ID: 1184300922

View in Genome Browser
Species Human (GRCh38)
Location 22:43560522-43560544
Sequence AGCATGGCTGCCCCTACCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 182}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184300922_1184300929 16 Left 1184300922 22:43560522-43560544 CCTTGGGTAGGGGCAGCCATGCT 0: 1
1: 0
2: 1
3: 16
4: 182
Right 1184300929 22:43560561-43560583 ATGCCACAGATGCAACTGGCTGG No data
1184300922_1184300930 17 Left 1184300922 22:43560522-43560544 CCTTGGGTAGGGGCAGCCATGCT 0: 1
1: 0
2: 1
3: 16
4: 182
Right 1184300930 22:43560562-43560584 TGCCACAGATGCAACTGGCTGGG 0: 1
1: 1
2: 2
3: 13
4: 177
1184300922_1184300933 29 Left 1184300922 22:43560522-43560544 CCTTGGGTAGGGGCAGCCATGCT 0: 1
1: 0
2: 1
3: 16
4: 182
Right 1184300933 22:43560574-43560596 AACTGGCTGGGACATGGCCCTGG 0: 1
1: 0
2: 2
3: 20
4: 203
1184300922_1184300927 12 Left 1184300922 22:43560522-43560544 CCTTGGGTAGGGGCAGCCATGCT 0: 1
1: 0
2: 1
3: 16
4: 182
Right 1184300927 22:43560557-43560579 CACCATGCCACAGATGCAACTGG 0: 1
1: 0
2: 0
3: 11
4: 147
1184300922_1184300932 23 Left 1184300922 22:43560522-43560544 CCTTGGGTAGGGGCAGCCATGCT 0: 1
1: 0
2: 1
3: 16
4: 182
Right 1184300932 22:43560568-43560590 AGATGCAACTGGCTGGGACATGG 0: 1
1: 0
2: 1
3: 19
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184300922 Original CRISPR AGCATGGCTGCCCCTACCCA AGG (reversed) Intronic
900521432 1:3107157-3107179 AGCAGGGCTGCCATTTCCCAGGG + Intronic
901156875 1:7146132-7146154 ACCATGACTGCCCATCCCCAGGG - Intronic
902063714 1:13666445-13666467 ACCATGGCTGCCCCATCTCAGGG + Intergenic
902737694 1:18412208-18412230 AGCCTGGCTGTACCTCCCCAGGG - Intergenic
904918289 1:33986011-33986033 AGTCTGACTGCCCCAACCCAGGG + Intronic
905675265 1:39820311-39820333 GGTCTGGCTGCCCCTACCCTCGG - Intergenic
905866268 1:41378436-41378458 ACCATGGCTGGCCCAACCCATGG - Intronic
906592011 1:47033850-47033872 AGCATGTATGCCCCTCCCCATGG - Intronic
906692323 1:47800705-47800727 AGAATGCCTGACCCTATCCAGGG + Intronic
907461337 1:54607486-54607508 AGCAGGGCCACCCTTACCCAGGG + Intronic
912623927 1:111192406-111192428 AGCAGTGCTGCCCATGCCCATGG + Intronic
918534577 1:185560001-185560023 AGCCTGGCTGGCCCTATGCAAGG - Intergenic
920295626 1:204954460-204954482 AGAAGGGCTGCCCCTGCCCTTGG + Intronic
920943910 1:210510503-210510525 AGCATGGCTGCCCTGCTCCAGGG - Intronic
922886763 1:229026328-229026350 AGCAGGGCTGCCGTTTCCCAGGG - Intergenic
923270173 1:232348209-232348231 ACCATGCCTGGCCCCACCCAGGG + Intergenic
1064027465 10:11860133-11860155 AGCATGGCTGGCCCTGCCTTGGG + Intronic
1066640931 10:37553451-37553473 AGCAGAGCAGCCCCTAGCCAAGG + Intergenic
1067041056 10:42953475-42953497 AGCATGGAGGGCCCTTCCCAGGG - Intergenic
1067203687 10:44196045-44196067 AGCGTGGCTGACCCTTCCCCAGG + Intergenic
1068608698 10:59034543-59034565 TGCATGCCTGACCCTAACCATGG + Intergenic
1069622829 10:69848317-69848339 AGCAAAGCTGCCACTTCCCAAGG + Intronic
1070706383 10:78642149-78642171 AGCCTGGCTCCCACTTCCCAGGG - Intergenic
1074421716 10:113314944-113314966 AACATGGTTGCCACTGCCCATGG - Intergenic
1075093499 10:119456429-119456451 AGCAGGGCTGTCCATCCCCAGGG + Intronic
1075485983 10:122822367-122822389 TGCCTGGCTGCCCCACCCCAGGG - Intergenic
1075970446 10:126647636-126647658 ACCATCTCTGCCCCTCCCCATGG + Intronic
1077130504 11:969877-969899 AGCTGGGCTGCACCTGCCCAGGG + Intronic
1077186860 11:1239360-1239382 TGCAGGGCAGCCCCTACCCCGGG - Intronic
1077974603 11:7234764-7234786 AGCATGGAAGCACTTACCCAAGG - Intergenic
1079007712 11:16803796-16803818 AGGAAGGCTGGCCTTACCCACGG - Intronic
1079110876 11:17604451-17604473 CACATGGCTGGCCCCACCCATGG - Intronic
1080645452 11:34184654-34184676 AGCATGGCTGCCCCAGCACAAGG + Intronic
1080789654 11:35510907-35510929 AGGATGGCTGCCCATAACCATGG - Intronic
1082895032 11:58181005-58181027 AGCAAAGCTGACCCTACTCAAGG + Exonic
1084687182 11:70703565-70703587 TGCTGGGCTGCCCCTTCCCAAGG + Intronic
1086193367 11:84107624-84107646 AGTATTCCTCCCCCTACCCATGG - Intronic
1088944444 11:114495462-114495484 CTCATGGCCGCCCCTACCCCAGG + Intergenic
1091205940 11:133821156-133821178 AGCAGGGGTGCTCCTGCCCAGGG - Intergenic
1091930123 12:4389317-4389339 AGCCTCGCTGTCCCCACCCAGGG + Intergenic
1092058365 12:5525250-5525272 AGCATGGCTCCTCCTTGCCAAGG - Intergenic
1094218325 12:27969331-27969353 AGCTTGGCAGCCCCTCCCCCTGG + Intronic
1095958152 12:47818456-47818478 TGCTAGGCTGCCGCTACCCATGG - Intronic
1097262461 12:57727276-57727298 AGGACTTCTGCCCCTACCCACGG + Intronic
1097455654 12:59795964-59795986 ATGATGGCTGCCCCTCCCCCAGG - Intergenic
1102547408 12:113666634-113666656 ACCCCGGCTTCCCCTACCCATGG - Intergenic
1102923333 12:116808985-116809007 AGGATGGCCGCCCCATCCCAAGG + Intronic
1103323056 12:120102720-120102742 AGGCTGGCTGCCCCTGCCCCCGG - Intronic
1103344098 12:120237931-120237953 AGCAGGCCTGACCCAACCCAGGG + Intronic
1104489778 12:129183799-129183821 ATCATCCGTGCCCCTACCCAAGG - Intronic
1111867811 13:93791879-93791901 AGCATCGCTGTCTCTTCCCAGGG + Intronic
1112368127 13:98773085-98773107 AGCAGGGCTGCCTCAACCCTTGG + Intergenic
1112588335 13:100739762-100739784 TGCATGTCTTCCCCTACCCCTGG - Intergenic
1113244195 13:108376726-108376748 CGCATGGCTGCCACCACCCCAGG + Intergenic
1113777866 13:112958938-112958960 AGGATGGCTGCACCTCCCCCCGG + Intronic
1115502075 14:34059355-34059377 AGCTCGGCTGCCCTTCCCCAAGG + Intronic
1117722208 14:58638569-58638591 AGCACGGCTGTTCCTGCCCAGGG + Intronic
1119032691 14:71204903-71204925 AGCAGGGCTACCCCTAGGCAGGG + Intergenic
1120628368 14:86857341-86857363 AGTATGGTTGCCCCAAGCCAAGG + Intergenic
1121801257 14:96776041-96776063 AGAATGGCTTCCCCTCCCCAAGG + Intergenic
1122087697 14:99318866-99318888 GGCCTGGCTGCCTCTCCCCAGGG + Intergenic
1122155260 14:99746827-99746849 AGCAGGGCTCCTCCCACCCAGGG + Intronic
1122640352 14:103155904-103155926 AGCATGGCTGCCCCCAGCCCAGG - Intergenic
1122738283 14:103856146-103856168 GGCATGGCGACCCCTACCCCTGG - Intergenic
1123067395 14:105625547-105625569 AGGCTGGATGCCCCTACCCCAGG - Intergenic
1123071411 14:105644271-105644293 AGGCTGGGTGCCCCTACCCCAGG - Intergenic
1123096841 14:105770887-105770909 AGGCTGGATGCCCCTACCCCAGG - Intergenic
1202858189 14_GL000225v1_random:64260-64282 AGCAAGGCTGCCCCGGCACAGGG - Intergenic
1125318632 15:38458753-38458775 AAGAGGCCTGCCCCTACCCAAGG + Intronic
1128756741 15:70188365-70188387 AGGATGGCTGGGCCTCCCCAGGG + Intergenic
1129182366 15:73885347-73885369 AGCATGGCTGGCCAGGCCCAGGG + Intronic
1129937549 15:79463338-79463360 AGCTGGGCTTCCCCCACCCAGGG - Intronic
1131132468 15:89909095-89909117 AGAGTGGCTGCCCTCACCCAGGG - Intronic
1131179578 15:90230766-90230788 AGGAGGGCTGCCCCTGCCCGGGG + Intronic
1132357274 15:101181090-101181112 AGCATGGCTTCCCAGACCCTGGG - Intronic
1132995533 16:2820583-2820605 AGCCAGGCTGCCCCTCCCCCAGG + Intronic
1133892278 16:9891937-9891959 ACCATGCCTGCACCTTCCCACGG - Intronic
1136049186 16:27638501-27638523 ACCTTGGCTGCCCCTAAGCATGG - Intronic
1137596901 16:49730067-49730089 AGCATGGCTTCCACATCCCAGGG + Intronic
1138507482 16:57485609-57485631 AGCCTGCCTGCCCCAAGCCATGG - Intronic
1141368026 16:83462240-83462262 AGCATTGCTTCCCTTTCCCAGGG - Intronic
1142266944 16:89068306-89068328 AGCATTGCTGCAGCTCCCCAAGG + Intergenic
1144023127 17:11254610-11254632 GGCAGGGCTGCCCCTACCTCTGG + Intronic
1145304813 17:21667978-21668000 AGCATGGCTGCCACCATCCTGGG - Intergenic
1148200867 17:45749306-45749328 AGCATGGGTGCCCCTAGCCCAGG + Intergenic
1151385877 17:73755023-73755045 AGCTTGGCAGCCCCAAACCAAGG + Intergenic
1152075177 17:78154939-78154961 AGGATGTCTTCCCCTGCCCAGGG - Intronic
1152247175 17:79191096-79191118 ACCCTTGCTGCCTCTACCCAGGG - Intronic
1152701618 17:81822567-81822589 AGCCTGGGTGCCCCTGCCCAGGG + Exonic
1152871649 17:82757130-82757152 AGCCAGGGTGCCCCCACCCAGGG - Intronic
1154357841 18:13635803-13635825 AGCATGGCTGCCCAGACCCAGGG - Intronic
1157546385 18:48549581-48549603 AGCATGGCTGCCACTGCTCCGGG + Intronic
1158024922 18:52885262-52885284 AGCATCCCTGGACCTACCCAGGG - Intronic
1158312286 18:56171314-56171336 AGACTTGCTGCCCCAACCCATGG - Intergenic
1158445020 18:57511978-57512000 AGCAAGGATGCCCCTTCTCATGG + Intergenic
1158512751 18:58106150-58106172 AGCACGGATGTCCCTACACAGGG - Intronic
1160157832 18:76446958-76446980 AGCAAAGCTGCCTCTGCCCAGGG + Intronic
1161572044 19:5036086-5036108 AGGCTGGCTGCCCCGAGCCAAGG - Intronic
1163293679 19:16398088-16398110 AGCAAGGCTGCCACCACCCTGGG + Intronic
1163754683 19:19099590-19099612 AGCATGGTTGCCCCCACCTCTGG - Intronic
1166268465 19:41699543-41699565 AGCCTGGTTGCCCCCATCCAGGG - Intronic
1166763469 19:45238787-45238809 AGCGGGGCTGCCCATCCCCAGGG + Intronic
1167042727 19:47032226-47032248 AGTCTGGCTGACCCTGCCCAGGG - Intronic
1167579519 19:50333319-50333341 AGCACCGCTCCCCCAACCCAGGG + Intronic
1167771927 19:51526054-51526076 AGCACAGCTGCCTCAACCCAGGG + Intronic
925915213 2:8600000-8600022 ACCATGCCTGTCCCTTCCCAGGG + Intergenic
928027006 2:27748728-27748750 TGCATGGATGCTCCTGCCCACGG + Intergenic
928404895 2:31007177-31007199 AGGATGGCTGCCTCAACCAAGGG + Intronic
928413292 2:31070824-31070846 AGAGAGGCTGGCCCTACCCAGGG + Intronic
929063252 2:37945114-37945136 AGCATTGCTGCCCCTAATAAAGG + Intronic
931585680 2:63824406-63824428 GGCATGGTGGCCCATACCCATGG + Intronic
932115243 2:69040963-69040985 AACATGTCTGTCACTACCCAGGG - Intronic
935657007 2:105431800-105431822 TGCCTGGCTGCTCCTGCCCAAGG + Intronic
938064102 2:128271849-128271871 AGCTTGGCTGCCAAGACCCACGG - Intronic
941884480 2:170514101-170514123 AGCAGGACTGCCCCTCCTCACGG - Intronic
943212839 2:184989927-184989949 GGCATGGCTGCCCCAAACCTTGG + Intergenic
944232264 2:197408368-197408390 AACATGGCTACCCCTACTCCAGG - Exonic
944847582 2:203684148-203684170 AGCAGGGCTGTCCCTCCCCCTGG - Intergenic
946020102 2:216634678-216634700 AGCCTGGCTGCCCCCGTCCAGGG - Intronic
946725428 2:222656980-222657002 AGTATGGCAGCCACAACCCAAGG + Intergenic
948335947 2:237207185-237207207 AGCACGGCTGAACCCACCCAGGG + Intergenic
948503542 2:238411779-238411801 ACCCAGGCTGCCCCTACCCAGGG + Intergenic
1169557787 20:6768345-6768367 AGGATGGCTGCCCCGAGCCATGG + Exonic
1169630703 20:7627456-7627478 AGCATGGCTCCCACTGACCAAGG + Intergenic
1171162316 20:22938984-22939006 AGCATTTCTGGCCCTTCCCATGG + Intergenic
1171239475 20:23553484-23553506 AGCAGGGCAGCCCCATCCCATGG + Intergenic
1171901584 20:30863391-30863413 AGAACGGCTGCCCCTCCCCCTGG + Intergenic
1172446077 20:34994125-34994147 AGCTTGGCTGCCCCTCCCTAGGG + Exonic
1172621569 20:36321116-36321138 AGCATGGGTGCCCTTGCCCTAGG - Intronic
1172630549 20:36375516-36375538 ATCAGAGCTGCCCCTGCCCAGGG + Intronic
1173021079 20:39268742-39268764 AGCATGGCTGGCCAAAACCAAGG - Intergenic
1174146937 20:48458810-48458832 GGCATGGCCGCCCCTGCCCCAGG - Intergenic
1174338710 20:49882918-49882940 AGCCTGGCTGCCCTACCCCATGG + Intronic
1174992116 20:55522659-55522681 AACATGGCTGCCCCTCCCCCAGG + Intergenic
1175731435 20:61357014-61357036 AGCATGGTTGACCCTAACCCTGG - Intronic
1179801318 21:43812733-43812755 GGCATGGCTGGGCCTGCCCAGGG + Intergenic
1179808469 21:43854966-43854988 AGCATGGCCACCCCTCCCCATGG + Intergenic
1180334954 22:11569339-11569361 AGAACGGCTGCCCCTCCCCCTGG + Intergenic
1181163540 22:20971537-20971559 AGGATGGCAGCCCCAGCCCAGGG + Intronic
1181279521 22:21709185-21709207 AGCTTCACTGCCCCTACCCAGGG + Intronic
1181630656 22:24149456-24149478 AGCATGTCTGCCTTTATCCATGG - Intronic
1182442589 22:30372898-30372920 AGAAAGGCTTCCCCTACCCTGGG - Intronic
1182522209 22:30891073-30891095 ACCCTGACTGCCCATACCCAAGG + Intronic
1183573663 22:38673078-38673100 AGCAAGGCCGGCCCTACACACGG - Intronic
1184300922 22:43560522-43560544 AGCATGGCTGCCCCTACCCAAGG - Intronic
954390486 3:50265786-50265808 TCCATGGGGGCCCCTACCCATGG + Intergenic
954798771 3:53175073-53175095 TCCATGGCTTCCCCTACCCCCGG - Intronic
961442160 3:126959586-126959608 AGCAGTGCTGCCCCACCCCAAGG - Intronic
963575647 3:147058572-147058594 AGCATGGCTGCCCCTAGGGGAGG + Intergenic
965600727 3:170452037-170452059 TTCATGGCTGCCCCTCCCCCAGG - Intronic
968619050 4:1595445-1595467 AGCAGGGCTGCCCCACCCCTAGG + Intergenic
969592128 4:8127896-8127918 ACTATTGCTGCCCCTACACATGG - Intronic
970950305 4:21747950-21747972 AGCAAGGCTGCCACAAGCCAAGG + Intronic
982605583 4:157512930-157512952 AGCAAGGATCCCCCTACCCTTGG + Intergenic
991475726 5:67017288-67017310 GGAATAGCTGCCCCTACCTAAGG + Intronic
991522837 5:67519455-67519477 AGCATGGCTTCCCTAACCTAGGG - Intergenic
997508765 5:134438730-134438752 GGCAAGGCTCCCCCTCCCCACGG + Intergenic
1000170754 5:158701066-158701088 AGCATGGCTCTGCCTCCCCAAGG + Intronic
1003513659 6:6801750-6801772 ACCATGGCCGCCCATCCCCATGG - Intergenic
1006139907 6:31922123-31922145 AGCATCTCTGTCTCTACCCAAGG - Intronic
1006374286 6:33663389-33663411 AGCCTGCCTGCCCAAACCCAGGG + Intronic
1007715330 6:43852276-43852298 TGCCTGGCTGCCCCTACCCTGGG - Intergenic
1009915840 6:69994882-69994904 AGCATATCTGACCCTGCCCACGG + Intronic
1012075069 6:94672759-94672781 ACCATGGCTACCCCTCCCCCAGG - Intergenic
1018350776 6:162956641-162956663 AGCAATGCTGCCCCAAGCCAAGG - Intronic
1019700053 7:2470422-2470444 AGCAGGGCAGCCCCTGCCCCCGG - Intergenic
1019783157 7:2956598-2956620 TGTCTGGCTGCCCCTCCCCATGG - Intronic
1020200679 7:6077432-6077454 AGCATGGCTTCCTCACCCCAGGG - Intergenic
1022103582 7:27183418-27183440 ACCTGGGCTGCCCCTTCCCAAGG + Intronic
1022340124 7:29459978-29460000 GGCGTGGCTGCCCCTTTCCAAGG + Intronic
1022469721 7:30674817-30674839 AGCAGGATTTCCCCTACCCAAGG + Intronic
1022508087 7:30919081-30919103 AGCCAGGCTGCCCCTAGCAAGGG + Intronic
1023883393 7:44334486-44334508 AGCATGCCTCCCCCTACCCCAGG + Intronic
1024566076 7:50682036-50682058 AGCAGGGCTGCCTCCAGCCAAGG - Intronic
1025282810 7:57640595-57640617 AGCATGGCTGCCACCATCCTGGG - Intergenic
1025301903 7:57824825-57824847 AGCATGGCTGCCACCATCCTGGG + Intergenic
1029361692 7:100092859-100092881 GGCATCACTGCCCCTTCCCAAGG + Exonic
1029611287 7:101627857-101627879 AGCATGGGTGGCCCCACCCTGGG - Intronic
1030765551 7:113404810-113404832 AGCCTGAGAGCCCCTACCCAGGG - Intergenic
1030937538 7:115603830-115603852 ACCACTGCTGCCCCTATCCATGG + Intergenic
1033221087 7:139526431-139526453 AGCAGGGCTGCTCCTCTCCAGGG + Intronic
1034548504 7:151805100-151805122 AGCACAGCTGCCCCAACTCAAGG - Intronic
1038542943 8:28404068-28404090 AGAATGACTGCCCCTTTCCATGG + Intronic
1038781116 8:30569086-30569108 ATCAGGGCTGCAGCTACCCATGG + Intronic
1039129290 8:34243611-34243633 AGAATGACTGCCCCTGCCAATGG + Intergenic
1040543430 8:48379598-48379620 AGCAGGACTGGCCCTCCCCAGGG + Intergenic
1043730047 8:83666148-83666170 AGCATGTCTGCGCCTCCTCAGGG + Intergenic
1047739968 8:127798493-127798515 AGCATGGCAGCCCTCACCTAAGG - Intergenic
1049434732 8:142581263-142581285 AGCGTGGCTGTCCCAACCGAGGG + Intergenic
1049597235 8:143490297-143490319 AGCCTGGCTGCCCCCAACCCTGG - Intronic
1053434781 9:38067796-38067818 AGCACGCCAGCCCCGACCCAGGG + Intronic
1060377304 9:123128213-123128235 AGCACAGCTGCCCCTGCCTATGG - Exonic
1061588223 9:131582279-131582301 AGCATGGCTGCACATGCTCACGG + Intronic
1062082248 9:134630234-134630256 AGCATGGCGGCCACAAGCCAAGG - Intergenic
1185504336 X:620183-620205 CCCAGGGCTGGCCCTACCCAAGG + Intergenic
1187405121 X:18996805-18996827 CCCATGGCTGCCACTCCCCAAGG + Intronic
1190781461 X:53600261-53600283 AGTATGGATGCTTCTACCCAGGG - Exonic
1193810584 X:86046485-86046507 AACATGGCTGCTCCTAATCATGG + Intronic
1199733092 X:150656369-150656391 AGATTGGCTGCCCCAAGCCAAGG + Intronic
1201921824 Y:19241810-19241832 AGCATGGATGCTCCCATCCAGGG + Intergenic