067849144 10:49744012-49744034 GGCCAGCTCTGTGCCCCTGGAGG - Exonic
1068039799 10:51809535-51809557 ATGTAGCTGTGTGACCATTGGGG + Intronic
1070890547 10:79939909-79939931 CCTCAGCTGTGTGTCCCTGGAGG + Intronic
1071255017 10:83864590-83864612 ACCTAGCTGTGTGTGCCTGGAGG + Intergenic
1071749801 10:88461619-88461641 ATCCAGCTGTTGGTCCCTGGAGG + Intronic
1072721914 10:97786463-97786485 AACCAGCTATGTGACCCGGACGG - Intergenic
1073261336 10:102192777-102192799 ATCCACCTGTGTCCACCTGGAGG + Intergenic
1073594896 10:104789827-104789849 CTCTGGCTGTGTGATCCTGGGGG + Intronic
1074414014 10:113251363-113251385 ACCTAGCTGTGTGCCCCTGATGG + Intergenic
1074443967 10:113503134-113503156 CACCAGCTGTGTGATCTTGGGGG - Intergenic
1074492937 10:113955293-113955315 CCCCAGCTGTGGGACACTGGGGG - Intergenic
1074539608 10:114353551-114353573 AACTTGCTGTGTGACCCTGGTGG - Intronic
1074819399 10:117167401-117167423 TACCAGCTGTGTGATCTTGGGGG - Intergenic
1075105406 10:119536916-119536938 ATCCACCTGACTGACCCTGGAGG - Intronic
1075172314 10:120127457-120127479 ACCCAGCTGGGTGGCACTGGGGG + Intergenic
1076675821 10:132147296-132147318 ACACAGCTGTCTGCCCCTGGTGG + Intronic
1076990459 11:270915-270937 AGGCAGCGGTGTGACCCTCGGGG + Intergenic
1078490080 11:11760361-11760383 ATCAAGCTGTCTGACTCTGAAGG - Intergenic
1078655179 11:13232135-13232157 TACCAGCTGTGTGATCTTGGGGG - Intergenic
1078917005 11:15787690-15787712 ATTCAGCTCTGTGCCCCAGGAGG - Intergenic
1079247278 11:18761868-18761890 ATGCAGGTGTGTGAGCCTGGAGG + Intronic
1081703967 11:45169719-45169741 TACCATCTGTGTGACACTGGGGG - Intronic
1083259392 11:61514999-61515021 GTCAGGCTGGGTGACCCTGGAGG + Intergenic
1083397752 11:62402886-62402908 ATTCAACTGTGAGACCCTTGAGG + Intergenic
1083771249 11:64868886-64868908 AACGAGCTGTGTGACCCAGCAGG + Intronic
1083897896 11:65629383-65629405 GTCCAGCTGTGTGACCAGGCGGG - Exonic
1084122827 11:67079227-67079249 TACCAGCTGTGTGACCTTGAAGG + Intergenic
1085694357 11:78691259-78691281 TGCCAGCAGCGTGACCCTGGAGG + Intronic
1086036745 11:82424937-82424959 GTCAAGCTGTGTTACCCTGTAGG - Intergenic
1087216739 11:95502998-95503020 ATCCAGGTGTGAGATCTTGGTGG - Intergenic
1088829165 11:113520601-113520623 ATCCAGCTGTGAGCCCCTCTAGG - Intergenic
1089351038 11:117821916-117821938 CTCCTGCTGTGTGCCCCTCGGGG + Intronic
1090051420 11:123383009-123383031 ATCTTGCTCTGTGACCCAGGAGG - Intergenic
1091201657 11:133785161-133785183 AGCCTGCTGTGAGACCCTGCGGG - Intergenic
1096510863 12:52127448-52127470 CAGAAGCTGTGTGACCCTGGGGG + Intergenic
1096743471 12:53711035-53711057 CTCCAGCTCTTAGACCCTGGTGG - Intronic
1097805400 12:63959819-63959841 TACCAGCTTTGTGACCCTTGAGG - Intronic
1098361657 12:69660080-69660102 AACCAGCTGTGTGATCTTTGGGG + Intronic
1098603236 12:72358978-72359000 ATAAAACTGTGTGAACCTGGTGG - Intronic
1098824397 12:75275170-75275192 ATTCAGCTTTGTGATCCTGGTGG - Intergenic
1099973575 12:89524885-89524907 ATCCAGCGGTCTGGGCCTGGCGG - Intronic
1102023042 12:109697081-109697103 TTCCAGCTGTGCGCCCTTGGGGG + Intergenic
1102252032 12:111394061-111394083 GACCTGCTGTGTGACCTTGGGGG - Intergenic
1102454513 12:113063391-113063413 GTCCAGCTGTGTGAACTGGGTGG - Intronic
1103393394 12:120590182-120590204 TCCCAGTTATGTGACCCTGGAGG - Intergenic
1103467894 12:121156564-121156586 AGCAAGCTGTGTGACCCTGGGGG - Intronic
1103898286 12:124289083-124289105 AGCCAGCTGTGTGTTCTTGGGGG - Intronic
1103919568 12:124392488-124392510 CTCGAGCTGTGTGACTCAGGAGG - Intronic
1103929969 12:124444910-124444932 ATTTGTCTGTGTGACCCTGGGGG + Intronic
1104056595 12:125235405-125235427 ATCCACCTGTGGGCCCATGGAGG + Intronic
1104893408 12:132150840-132150862 CTCCAGCTTTGTGTCCGTGGGGG + Intronic
1106900217 13:34347881-34347903 GTCCAGCTCTGTGACACTGAAGG + Intergenic
1112100443 13:96183312-96183334 CTCCAGGTGTGGGACCCTAGTGG - Intronic
1112258723 13:97858428-97858450 ATCCAGATTTGTAACCCAGGCGG + Intergenic
1112381900 13:98899326-98899348 ATCCAGCTGTATGACTCTGTAGG + Intronic
1112684586 13:101809893-101809915 ATCTAGTTGTGTGACCTTGGGGG - Intronic
1114220094 14:20688771-20688793 TTCCAGTTGTGTGAACCTGGAGG - Intronic
1115707800 14:36015897-36015919 AGCCACCTGTGTGTCCGTGGGGG + Intergenic
1116017155 14:39421043-39421065 ACCCAGCCCTGTGACCCTGGTGG + Intronic
1117172523 14:53114842-53114864 ATCCAGTTTTGTGACCTTGCTGG - Intronic
1118011764 14:61616993-61617015 TTCCAGCTATGTGACCCTGAAGG - Intronic
1120088770 14:80306692-80306714 TTTCAGCTGTGTGTCTCTGGGGG + Intronic
1121517412 14:94561740-94561762 TACCAGCTGTGTGTCCCTGGGGG - Intronic
1122359742 14:101152197-101152219 CTCCAGCAGTGAGACCATGGAGG - Intergenic
1122781586 14:104146078-104146100 CCCCAGCTCTGCGACCCTGGTGG + Intronic
1124004595 15:25785811-25785833 ATCCAGTTCTCTGGCCCTGGTGG + Intronic
1126376439 15:48001619-48001641 ATCCTGCAGGGTAACCCTGGAGG + Intergenic
1126785681 15:52176301-52176323 AACCAGCTGCATGACCCTGAAGG + Intronic
1127045749 15:55023778-55023800 ATACAGCTGTGTGGCAATGGAGG + Intergenic
1127377273 15:58396715-58396737 AACCAGTTTTGTGGCCCTGGGGG + Intronic
1127554290 15:60072225-60072247 AACTAGCTGTGTGATCTTGGAGG - Intergenic
1127994478 15:64145145-64145167 ATCCAGCACTGTCACCCTGCAGG + Intronic
1128277836 15:66368934-66368956 AACTAGCTGTGCGACCTTGGAGG + Intronic
1128744282 15:70102716-70102738 TTCAAGCTATGTGACCTTGGGGG + Intergenic
1129844521 15:78762152-78762174 AGGCAGCTGTCTGACCTTGGGGG - Intronic
1131145765 15:90010777-90010799 ATCTTGCTGTGTCACCCAGGTGG + Intronic
1131607719 15:93926443-93926465 AGACACCTGTGTGACCTTGGGGG + Intergenic
1131839264 15:96418096-96418118 ATGCAGCCGTGTGATCCTGTCGG + Intergenic
1132664967 16:1077355-1077377 CTGGAGCTGTGTGACTCTGGGGG - Intergenic
1133850387 16:9497971-9497993 ATCTTGCTGTGTGTCTCTGGAGG + Intergenic
1138349967 16:56341207-56341229 TACGAGCTGTGTGACCATGGCGG + Intronic
1139477176 16:67208574-67208596 ACCCAGGTGTGGGACCCTCGAGG - Intronic
1141356971 16:83355997-83356019 CACCAGCTGTGTGACCACGGCGG - Intronic
1141389178 16:83650052-83650074 AGGCAGCTGTGTCACCCTTGGGG - Intronic
1141743286 16:85908749-85908771 ACTCAGCTGTATGAACCTGGGGG + Intronic
1142029838 16:87833039-87833061 AGACAGCTGTGTTAGCCTGGGGG + Intronic
1142262019 16:89047498-89047520 ATCCATCTGTGTGGCCGTTGGGG - Intergenic
1142370042 16:89674258-89674280 ATCGAGCTGTGACACCCTTGGGG - Intergenic
1143105089 17:4525528-4525550 ATCTGGCTGTGTGACCCTGGGGG + Intronic
1143470751 17:7173844-7173866 AGCCAGCTGTGGGCCCCAGGAGG + Intronic
1144763375 17:17720048-17720070 TTCCACCTGGGTGTCCCTGGTGG + Intronic
1144957888 17:19028676-19028698 TTCTGGCTGTGTGACCCTGAGGG - Intronic
1144959949 17:19039320-19039342 TGCCAGCTGTGAGATCCTGGGGG + Intronic
1144975211 17:19135204-19135226 TGCCAGCTGTGAGATCCTGGGGG - Intronic
1144977270 17:19145844-19145866 TTCTGGCTGTGTGACCCTGAGGG + Intronic
1147717849 17:42520153-42520175 ATGGTGCTGTGTGACCCTGGAGG - Intronic
1150437842 17:65167888-65167910 TGCTAGCAGTGTGACCCTGGTGG + Intronic
1151401067 17:73856517-73856539 TTCCGGCTCTGTGACCTTGGGGG - Intergenic
1153355646 18:4132444-4132466 TTCTAGCTGTGTGACCCTAGGGG + Intronic
1153909586 18:9695324-9695346 ACACAGATGTGTGACCCTGTGGG - Intergenic
1153955165 18:10089918-10089940 AGCCTGCCGTGTGGCCCTGGTGG + Intergenic
1155644270 18:28058444-28058466 ATACAGTTGCGTGAGCCTGGAGG - Intronic
1155763030 18:29589648-29589670 ATCCAGCTCTGTGCCCTTGCTGG - Intergenic
1157019087 18:43757444-43757466 AACCCACTGTGTGACCTTGGAGG - Intergenic
1157293206 18:46424545-46424567 GTCCAGCTCTAGGACCCTGGCGG + Intronic
1160915869 19:1496229-1496251 ACCCAGCTCTGTGCCCCTGGTGG - Intronic
1161014162 19:1975242-1975264 ATCCAGCTGTGGCTCCCTGACGG - Intronic
1161014505 19:1977095-1977117 ATCCAGCTGGGTCACCGTGTTGG - Intronic
1161308294 19:3578995-3579017 CTCCAGCCGAGGGACCCTGGTGG + Exonic
1162068531 19:8140056-8140078 TTGCAGCTGTGTGACTTTGGAGG - Intronic
1163573696 19:18098416-18098438 AACCAGCAGTGTGACCTGGGGGG + Intronic
1165050734 19:33139908-33139930 TACCAGCTGTGTGACCCTGGGGG + Intronic
1165148799 19:33749278-33749300 GGCCAGCTGTGTGACCTTAGTGG + Intronic
1166122798 19:40695521-40695543 GCCCAGGTGTGTGTCCCTGGGGG - Intronic
1167331290 19:48858059-48858081 CTCCAGCTGTGTGCCACTGTGGG + Intronic
1168318713 19:55495862-55495884 ATGCAGCTGTGTTACCCAGGAGG - Intronic
925256191 2:2490695-2490717 ATAGATCTGTGTAACCCTGGAGG + Intergenic
929572165 2:43029472-43029494 AACCAGCTGTGTGCAGCTGGAGG + Intergenic
929575410 2:43048909-43048931 ATCCAGATGTTTGGCCCTGGGGG + Intergenic
933408459 2:81893569-81893591 TTCTAGTTGTGTGACCTTGGGGG - Intergenic
933890721 2:86766792-86766814 GTCTAGCTGTGTTACCCGGGTGG - Intronic
934529968 2:95079254-95079276 ATCCTGCTGTGTGTCATTGGTGG - Intergenic
934735510 2:96687914-96687936 ACACCGCTGTGTCACCCTGGCGG - Intergenic
934989045 2:98908452-98908474 ATCCAGCTGTGTGGCCAGGAAGG - Intronic
935251479 2:101265758-101265780 ATCCAGCTGTGTGATGGGGGCGG - Intronic
937418498 2:121736606-121736628 ATCCACTTGGGAGACCCTGGAGG + Intronic
938578581 2:132626152-132626174 AACCAGCAGTGTCACCTTGGGGG - Intronic
940082253 2:149816738-149816760 ATCCAGCTGTGCTACCTGGGAGG - Intergenic
944253177 2:197598404-197598426 TTCCAGGTGTGTGATCCAGGTGG + Intronic
944645793 2:201780434-201780456 ACCCTGCTGAGTGTCCCTGGCGG - Intronic
945857571 2:215086726-215086748 ACCCAGCTGTTTGTCCCTGTAGG - Intronic
948617997 2:239213828-239213850 ATCCAGCTGTGTACTCATGGAGG - Intronic
1169137951 20:3209192-3209214 CTGCAGCCCTGTGACCCTGGAGG - Intronic
1169589151 20:7121438-7121460 ACCCTGCCGTGTGACCCTGCTGG + Intergenic
1169878656 20:10324029-10324051 ATACAGGTGTATGACCCCGGAGG + Intergenic
1171186823 20:23128853-23128875 TTCCCACTGGGTGACCCTGGTGG + Intergenic
1171214153 20:23340098-23340120 TCCCAGCTGTGGGCCCCTGGAGG - Intergenic
1172399487 20:34637422-34637444 TTCCAGCTGGGTGACCCATGTGG - Intronic
1172977744 20:38919369-38919391 AGCCAGCTGTGTGACCATCCAGG + Exonic
1173015746 20:39223980-39224002 CTCCAGCTGTGTCACCAGGGAGG - Intergenic
1173143597 20:40506154-40506176 TCCCAGCTGTGTGTCCTTGGAGG - Intergenic
1173626623 20:44477509-44477531 ATCCAGCTGAGAGATGCTGGTGG - Intronic
1177094178 21:16810985-16811007 AGCCAACTCTGTGCCCCTGGAGG - Intergenic
1177099292 21:16879931-16879953 ATCCAGCTCTGTGCCCTTGCTGG - Intergenic
1177767934 21:25480205-25480227 AGCCTGCTGTGTTAGCCTGGGGG - Intergenic
1177789624 21:25708655-25708677 ATCCAGCTGTGGCCCCCTGCTGG + Intronic
1178859759 21:36278972-36278994 AGCCCACTGGGTGACCCTGGGGG + Intronic
1182033990 22:27183326-27183348 AACTTGCTGTGTGACCTTGGTGG + Intergenic
1182444025 22:30379938-30379960 ATTCTGCTCTGTGGCCCTGGGGG + Intronic
1182462984 22:30495417-30495439 ATCCAGCTGTATGACTCGGGTGG - Exonic
1183080025 22:35450390-35450412 AGAGAGGTGTGTGACCCTGGAGG - Intergenic
1183288609 22:36983661-36983683 CACTAGCTGTGTGACCTTGGGGG + Intergenic
1184161734 22:42701125-42701147 AACGAGCTGGGAGACCCTGGGGG - Intronic
1184299713 22:43550246-43550268 ATCCAGCTGTGTGACCCTGGAGG - Intronic
1184557112 22:45239625-45239647 CTGCAGCTGTGTGACCTTAGGGG + Intronic
949177852 3:1088105-1088127 ATCCAACTGGGTGACAGTGGGGG - Intergenic
950046552 3:9951814-9951836 ACTCAGCTGTGTGACCTTGGGGG - Intronic
952129335 3:30342017-30342039 CTCCATCTGTGTGGTCCTGGAGG + Intergenic
952176103 3:30865094-30865116 ATAGAGCTGTGTGAGCTTGGAGG - Intronic
952392379 3:32891374-32891396 ATCCAGCTGTTTGGGCCTGATGG + Exonic
953881252 3:46692563-46692585 ATCTAGCTAGGTGAACCTGGTGG - Intronic
956001806 3:64737833-64737855 AATCAGCTGTGTGAAACTGGAGG + Intergenic
957192475 3:77027676-77027698 AGCCAGCTGTCGGACCGTGGAGG + Intronic
959119994 3:102222114-102222136 ATCCAGCTTTGTGCCCTTGCTGG + Intronic
960052210 3:113249743-113249765 ATCTCTTTGTGTGACCCTGGCGG + Exonic
966633446 3:182105216-182105238 ATCCATCTGTCTGCCACTGGAGG - Intergenic
966937144 3:184718163-184718185 TTCAAGCTGTGGGACCATGGGGG + Intergenic
967017162 3:185492806-185492828 CACAAGCTGTGTGACCCTGAGGG - Intronic
968091604 3:195901492-195901514 ATCCAGCTGGGGGGCCCAGGAGG + Intronic
968782898 4:2596552-2596574 ATCAAGCTATGTGACCCTGAAGG + Intronic
968954262 4:3710265-3710287 TCCAAGCTGTGTGACCTTGGGGG + Intergenic
969545146 4:7821146-7821168 TACCAGCTGTGTGGCCTTGGGGG + Intronic
969942748 4:10750887-10750909 TTCCAGCTCTGTGAGCCTGGTGG - Intergenic
972350408 4:38231366-38231388 TCCTAGCTGTGTGACCTTGGAGG + Intergenic
972594159 4:40515666-40515688 CTCCAGCTGTGTGACCTTGAGGG + Intronic
976716855 4:88132198-88132220 TTCCAGCTGTCTGACCTTGGAGG + Intronic
977252255 4:94702250-94702272 CTCCAGCTGTGAGACCCAGAAGG - Intergenic
979434246 4:120670479-120670501 ATCCAGCTCTGACACCTTGGAGG + Intergenic
985019824 4:185675550-185675572 TGCCAGCTGCATGACCCTGGGGG + Intronic
985141937 4:186849161-186849183 ATCCAGCTGTGGAGGCCTGGGGG + Intergenic
987123974 5:14793746-14793768 AGCCAGCTGTGTGGCCTTGCGGG + Intronic
988748746 5:34174084-34174106 ACCCAGCTCTGTCACCCAGGCGG + Intergenic
988789792 5:34597016-34597038 ATCCTGCTCTGTGTCCCAGGAGG + Intergenic
989730082 5:44638548-44638570 ATCCACCTGTGGGAACCAGGTGG + Intergenic
990619979 5:57549439-57549461 ATCCAGCTCTGTGTCCTTGCTGG + Intergenic
990631624 5:57676496-57676518 ATCCAGCTGTGTGATCTTTATGG - Intergenic
992384429 5:76270097-76270119 ATCCAGATTTATGACCCTGCAGG - Intronic
992615667 5:78543738-78543760 CTCCAGCTGTGTGTTCCTGAAGG - Intronic
993252729 5:85549688-85549710 ATCCAGTTGTGTGACCTTTTTGG - Intergenic
993490344 5:88539268-88539290 CTCCAGCTGTGAGTCTCTGGTGG + Intergenic
994575395 5:101571905-101571927 CACCAGCTGTGTGACTCTTGGGG - Intergenic
995190006 5:109309960-109309982 AACCTGCTCTGTGCCCCTGGAGG - Intergenic
996750134 5:126879913-126879935 AGCCAGCTGTGTGGCACTGCTGG - Intronic
999276879 5:150337371-150337393 ATCCATTTGTATAACCCTGGTGG - Intronic
999568377 5:152891711-152891733 ACCCTGCCGTGTGACCCTGCTGG + Intergenic
999623283 5:153493444-153493466 ATCTAGCTCTGGGACCCTGTGGG - Intronic
1000244221 5:159436140-159436162 AAACAGCTCTGTAACCCTGGGGG - Intergenic
1001493389 5:172171278-172171300 TCCCAGCTGTGTGCCCCTGAGGG + Intronic
1002493686 5:179597787-179597809 TACCAGCTGAGTGGCCCTGGGGG - Intronic
1003191412 6:3878444-3878466 ATCCATGTGGGTGTCCCTGGTGG - Intergenic
1004877951 6:19974795-19974817 ATCCAACTGTGTGAGCCCCGAGG + Intergenic
1005292905 6:24396712-24396734 ATCCAGGTGTGATACCCTGATGG + Intergenic
1006134705 6:31888437-31888459 ATCCAGCCGTGTGGCCCTGATGG - Exonic
1010945749 6:81971037-81971059 ATCCAGTTCTGTGCCCTTGGTGG - Intergenic
1012508936 6:99980402-99980424 ATCCAGTTCTGAGAGCCTGGGGG + Intronic
1013270111 6:108537470-108537492 GCCCAGCTGGGTGACCCTCGGGG + Intergenic
1013379796 6:109557007-109557029 ATCCAGTTCTGTGCCCTTGGTGG + Intronic
1013519942 6:110923843-110923865 ATCCAGTTGTGTGACCTTTTTGG - Intergenic
1016561512 6:145400121-145400143 ATCCATCTGTGGGACCCCTGTGG - Intergenic
1016562108 6:145408256-145408278 ATCCTGCTCTGTGTCCCAGGAGG + Intergenic
1016833509 6:148455223-148455245 ATCCAGATGTGGAACCCTGGAGG + Intronic
1017618378 6:156269474-156269496 ATCCAGCTGTGAGCCCATGAGGG + Intergenic
1018133711 6:160757545-160757567 GCCCAGCTGTGTGTTCCTGGGGG - Intergenic
1018568306 6:165181345-165181367 TTCCAGCTGTGAGGCCCTGTTGG - Intergenic
1018746557 6:166766917-166766939 ACCCAGCTGCGTGGCCCTGTGGG + Intronic
1019414636 7:921704-921726 CTCCGGCTGTGTGACCACGGAGG + Intronic
1019442057 7:1052480-1052502 AACCAGCAGTGTGACTTTGGAGG + Intronic
1020278450 7:6637915-6637937 AGCCCGCTTTGTGACCTTGGGGG + Exonic
1020707734 7:11566948-11566970 ATCCAGCTGTGGGAGAGTGGGGG + Intronic
1022615751 7:31927906-31927928 ATCCAGTTGTGTGCCCTTGTTGG - Intronic
1023358871 7:39395578-39395600 GTCCATCTCTGTGTCCCTGGGGG + Intronic
1024662833 7:51515134-51515156 AGCCAGTTGTGTGAGCATGGTGG + Intergenic
1024794489 7:53004977-53004999 AGCCAGCAGTGTGAACCTGCTGG + Intergenic
1024924447 7:54598623-54598645 ATCCTGTTGTGTGTCCCTGAAGG + Intergenic
1026369246 7:69682473-69682495 TTCTAGCTGTGTAATCCTGGTGG + Intronic
1027004825 7:74684333-74684355 ATCTCGCTGCGTGCCCCTGGGGG - Intronic
1027609099 7:80337505-80337527 ATCCTGCTCTGTACCCCTGGTGG + Intergenic
1029275288 7:99400338-99400360 ATCCAGTTGTGTGACCTTTTTGG + Exonic
1036744232 8:11392813-11392835 CACTAGCTGTGTGGCCCTGGGGG - Intronic
1037514048 8:19611982-19612004 ATCCAGCTTTGTGATTCTGCTGG + Intronic
1039587247 8:38717662-38717684 AGCCAGCTGTGTGATCATTGAGG - Intergenic
1039803679 8:40981296-40981318 AGCCAGATGAGTGACCTTGGAGG - Intergenic
1041105701 8:54441730-54441752 TTCCTCTTGTGTGACCCTGGGGG + Intergenic
1041243841 8:55872497-55872519 ACCCAGCTGTGTGAGGATGGAGG + Intergenic
1048231939 8:132651099-132651121 ATCCAGCTCAGTGACCCTCTGGG + Intronic
1048415621 8:134224926-134224948 TTGCAGCTGTGTGGCCTTGGAGG - Intergenic
1048463039 8:134638778-134638800 ATCCAGTTGTGTGAAGGTGGAGG + Intronic
1048971885 8:139649725-139649747 TCTCAGCTGTGTAACCCTGGGGG + Intronic
1049226037 8:141450927-141450949 AGCTGGCTGTGTGACCTTGGGGG + Intergenic
1049332055 8:142059787-142059809 AACCAGCTGTGCGACCTTGGTGG - Intergenic
1049825922 8:144667708-144667730 TACTAGTTGTGTGACCCTGGTGG + Intergenic
1053154632 9:35768401-35768423 ATGGAGATGTCTGACCCTGGAGG + Intergenic
1053751966 9:41266266-41266288 ATCCACCTCTGTGTCCCTGCTGG - Intergenic
1054257489 9:62830596-62830618 ATCCACCTCTGTGTCCCTGCTGG - Intergenic
1054942883 9:70763136-70763158 ATCCAGCTGAGTGACCTTCCAGG - Intronic
1055665923 9:78553089-78553111 ATCCAGCTCTCTGGCCCTTGAGG - Intergenic
1057053640 9:91945257-91945279 ATATAGCTGTGTGTGCCTGGTGG + Intronic
1058615422 9:106822098-106822120 AACCAGCTGTGTGACTTTGAGGG + Intergenic
1058703686 9:107621555-107621577 ACACAGCTGTGTGACCTGGGGGG - Intergenic
1058764491 9:108168193-108168215 CACCAGCTGTGTGACCTTGAAGG - Intergenic
1059655694 9:116355352-116355374 TGCCAGCTGTGTCACCATGGGGG - Intronic
1059790271 9:117635169-117635191 ATCCAGCTGTGTGCACCTTGAGG + Intergenic
1059913972 9:119077970-119077992 GTCCAGCTGTGTGATCTTGAGGG - Intergenic
1060978010 9:127776734-127776756 GCCTTGCTGTGTGACCCTGGGGG - Intronic
1060984185 9:127810155-127810177 GTCTGGCGGTGTGACCCTGGGGG + Intronic
1061264092 9:129495807-129495829 GGCCGGCTGTGTGACCTTGGGGG - Intergenic
1061404396 9:130385452-130385474 GGTCTGCTGTGTGACCCTGGTGG + Intronic
1061545944 9:131304269-131304291 ACCCTGCTGTGTGGCCTTGGGGG - Intronic
1062261925 9:135667162-135667184 GTCCTGCACTGTGACCCTGGCGG + Intergenic
1062388614 9:136325149-136325171 ATCCAGAAGGGAGACCCTGGAGG - Intergenic
1062400046 9:136368390-136368412 ATCCAGCTGTGCCCCCATGGGGG - Intronic
1188538079 X:31219374-31219396 AACCAGCTGTGTGAACCCAGAGG - Intronic
1189321311 X:40089297-40089319 TACTAGCTGTGTGACCTTGGGGG - Intronic
1190619179 X:52268119-52268141 CTTCAGATGTGTGAGCCTGGAGG + Intergenic
1190636999 X:52445016-52445038 CTTCAGATGTGTGAGCCTGGAGG - Intergenic
1193999937 X:88415680-88415702 ATAAAGCTGTGGGACCTTGGAGG - Intergenic
1198431406 X:136570473-136570495 TTCAAGCTGTGTGACCTTGGGGG - Intergenic
1200335371 X:155345550-155345572 GTTCAGGTGTGTGACCTTGGAGG - Intergenic
1200351097 X:155495671-155495693 GTTCAGGTGTGTGACCTTGGAGG + Intronic