ID: 1184301748

View in Genome Browser
Species Human (GRCh38)
Location 22:43564970-43564992
Sequence CAGGGTGAACAGAAGCAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1884
Summary {0: 1, 1: 8, 2: 176, 3: 506, 4: 1193}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184301748_1184301758 4 Left 1184301748 22:43564970-43564992 CCCCCCTGCTTCTGTTCACCCTG 0: 1
1: 8
2: 176
3: 506
4: 1193
Right 1184301758 22:43564997-43565019 TGTGCATGCCCTTTGCCAGGGGG 0: 1
1: 0
2: 1
3: 23
4: 191
1184301748_1184301763 14 Left 1184301748 22:43564970-43564992 CCCCCCTGCTTCTGTTCACCCTG 0: 1
1: 8
2: 176
3: 506
4: 1193
Right 1184301763 22:43565007-43565029 CTTTGCCAGGGGGGGCTTTGTGG 0: 1
1: 0
2: 0
3: 14
4: 176
1184301748_1184301759 5 Left 1184301748 22:43564970-43564992 CCCCCCTGCTTCTGTTCACCCTG 0: 1
1: 8
2: 176
3: 506
4: 1193
Right 1184301759 22:43564998-43565020 GTGCATGCCCTTTGCCAGGGGGG 0: 1
1: 0
2: 3
3: 14
4: 174
1184301748_1184301760 6 Left 1184301748 22:43564970-43564992 CCCCCCTGCTTCTGTTCACCCTG 0: 1
1: 8
2: 176
3: 506
4: 1193
Right 1184301760 22:43564999-43565021 TGCATGCCCTTTGCCAGGGGGGG 0: 1
1: 0
2: 3
3: 21
4: 201
1184301748_1184301755 1 Left 1184301748 22:43564970-43564992 CCCCCCTGCTTCTGTTCACCCTG 0: 1
1: 8
2: 176
3: 506
4: 1193
Right 1184301755 22:43564994-43565016 CTGTGTGCATGCCCTTTGCCAGG No data
1184301748_1184301756 2 Left 1184301748 22:43564970-43564992 CCCCCCTGCTTCTGTTCACCCTG 0: 1
1: 8
2: 176
3: 506
4: 1193
Right 1184301756 22:43564995-43565017 TGTGTGCATGCCCTTTGCCAGGG 0: 1
1: 0
2: 1
3: 31
4: 238
1184301748_1184301757 3 Left 1184301748 22:43564970-43564992 CCCCCCTGCTTCTGTTCACCCTG 0: 1
1: 8
2: 176
3: 506
4: 1193
Right 1184301757 22:43564996-43565018 GTGTGCATGCCCTTTGCCAGGGG 0: 1
1: 0
2: 1
3: 11
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184301748 Original CRISPR CAGGGTGAACAGAAGCAGGG GGG (reversed) Intronic
900191573 1:1354397-1354419 CAGGATGAAGAGCAGCAGCGTGG + Exonic
900548494 1:3241827-3241849 CAGCGTGGACAGAGGGAGGGCGG + Intronic
900751864 1:4402948-4402970 CAGGGACAAGACAAGCAGGGTGG + Intergenic
900800755 1:4735675-4735697 CAGGGAGCAGAGGAGCAGGGAGG - Intronic
900818275 1:4867053-4867075 GAGTGTGAGCCGAAGCAGGGTGG - Intergenic
900819406 1:4874642-4874664 GAGGGTGAACAGGAGCTGGTGGG + Intergenic
901186357 1:7375869-7375891 CAGGGTGGACAGAAGGGGGCAGG + Intronic
901760439 1:11467732-11467754 AAAGGTGAACAGATGCAGGAAGG + Intergenic
902873474 1:19327548-19327570 CTGGGTGAACAGATGGAGGGAGG - Intronic
902965170 1:19995849-19995871 GAGGGTGAGCAAAAGCAGGGTGG - Intergenic
902965213 1:19996072-19996094 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
903281934 1:22255039-22255061 CACGGTGAGCAAAGGCAGGGAGG + Intergenic
903566994 1:24275047-24275069 GAAGGTGAGCCGAAGCAGGGTGG - Intergenic
903765154 1:25729272-25729294 CAGGGTGGAGAGCAACAGGGGGG - Intronic
903918544 1:26782645-26782667 CAGGCAAAGCAGAAGCAGGGAGG - Intergenic
904625611 1:31800225-31800247 CAGGGTGGACTGGAGGAGGGAGG - Intronic
905102786 1:35540196-35540218 AAAGGGAAACAGAAGCAGGGAGG - Intronic
905405803 1:37731642-37731664 AAGGGTGAACAGGAACAGGGAGG + Intronic
905447134 1:38034773-38034795 CAGGGTGAAGAGAGGCAAGATGG - Intergenic
905871595 1:41407535-41407557 CAGGGTGAACATGAGAAGGATGG - Intergenic
906579634 1:46925692-46925714 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
906604089 1:47153196-47153218 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
906843177 1:49161347-49161369 GAGGGTGACCCAAAGCAGGGCGG - Intronic
907005677 1:50910846-50910868 GAGTGTGAGCCGAAGCAGGGCGG - Intronic
907310262 1:53535016-53535038 AAGCATGAACAAAAGCAGGGAGG + Intronic
907323497 1:53620357-53620379 CAGGGTGAACAGAAAATGGGCGG + Intronic
907600040 1:55760235-55760257 GAGGGTGAGCCGAAGCAGGTGGG + Intergenic
908584706 1:65555007-65555029 GAGGGTGAGCTGAAGCAGGATGG - Intronic
908592788 1:65651826-65651848 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
908724154 1:67157091-67157113 GAGAGAGAGCAGAAGCAGGGTGG - Intronic
908813579 1:68009057-68009079 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
908903776 1:68985231-68985253 GTGGGAGAGCAGAAGCAGGGTGG + Intergenic
908976323 1:69903322-69903344 GAGGGCGAGCGGAAGCAGGGTGG + Intronic
909156968 1:72090759-72090781 CAGGGAGAAAACAAGCAGGCAGG - Intronic
909261311 1:73492131-73492153 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
909374393 1:74923686-74923708 CAGAATGAAGAAAAGCAGGGTGG + Intergenic
909384159 1:75036509-75036531 GAGGGTGAGCACAAGCAGGGTGG + Intergenic
909448971 1:75777735-75777757 GAGGGTGAGCTGAAGCAAGGTGG + Intronic
909462003 1:75927511-75927533 AAGGGTGAACAGAGGTTGGGAGG + Intronic
909493209 1:76248105-76248127 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
909992546 1:82240449-82240471 GAGAGTGAAGAAAAGCAGGGTGG - Intergenic
910231204 1:84988903-84988925 CTGGGGGAACAGCAGTAGGGTGG - Intronic
910318835 1:85921105-85921127 GAGGGTGAACCAAATCAGGGTGG + Intronic
910330918 1:86071855-86071877 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
910383558 1:86657589-86657611 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
910606339 1:89088831-89088853 GAGGGCGAACAGAAGCAGGGTGG - Intergenic
910626852 1:89316477-89316499 GAGGGTGAGCAGAAGCAAGGTGG + Intergenic
910635784 1:89405728-89405750 GAGAGCGAGCAGAAGCAGGGTGG - Intergenic
910827916 1:91428731-91428753 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
910930295 1:92436730-92436752 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
911270572 1:95797057-95797079 GAGGGTGAGGTGAAGCAGGGTGG + Intergenic
911339308 1:96617828-96617850 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
911342039 1:96651403-96651425 GAGGGTGAGCTGAAGAAGGGCGG + Intergenic
911530626 1:99039398-99039420 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
911541435 1:99162530-99162552 GAGGGTGAGCTGAAGCAGGCTGG - Intergenic
911689766 1:100820102-100820124 GAGGGTGAGCCAAAGCAGGGCGG + Intergenic
911982676 1:104586216-104586238 GAGGCAGAGCAGAAGCAGGGTGG + Intergenic
912235253 1:107844165-107844187 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
912315783 1:108666674-108666696 GAGGGGGAGCAAAAGCAGGGAGG - Intergenic
912516643 1:110220478-110220500 GAGGGTGAGCAGAGGGAGGGAGG - Intronic
912636155 1:111295731-111295753 GAGGGTGAGCCAAAGCAGGGTGG + Intronic
912675714 1:111679235-111679257 GAGGGCTAGCAGAAGCAGGGTGG + Intronic
912894948 1:113576453-113576475 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
912904497 1:113689610-113689632 CAGGGAGAAGGGATGCAGGGAGG + Intergenic
913102815 1:115584819-115584841 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
913108742 1:115639768-115639790 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
913113192 1:115674116-115674138 CAGTGTGAGCAGAAACAGGCTGG - Intronic
913507134 1:119527158-119527180 ATGAGTGAGCAGAAGCAGGGTGG - Intergenic
914457972 1:147854715-147854737 GAGGGCAAGCAGAAGCAGGGAGG + Intergenic
914683506 1:149958000-149958022 GAGCGTGAGCCGAAGCAGGGCGG - Intronic
915061443 1:153188947-153188969 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
915077398 1:153320399-153320421 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
915651520 1:157315405-157315427 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
915654570 1:157348567-157348589 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
915765277 1:158355937-158355959 CGGGGTGAGCAGGAGCAGCGGGG + Exonic
915771858 1:158433341-158433363 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
916038426 1:160941874-160941896 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
916215374 1:162389106-162389128 CAGTGCAAACAGTAGCAGGGAGG - Intergenic
916251816 1:162746145-162746167 GAGTGTGAGCTGAAGCAGGGTGG + Intronic
916362788 1:163990127-163990149 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
916469559 1:165109539-165109561 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
916612881 1:166410202-166410224 GAGGGCGAGCAGAAGCAGAGTGG - Intergenic
916718515 1:167464665-167464687 CAGGGTGAGTAGAAGAAGAGGGG + Intronic
916731678 1:167572196-167572218 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
917006978 1:170426318-170426340 ATGGGTGAGCAGAAGCAGGGTGG + Intergenic
917019293 1:170569019-170569041 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
917023455 1:170614823-170614845 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
917041550 1:170810893-170810915 GAGGGTGAGCCAAAGCAGGGCGG + Intergenic
917163231 1:172080921-172080943 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
917192377 1:172431760-172431782 GAGGGTGAGCCAAAGCAGGGCGG + Intronic
917405894 1:174708489-174708511 AAGGATTAACAGAAGCAGGGTGG + Intronic
917505141 1:175620580-175620602 CAGAGAGAAAAGAAGCAGAGGGG + Intronic
917585058 1:176417440-176417462 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
917893786 1:179466086-179466108 GAGTGTGAGCTGAAGCAGGGCGG - Intronic
918163278 1:181920580-181920602 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
918353760 1:183684884-183684906 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
918632154 1:186730806-186730828 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
919031649 1:192250732-192250754 CAGGGAGAACAGAAACAAGCTGG - Intergenic
919061634 1:192641481-192641503 CAGGGAGGACAGAAACAAGGAGG - Intronic
919063967 1:192668932-192668954 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
919836138 1:201574781-201574803 GAGGATAAACAGAGGCAGGGAGG - Intergenic
920503742 1:206501831-206501853 AAGGGGGGACAAAAGCAGGGAGG - Intergenic
920781047 1:208991599-208991621 GAGTGTGAGCCGAAGCAGGGTGG + Intergenic
920985508 1:210885255-210885277 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
920993192 1:210959879-210959901 GAGGGCGAGCTGAAGCAGGGCGG - Intronic
921455494 1:215365914-215365936 GAGAGTGAGCTGAAGCAGGGCGG - Intergenic
921626101 1:217379514-217379536 GAGGGCAAACAGAAGCAGGGTGG + Intergenic
921631261 1:217437077-217437099 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
921962153 1:221047279-221047301 GAGGGTGAACAGAAGTAGGGTGG + Intergenic
921976253 1:221206728-221206750 GAGGGCGAGCTGAAGCAGGGTGG + Intergenic
922014410 1:221630506-221630528 GAGGAGGGACAGAAGCAGGGAGG + Intergenic
922066129 1:222145642-222145664 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
922179542 1:223223312-223223334 CAGGGTTGTCCGAAGCAGGGTGG + Exonic
922396719 1:225209845-225209867 AAGGGCGAGCAGAAGCAGGGTGG + Intronic
922406298 1:225316647-225316669 GAGGGAGAACTGAAGCAGGGTGG - Intronic
922715928 1:227872034-227872056 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
923067062 1:230527567-230527589 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
923194501 1:231652061-231652083 CAGGGTGAGCCGAAGCAGGGCGG - Intronic
923482233 1:234396456-234396478 CAGGGTGAAGAGAGGGACGGAGG - Intronic
923690997 1:236192635-236192657 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
923853345 1:237820368-237820390 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
924253486 1:242158610-242158632 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
924276453 1:242392377-242392399 CAGGGTGAACATGTGCAGGTTGG - Intronic
924440625 1:244082540-244082562 GAGGGAGAAGAGAGGCAGGGAGG + Intergenic
924823188 1:247513807-247513829 GAGGGTGAGCAGAAAGAGGGTGG - Intronic
924829092 1:247573484-247573506 GAGGGTGAACAGAAGCAGGGTGG - Intronic
924878144 1:248128451-248128473 GAGAGTTAGCAGAAGCAGGGTGG + Intergenic
924883390 1:248187685-248187707 GAGAGTGAGCAGAAGCAGGATGG + Intergenic
924894120 1:248317260-248317282 GAGAGTGAGCAGAAGCAGAGTGG - Intergenic
1062785091 10:257973-257995 CAGGGTGAGCAGAGGCTGGCTGG + Intergenic
1062961984 10:1579071-1579093 CAGGGTAAACTGAGGCAGTGTGG - Intronic
1063666127 10:8061820-8061842 CAGGGTGCCCAGGAGCCGGGTGG + Intronic
1064264641 10:13815641-13815663 CAGGGTCAACAGAGGTAGAGTGG - Intronic
1064492925 10:15878513-15878535 GAGGGGGAGCTGAAGCAGGGCGG - Intergenic
1065076082 10:22080592-22080614 GAAGGTGAGCTGAAGCAGGGTGG - Intergenic
1065076874 10:22089421-22089443 GAAGGTGAGCTGAAGCAGGGTGG + Intergenic
1065121067 10:22530754-22530776 GAGGGCAAACAGAAGCCGGGTGG - Intergenic
1065427332 10:25619328-25619350 GAGGGTGAGCCGACGCAGGGTGG + Intergenic
1065766642 10:29036543-29036565 CAGAAGGAACAGAAGCAGGAAGG + Intergenic
1065799081 10:29334796-29334818 GAGGGTGAACTGAAATAGGGCGG + Intergenic
1065907566 10:30271962-30271984 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1066140866 10:32502354-32502376 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
1066159578 10:32714246-32714268 GAGGGCGAGCAGAAGCAGGGTGG + Intronic
1066162959 10:32754794-32754816 GAGTGTGAGCTGAAGCAGGGCGG + Intronic
1066176415 10:32912318-32912340 GAGTGTGAGCCGAAGCAGGGCGG + Intronic
1066257728 10:33696580-33696602 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1066550710 10:36553263-36553285 CAGTGTGATCAGAGGCAGGGTGG + Intergenic
1066615468 10:37289057-37289079 CAGGGTGAGCAGAAGCAGGATGG - Intronic
1066751218 10:38659332-38659354 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1066965826 10:42263759-42263781 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1066993574 10:42540000-42540022 GAGGGTGAGCCGAAGCAGGATGG - Intergenic
1067332353 10:45333919-45333941 GAGGGTGAACTGAGGCAGGGTGG - Intergenic
1068022340 10:51601001-51601023 GAGGGGGAAAAGAAGAAGGGAGG + Intronic
1068357188 10:55923806-55923828 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1068453612 10:57226407-57226429 CAGGAAGAGCAGAAGTAGGGAGG + Intergenic
1068470046 10:57448782-57448804 GAGGGTGACCTGAAGCATGGTGG - Intergenic
1068478008 10:57552244-57552266 GAGTGTGAGCCGAAGCAGGGTGG - Intergenic
1068495306 10:57778992-57779014 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1068575076 10:58675980-58676002 GAGAGTGAGCAGAAGCAGGGTGG + Intronic
1068646105 10:59470265-59470287 GAGGGCGAGCCGAAGCAGGGTGG + Intergenic
1068651560 10:59528342-59528364 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1068759324 10:60690255-60690277 GAGGGCGAGCTGAAGCAGGGCGG + Intronic
1068789200 10:61008873-61008895 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1069120899 10:64567792-64567814 GAGGGTGAGCAGAAGTAGGGAGG - Intergenic
1069264372 10:66438988-66439010 GAGGGTGACCCGAAGCAGGGTGG - Intronic
1069307467 10:66988848-66988870 TAGGGTGGAGAGAAACAGGGAGG - Intronic
1069349056 10:67503263-67503285 GAGGGTGAGCCAAAGCAGGGTGG - Intronic
1069355944 10:67585031-67585053 GAGTGTGAGCTGAAGCAGGGCGG - Intronic
1069881070 10:71593781-71593803 CAGGCTGCACAAAAACAGGGAGG - Intronic
1070213086 10:74347277-74347299 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1070234542 10:74609533-74609555 AAGGGCGAGCGGAAGCAGGGTGG - Intronic
1070349175 10:75575716-75575738 GAGGGTGAGCCGAAGCAGGAGGG + Intronic
1070509468 10:77147426-77147448 CAGGGGGAAGGGAAGGAGGGAGG - Intronic
1070662189 10:78315001-78315023 CAGGTTGAACAGTAGAAGGAAGG - Intergenic
1070753676 10:78978363-78978385 CAGCGTGAACAAAACCAGGGAGG - Intergenic
1070843649 10:79505200-79505222 CAGCGTGAGCAGGAGCATGGAGG - Intergenic
1070930017 10:80254400-80254422 CAGCGTGAGCAGGAGCATGGAGG + Intergenic
1070999653 10:80817722-80817744 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1071207131 10:83294432-83294454 AAGCGTGAGCCGAAGCAGGGCGG + Intergenic
1071480532 10:86061669-86061691 CAGGAGGGACAGAAGCAGGCTGG - Intronic
1071698530 10:87903819-87903841 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1071838538 10:89444776-89444798 GAGGGGGAGCCGAAGCAGGGTGG + Intronic
1071844275 10:89505596-89505618 GAGGGTGAGCCGAAGCAGAGTGG + Intronic
1071922934 10:90371792-90371814 GAGGGTGAGCTGAAGCAGGCGGG - Intergenic
1072044795 10:91643987-91644009 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1072374527 10:94800991-94801013 GAGGGTGAGCTGAAGAAGGGTGG - Intronic
1072375767 10:94814079-94814101 GAGGCTAAACTGAAGCAGGGAGG - Intronic
1072389643 10:94969730-94969752 GAGGCTAAACTGAAGCAGGGAGG - Intronic
1072404324 10:95136032-95136054 GAGGGAGAGCAGAAGCAGGGTGG + Intergenic
1072480600 10:95807481-95807503 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1072493788 10:95934683-95934705 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1072617513 10:97059535-97059557 CAAGGTGAGCAGAAGGAGAGGGG + Intronic
1072709169 10:97704652-97704674 CAATGTGACCAGAAGCATGGTGG + Intergenic
1072775107 10:98183011-98183033 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
1072838018 10:98737557-98737579 TGGGGTGAGCAGAAGCAGGGTGG - Intronic
1072876093 10:99174959-99174981 GAAGGCGAGCAGAAGCAGGGTGG + Intronic
1072953664 10:99870273-99870295 GAGGGTGAGCAGAAGCAGAGTGG - Intergenic
1074015463 10:109529867-109529889 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1074017248 10:109546441-109546463 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1074117852 10:110471009-110471031 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1074631503 10:115259588-115259610 GAGGGCGAGCCGAAGCAGGGTGG - Intronic
1074795594 10:116939461-116939483 AAGGGTGAGCTGAAGCAAGGTGG - Intronic
1075064827 10:119282379-119282401 CAGGGGGAACAGCAGCACTGGGG - Intronic
1075175387 10:120155855-120155877 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1075212405 10:120502345-120502367 AAGGGGGAAGAGAAGGAGGGAGG + Intronic
1075260463 10:120959016-120959038 CTGGGTGAACAGAAGACAGGTGG - Intergenic
1075575853 10:123576972-123576994 CAGAGTGAACAGAATGAGAGGGG + Intergenic
1075805396 10:125184955-125184977 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1076063447 10:127430424-127430446 CATGGTGAGGAGAAGCAGTGTGG + Intronic
1076230145 10:128813457-128813479 GAGGGTGGAAGGAAGCAGGGAGG + Intergenic
1076266007 10:129110447-129110469 CAGCTTGCACAGAGGCAGGGAGG - Intergenic
1076389706 10:130090259-130090281 GAGGGACAACTGAAGCAGGGTGG + Intergenic
1076489253 10:130845838-130845860 GAGGATGAACACAAGGAGGGTGG + Intergenic
1076493610 10:130881783-130881805 AAGGGTGAAGACAAGCAGGAAGG - Intergenic
1076751741 10:132546776-132546798 CAGGGAGAACAGTGGCTGGGCGG - Intronic
1077097809 11:806531-806553 TGGGGTGAATGGAAGCAGGGAGG - Intronic
1077474995 11:2782165-2782187 GAGGATGAACAGCAGCACGGCGG - Intronic
1077508386 11:2942727-2942749 CAGGGTGAACAGTCACAGGAAGG + Intergenic
1077799584 11:5524748-5524770 GAGGGTAGACAGAAACAGGGAGG - Intronic
1078283793 11:9930770-9930792 GAGGGTGAGCCGAAGCAGCGTGG + Intronic
1078392987 11:10952555-10952577 GAGGGTCAGCCGAAGCAGGGTGG - Intergenic
1078796841 11:14600714-14600736 GAGGGCGAGCAGAAACAGGGTGG - Intronic
1078809509 11:14743856-14743878 GAGGGCGAGCAGATGCAGGGTGG - Intronic
1078981133 11:16536474-16536496 GAGGGTGAGCTGAAGAAGGGCGG + Intronic
1078987346 11:16608409-16608431 CAGGGAGAAGACAAGAAGGGTGG + Intronic
1079165277 11:18035090-18035112 CAGGCTGCACAGCAGCAGGTGGG - Intronic
1079463742 11:20708309-20708331 GAGTGTGAGCCGAAGCAGGGCGG - Intronic
1079517789 11:21289357-21289379 GAGGGTGAGCCAAAGCAGGGTGG + Intronic
1079577783 11:22025130-22025152 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1079714815 11:23731737-23731759 GAAGGCGAGCAGAAGCAGGGTGG + Intergenic
1079867821 11:25758137-25758159 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1080033697 11:27688705-27688727 GAGGGTGAGCCAAAGCAGGGTGG - Intronic
1080334464 11:31180546-31180568 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1080709982 11:34737670-34737692 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1080818231 11:35779410-35779432 GAGTGTGAGCTGAAGCAGGGTGG - Intronic
1080891020 11:36409367-36409389 CAACAAGAACAGAAGCAGGGTGG - Intronic
1080917350 11:36673564-36673586 GAGTGTGAGCTGAAGCAGGGTGG + Intergenic
1080965703 11:37211410-37211432 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
1081095042 11:38921610-38921632 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
1081118198 11:39231917-39231939 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1081221505 11:40469226-40469248 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1081252436 11:40851431-40851453 GAGGGTAAGCAGAAGCAGGGTGG - Intronic
1081269284 11:41064767-41064789 CAGAGGGAGCAGAAGCAGGGTGG + Intronic
1081317804 11:41651379-41651401 GAGGGCGAGAAGAAGCAGGGTGG - Intergenic
1081493043 11:43581695-43581717 CAGGGGGAACTGGAGCAGGTGGG + Intronic
1081587453 11:44397130-44397152 GAGTGTGAGCCGAAGCAGGGTGG - Intergenic
1081958972 11:47119427-47119449 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
1082011510 11:47452864-47452886 CAGGCTCAACAGAGGCAGAGTGG + Intergenic
1082287167 11:50330069-50330091 AAGCGTGAGCCGAAGCAGGGTGG - Intergenic
1082614147 11:55338069-55338091 CAGGGAGAACAGAAACAAGTTGG - Intergenic
1082633022 11:55562752-55562774 CAGATTGAATAGAAGTAGGGAGG - Intergenic
1082670624 11:56032970-56032992 GTGGGTGAGCAGAAGCAGGGTGG + Intergenic
1082729880 11:56782640-56782662 GAGGGCGATCAGAAACAGGGTGG + Intergenic
1082867161 11:57910713-57910735 CAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1082872225 11:57953829-57953851 GAGGTTGAGCAGAAGCAGGGTGG - Intergenic
1082876400 11:57992971-57992993 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1083003716 11:59321429-59321451 GAGGGTGAGCTGAAGAAGGGTGG - Intergenic
1083079822 11:60079648-60079670 CAGGGTGAGGAGGAGCAGAGGGG - Intergenic
1083385607 11:62306956-62306978 GAGGGTGAGCTGAAGTAGGGTGG - Intergenic
1083497023 11:63064401-63064423 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1083503490 11:63133285-63133307 GAGGGTAAGCTGAAGCAGGGTGG - Intronic
1083506960 11:63167027-63167049 GAGGGTAAGCTGAAGCAGGGTGG + Intronic
1083510140 11:63201990-63202012 GAGGGTGAGCAGAAGCAGGTTGG + Intronic
1083516310 11:63262107-63262129 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
1083776902 11:64898446-64898468 CAGCGTGTTCAGAGGCAGGGTGG - Intronic
1083896870 11:65624459-65624481 CAGGGTGAACACTGGCAGGGAGG - Exonic
1084359557 11:68660683-68660705 CAGGGTGAGCAGAGGAAGGCAGG + Intergenic
1084375728 11:68776101-68776123 CTGAGTGAAAAGAAGCAGGCAGG + Intronic
1084585508 11:70059383-70059405 CAGATTGAATAGAAGTAGGGAGG + Intergenic
1084732459 11:71082210-71082232 CAGCGTGAACAGCAGCCAGGTGG - Intronic
1084943669 11:72627498-72627520 CAGTGTGAGCAAAGGCAGGGAGG + Intronic
1085199263 11:74691858-74691880 CAGGGTGAGGGGAAGCAGGGTGG + Intergenic
1085260220 11:75200312-75200334 CAGGCTGACCAGGAGCAGGAAGG - Exonic
1085282514 11:75340454-75340476 CAGGGAGGAAAGGAGCAGGGAGG + Intronic
1085433718 11:76480762-76480784 GAGGGTGAGCCAAAGCAGGGTGG + Intronic
1085461867 11:76698930-76698952 CTGGGTGGACAGCAGCAGGCAGG - Intergenic
1085620541 11:78034849-78034871 GAGAGTGAATAAAAGCAGGGTGG - Intronic
1085827575 11:79864549-79864571 GAGGGTGAGCCAAAGCAGGGAGG + Intergenic
1086086116 11:82956681-82956703 GAGGGTGAGCTGAAGCAGCGTGG - Intronic
1086117279 11:83266277-83266299 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1086298187 11:85395426-85395448 GAGGGTGAGCTGAAGCAGGGCGG + Intronic
1086414622 11:86576436-86576458 AAGGGTGAATAGAAGCAGAATGG - Intronic
1086421830 11:86644906-86644928 GAGGGTGAACAGAAGCAGGGTGG + Intronic
1086456913 11:86968064-86968086 GAGGGTGAGCCGAAGTAGGGTGG - Intergenic
1086494325 11:87386668-87386690 GAGGGTGAGCCGAAGCAGGGCGG + Intergenic
1086506334 11:87508221-87508243 GAGGGTGAGTTGAAGCAGGGTGG - Intergenic
1086608371 11:88724752-88724774 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1086612913 11:88778425-88778447 GAGGGTGAGCCAAAGCAGGGTGG - Intronic
1086812073 11:91322271-91322293 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
1086907403 11:92433528-92433550 GAGGGTGAGCAAAAGTAGGGTGG - Intronic
1086923878 11:92618445-92618467 GAGTGTGAGCCGAAGCAGGGCGG - Intronic
1087311111 11:96545152-96545174 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1087728128 11:101746447-101746469 AAGGGTGAAAAGGAGGAGGGAGG - Intronic
1087831057 11:102820212-102820234 GAGGGTAAGCAGGAGCAGGGTGG - Intergenic
1087925058 11:103910443-103910465 GAAGGTGAGCTGAAGCAGGGTGG + Intronic
1088078379 11:105879186-105879208 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1088702462 11:112425917-112425939 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1089129552 11:116201008-116201030 CCGGGAGAGCAGAAGCATGGAGG + Intergenic
1089534224 11:119150631-119150653 CACAGTGCTCAGAAGCAGGGAGG + Intronic
1089603706 11:119629570-119629592 ATGGGTGGACAGAGGCAGGGTGG + Intronic
1089766113 11:120766748-120766770 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1090103822 11:123830192-123830214 CAGGGCGAGCCAAAGCAGGGCGG - Intergenic
1090124873 11:124075399-124075421 CAGGATGATCAGCAGCAGAGAGG - Intergenic
1090216347 11:124968628-124968650 GAGGGTGAACCGAAGCAGGGTGG - Intronic
1090321049 11:125844258-125844280 GAGAGTGAGCAAAAGCAGGGTGG + Intergenic
1090720326 11:129466893-129466915 GAGGGCGGGCAGAAGCAGGGTGG + Intergenic
1090811620 11:130249640-130249662 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1090898724 11:131005766-131005788 CAGTGTGAACAGAATCACGTAGG + Intergenic
1091213613 11:133885545-133885567 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1091558854 12:1594997-1595019 CCGGGTGAAAAGAAGCCGGGTGG - Intronic
1092064601 12:5579466-5579488 CAGTGTGAGCAAAAGCATGGTGG + Intronic
1092273831 12:7044210-7044232 CAGTGTGCACAGCAGCAGGGAGG - Intronic
1092304277 12:7283398-7283420 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1092398876 12:8154208-8154230 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1092440320 12:8495749-8495771 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1092510435 12:9149887-9149909 CAAAGTGAATAGAAGCAGAGAGG - Intronic
1092567777 12:9686143-9686165 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1092581765 12:9849879-9849901 GAGGCTGAGCCGAAGCAGGGTGG - Intergenic
1092629031 12:10358826-10358848 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
1092637479 12:10467195-10467217 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1092661963 12:10748206-10748228 GAGGGTGAGCCGAAGCAGGGCGG - Intergenic
1092711313 12:11340388-11340410 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
1093545137 12:20336924-20336946 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1093608165 12:21119737-21119759 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
1093677592 12:21962348-21962370 GAGGGTGAGCCAAAGCAGGGCGG + Intergenic
1094292437 12:28867048-28867070 GATGGTGCAGAGAAGCAGGGTGG - Intergenic
1094311784 12:29092519-29092541 GAGAGTGAGCTGAAGCAGGGTGG + Intergenic
1094387266 12:29908895-29908917 AAGGAGGAACAGAAGAAGGGAGG - Intergenic
1094694826 12:32808121-32808143 CAGGGAGAACAGAACCAAGTTGG - Intronic
1094755313 12:33462572-33462594 CTGGTTGAGCCGAAGCAGGGTGG + Intergenic
1094757774 12:33492412-33492434 GAGGGTGAGCTGAAGAAGGGTGG + Intergenic
1094776231 12:33731194-33731216 CAGGGTGAATGGAAACAAGGTGG - Intergenic
1095140504 12:38657048-38657070 GAGGGTGAGCTGAAGCAGTGCGG + Intronic
1095230579 12:39734203-39734225 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
1095356334 12:41280059-41280081 GAGGGCGAGCAGAAGCAGGGTGG + Intronic
1095488407 12:42708037-42708059 GAGGGTGAGCTGAGGCAGGGTGG + Intergenic
1095547449 12:43388326-43388348 GAGGGTGAACAGAAGCAGGCAGG - Intronic
1095595218 12:43950995-43951017 GAGAGTGAGCAGAAGCAGGGTGG + Intronic
1095798397 12:46246177-46246199 GAGGGTGAGGCGAAGCAGGGCGG + Intronic
1095831545 12:46591964-46591986 GAGGGCTAGCAGAAGCAGGGTGG - Intergenic
1095920699 12:47526870-47526892 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1096504769 12:52085825-52085847 TGGGGTGAACAGATGCTGGGTGG + Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096950069 12:55459456-55459478 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1097364892 12:58701475-58701497 GAGGGTGAGCCAAAGCAGGGTGG + Intronic
1097365767 12:58710341-58710363 GAGGGTGAGCCAAAGCAGGGCGG - Intronic
1097654516 12:62343692-62343714 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
1097700968 12:62819946-62819968 GAGGGCGAGCCGAAGCAGGGTGG + Intronic
1097737301 12:63196360-63196382 AAGAGTGAACCGAAGCAGGGTGG + Intergenic
1097898884 12:64853786-64853808 GAGGGTAAGCTGAAGCAGGGTGG - Intronic
1097948884 12:65403900-65403922 GAGGGGGAGCCGAAGCAGGGTGG - Intronic
1098176073 12:67792603-67792625 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1098268394 12:68746421-68746443 CAGGTTGAACAGGAGCCCGGCGG - Exonic
1098382597 12:69884492-69884514 GAGGGTGGACAGGGGCAGGGAGG - Intronic
1098438866 12:70497491-70497513 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1098635535 12:72780040-72780062 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1098706810 12:73702165-73702187 GAGTGTGAGCAGAAGCAGGGTGG + Intergenic
1099022610 12:77424846-77424868 GAGGATGAGCCGAAGCAGGGTGG - Intergenic
1099071449 12:78049504-78049526 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1099107809 12:78518769-78518791 GAGGGCAAACAGAAGCAGGGTGG + Intergenic
1099183841 12:79497156-79497178 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1099216608 12:79861482-79861504 GAGGGCGAGCTGAAGCAGGGCGG + Intronic
1099236185 12:80084562-80084584 GAGGGCGAACTGAAGCAGGGTGG - Intergenic
1099253801 12:80290186-80290208 GAGGGTGAGCAGAAGCAGGGCGG - Intronic
1099486331 12:83233109-83233131 GAGGGTGAGCGGAAGCAGGGTGG - Intergenic
1099491947 12:83299592-83299614 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1099512687 12:83556526-83556548 GAGGGTGAGCTGAAGGAGGGTGG - Intergenic
1099554694 12:84097277-84097299 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1099697548 12:86040975-86040997 GAGGGTGAGTTGAAGCAGGGTGG - Intronic
1099740332 12:86626890-86626912 GAGGGTGAGCCAAAGCAGGGTGG + Intronic
1099745056 12:86690608-86690630 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1099820319 12:87700731-87700753 GAGGGTGAGCCGAAGCAGGGCGG - Intergenic
1100417104 12:94389641-94389663 GAGGGTGAGCTGAAGCAGGGCGG + Intronic
1100482921 12:94996517-94996539 AAGGGAGAACAGAAGAAAGGAGG + Intronic
1100739962 12:97581235-97581257 GAGGGTGAGCAAAAGCAGGGTGG + Intergenic
1100768822 12:97898597-97898619 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1100900758 12:99238069-99238091 GAGGGCGAGCTGAAGCAGGGCGG + Intronic
1100965698 12:100010900-100010922 GAGTGTGAGCTGAAGCAGGGCGG + Intergenic
1101301754 12:103489922-103489944 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1101601335 12:106212697-106212719 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1102244814 12:111348535-111348557 CAGGGTGAAGAGGAGCAGGGGGG - Exonic
1102345658 12:112159484-112159506 GAGGGTGATCTGAAGCAGGGTGG - Intergenic
1102783541 12:115585520-115585542 CTGGGAGGACAGATGCAGGGAGG + Intergenic
1103169238 12:118799447-118799469 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1103324665 12:120112373-120112395 GAGGTTGAACTGAAGCAGAGAGG - Intronic
1103614425 12:122143164-122143186 GAGGGTGAGGAGAGGCAGGGAGG - Exonic
1104175417 12:126326621-126326643 AAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1104206378 12:126642690-126642712 GAGGGTGAAGCAAAGCAGGGCGG - Intergenic
1104735184 12:131132083-131132105 CAGGGTGATGAGCAGCTGGGGGG + Intronic
1104736530 12:131138851-131138873 CAGCGTGGACAGATGCATGGGGG + Intronic
1104900047 12:132184737-132184759 CAGGGTGGAGAGAAGCAGGCTGG - Intergenic
1105201328 13:18182309-18182331 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1105509268 13:21037805-21037827 CAGGGTGGTCAGGACCAGGGCGG + Intronic
1105737463 13:23285904-23285926 GAGGGTGAGCCAAAGCAGGGTGG - Intronic
1105777887 13:23679999-23680021 GAGGGGGCACAGAAGCTGGGAGG + Intergenic
1106153103 13:27125627-27125649 GAGGGTGAGCGGAAGCAGGGTGG + Intronic
1106326389 13:28694178-28694200 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1106336667 13:28789462-28789484 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1106378893 13:29216655-29216677 CAGGGTGAGCAGAAGCAGGGTGG - Intronic
1106426676 13:29636955-29636977 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1106429339 13:29665429-29665451 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1106874309 13:34055080-34055102 GAGGGTGAGCAGAAGCAGAATGG - Intergenic
1106983946 13:35322393-35322415 GTGGGTGAGCTGAAGCAGGGTGG - Intronic
1107243355 13:38264499-38264521 GAGAGTGAGGAGAAGCAGGGTGG + Intergenic
1107473538 13:40713148-40713170 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1107661463 13:42643464-42643486 GAGAGTGAAGAAAAGCAGGGTGG - Intergenic
1107674164 13:42777244-42777266 AACGGTGAGCAGAAGAAGGGTGG - Intergenic
1107730933 13:43348074-43348096 CAGCATGAGCAGATGCAGGGAGG - Intronic
1107829191 13:44359415-44359437 GAGGGTGAAAAGTAGGAGGGAGG - Intergenic
1108217645 13:48200901-48200923 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1108262879 13:48675943-48675965 GGGGGTGAGCAGAAGCAGAGTGG - Intronic
1108304519 13:49118200-49118222 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1108850197 13:54718706-54718728 GAGGACGAGCAGAAGCAGGGTGG - Intergenic
1108940488 13:55947500-55947522 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1108940719 13:55949185-55949207 CAGGGAGAACAGAACCAAGTTGG + Intergenic
1108998236 13:56762990-56763012 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1109195846 13:59376967-59376989 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1109293661 13:60504784-60504806 GAGGGCGAGCAGAAGCAGAGTGG + Intronic
1109457570 13:62612017-62612039 GAGGGTGAGCAGAAGCAGGGAGG - Intergenic
1109661682 13:65467716-65467738 GAGGGCGAGCAGAAGCAGAGCGG - Intergenic
1109806598 13:67452421-67452443 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1110019873 13:70457150-70457172 GAGGGCGAGCAGATGCAGGGTGG + Intergenic
1110071511 13:71184434-71184456 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1110135438 13:72062263-72062285 GAAGGTGAGCCGAAGCAGGGTGG + Intergenic
1110737234 13:78951372-78951394 GAGGGTGAGCAGAAGTTGGGTGG - Intergenic
1110824598 13:79957955-79957977 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1110968689 13:81733369-81733391 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1111627873 13:90813046-90813068 CAGGATGAGCAAAAGCAGGGTGG + Intergenic
1111634994 13:90892541-90892563 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1112165766 13:96918541-96918563 GAGGGTGAGCAGAAGCAGAGTGG + Intergenic
1112232346 13:97602014-97602036 AAGGGAGAGCTGAAGCAGGGTGG + Intergenic
1112412091 13:99173291-99173313 GAGGGCGAGCTGAAGCAGGGCGG - Intergenic
1112620232 13:101047220-101047242 GAGGGGGAACAGAAGCAGGGTGG - Intergenic
1113300974 13:109018792-109018814 GAGGGTGAGCTGAAGCAGAGCGG - Intronic
1113348833 13:109508280-109508302 GAGGGTGAGCCAAAGCAGGGCGG - Intergenic
1113381226 13:109808032-109808054 CACGGTGCACAGAAGCAGCCTGG + Intergenic
1113383079 13:109821272-109821294 CAGGAAGAGCAGATGCAGGGAGG - Intergenic
1113383871 13:109829344-109829366 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
1113394457 13:109933719-109933741 CAGGGTGAAGAGGAGGAGTGTGG - Intergenic
1113488058 13:110669736-110669758 GAGTGTGAGCCGAAGCAGGGTGG + Intronic
1113762532 13:112859574-112859596 CAGGGTGCCCAGCAGCAGGCGGG + Intronic
1113975668 13:114225627-114225649 GAGGGAGAAGAGAAGGAGGGAGG + Intergenic
1114677563 14:24453874-24453896 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
1114695561 14:24624010-24624032 AAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1114741672 14:25104411-25104433 GAGGGCGGGCAGAAGCAGGGTGG + Intergenic
1114744901 14:25136567-25136589 AAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1114844817 14:26308758-26308780 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1114981252 14:28168139-28168161 GAAGGTGAGCTGAAGCAGGGCGG + Intergenic
1115123174 14:29961335-29961357 GAGCGTGAGCTGAAGCAGGGTGG - Intronic
1115135820 14:30107103-30107125 GAGCGTGAACTGAAGCAGGGTGG + Intronic
1115277153 14:31621584-31621606 GAGGGTGAGCCAAAGCAGGGTGG - Intronic
1115357083 14:32460429-32460451 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1115359894 14:32488807-32488829 CAAGGGGAGCAGAAGCAGGGTGG - Intronic
1115511184 14:34139486-34139508 GAGGGTGAGCCAAAGCAGGGTGG + Intronic
1115537968 14:34391353-34391375 GAGGGTGAGCCAAAGCAGGGTGG + Intronic
1115584555 14:34797828-34797850 CAGGGCGAGCCAAAGCAGGGCGG + Intronic
1115584560 14:34797843-34797865 CAGGGCGGGCCGAAGCAGGGCGG + Intronic
1115743172 14:36409562-36409584 GAGGGTGAGCCAAAGCAGGGAGG + Intergenic
1115762536 14:36589874-36589896 CAGGGTGAAGGGAAGGAGGAAGG + Intergenic
1115912249 14:38269255-38269277 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
1115940422 14:38602126-38602148 GAGGGCGAGCCGAAGCAGGGTGG - Intergenic
1115974491 14:38981488-38981510 GAGGGCGAGCAGAAGCAAGGTGG - Intergenic
1116272848 14:42794770-42794792 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1116401813 14:44516134-44516156 GAGGGTCAGCTGAAGCAGGGCGG - Intergenic
1116433680 14:44873929-44873951 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1116511964 14:45757051-45757073 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1116565323 14:46438329-46438351 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1116634410 14:47377388-47377410 GAGTGTGAGCCGAAGCAGGGTGG + Intronic
1116671441 14:47847332-47847354 CAGGGAGAACAGAACCAAGTTGG + Intergenic
1116775639 14:49178319-49178341 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1116808302 14:49514786-49514808 CTGGGTGAGGAGAAGCAGTGCGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117005724 14:51419151-51419173 GAGGGTGATCTGAAGCAGGGCGG - Intergenic
1117104184 14:52381982-52382004 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1117120976 14:52568149-52568171 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1117172312 14:53113581-53113603 GAGAGTGAGCAGAAGCATGGTGG + Intronic
1117237893 14:53798052-53798074 GAAGGTGAACTGAAGCAGGGTGG + Intergenic
1117511329 14:56454612-56454634 GAGTGTGAGCCGAAGCAGGGTGG + Intergenic
1117617170 14:57545357-57545379 AAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1117624134 14:57618382-57618404 GAGGGTAAGCAGAAGCAGGGTGG + Intronic
1117850145 14:59958904-59958926 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1117887608 14:60381772-60381794 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1117900674 14:60529262-60529284 GAGGGCGAGCTGAAGCAGGGCGG - Intergenic
1118333290 14:64831047-64831069 GAGGGGGAAAAGAAGCAGTGGGG - Intronic
1118348073 14:64954230-64954252 AAGAGTGAAGAGAAGGAGGGAGG + Intronic
1118450015 14:65892217-65892239 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1118516178 14:66530754-66530776 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
1118544869 14:66874801-66874823 CAGGGAGAACAGAACCAAGTTGG + Intronic
1118830002 14:69421977-69421999 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1119719694 14:76882706-76882728 CAGGGGAAGCAGAAGCAGGCAGG - Intergenic
1119942506 14:78656406-78656428 CAGGGTGAGCAAAGGCATGGAGG + Intronic
1120450125 14:84655878-84655900 GAAGGTGAGCCGAAGCAGGGTGG - Intergenic
1120478962 14:85024318-85024340 CAGTGTGAGCCGAAGCAGGGCGG - Intergenic
1120624964 14:86813768-86813790 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1121017757 14:90558708-90558730 CAGTGTGAACAGAGGCCGGCAGG - Intronic
1121470676 14:94151835-94151857 GAGGGTGAGCTGAAGCAGGTTGG - Intronic
1121602219 14:95213766-95213788 CAGGATGAGCAGAAGCAATGGGG - Intronic
1122409105 14:101517039-101517061 AAGGGGAAACAGAAGAAGGGAGG + Intergenic
1122443403 14:101750223-101750245 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1122917935 14:104867354-104867376 CAGGGAACACAGAGGCAGGGCGG - Intronic
1123449343 15:20350281-20350303 CAGGGTGACCAGATGCTGGCCGG - Intergenic
1124084119 15:26531195-26531217 CAGGGCAAGCAGAAACAGGGTGG + Intergenic
1124474759 15:30023180-30023202 GAGGGTGAGCAGAATCAGGGTGG - Intergenic
1124624705 15:31301204-31301226 CAAGGTGAACAAAGGCAGTGGGG - Intergenic
1124718783 15:32093645-32093667 CCAGGTGAACAGAGGCAGGTGGG - Intronic
1124885666 15:33683655-33683677 GAGGGTGAGCCAAAGCAGGGTGG + Intronic
1124948451 15:34292986-34293008 GAGGGTGAGCCAAAGCAGGGTGG - Intronic
1125219478 15:37317223-37317245 AAGGGTGAACTGAAGCAGGGTGG + Intergenic
1125288432 15:38119567-38119589 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125352202 15:38779549-38779571 TAGGGCGAGCTGAAGCAGGGCGG - Intergenic
1125354632 15:38803768-38803790 GAGGGTGAGCTGAAACAGGGTGG - Intergenic
1125609123 15:40958938-40958960 CAGGGTGAGGAGAGCCAGGGTGG + Intergenic
1125750255 15:42023036-42023058 CAGCATGAACACAGGCAGGGAGG + Intronic
1125784210 15:42301206-42301228 GAGGGCGAGCCGAAGCAGGGTGG + Intronic
1125984678 15:44038699-44038721 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1126050750 15:44682937-44682959 GAGGGTGAGCCAAAGCAGGGTGG + Intronic
1126087092 15:45021058-45021080 GAGGGTGAGCCGAAGCAGGGAGG - Intergenic
1126476280 15:49068697-49068719 GAGGGTGAGCCAAAGCAGGGCGG + Intergenic
1126720044 15:51568953-51568975 GAGGTTGAGCTGAAGCAGGGTGG + Intronic
1126742030 15:51786998-51787020 GAGGGTGAGCTGAAGCAGGGCGG + Intronic
1126923535 15:53555290-53555312 CACGGAGGACAGAGGCAGGGCGG + Intronic
1126956128 15:53935664-53935686 GAGGGTGAGGAAAAGCAGGGTGG + Intergenic
1127179395 15:56399130-56399152 GAGGGTGAACTGAAGCAGAGTGG + Intronic
1127253920 15:57271561-57271583 GAGGGTGAGCTGAATCAGGGTGG - Intronic
1127448253 15:59088205-59088227 CAGGGTGAACAGGTGAAGGGAGG + Intronic
1127452608 15:59131474-59131496 GAGGGCGAGCAGAAGTAGGGTGG + Intergenic
1127608063 15:60609907-60609929 CAATGAAAACAGAAGCAGGGAGG + Intronic
1127846824 15:62877605-62877627 TAAGGTGATCAGAAGCAGGTGGG + Intergenic
1128454551 15:67825366-67825388 GGGGGTGAAGAGAAGGAGGGGGG - Intronic
1128857595 15:71032273-71032295 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1128883590 15:71265299-71265321 GAGGCTGAGCTGAAGCAGGGTGG + Intronic
1129126685 15:73447838-73447860 GGGGGTGAGCCGAAGCAGGGTGG + Intronic
1129495680 15:75977609-75977631 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
1130128147 15:81111660-81111682 CAGGGTGATGAGAGGCAGAGGGG - Intronic
1130330523 15:82918656-82918678 CAGGGAGAACAGCAGCAGGGAGG - Intronic
1130515957 15:84625927-84625949 CAGGGTGAACAGGGGCACTGAGG - Intronic
1130751206 15:86715024-86715046 CAGGGAGTACAGAGGCATGGTGG - Intronic
1130987539 15:88854605-88854627 CAGGGAGAAAGGAAGGAGGGAGG - Intronic
1131113156 15:89777513-89777535 GAGGGTGGAAAGTAGCAGGGTGG + Intronic
1131439899 15:92451849-92451871 GATGGTGATCAGGAGCAGGGAGG - Intronic
1132096325 15:98987830-98987852 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1132211543 15:100027073-100027095 CAGGGTGAACAACAGTCGGGAGG + Intronic
1132287809 15:100678162-100678184 CAGGGAGAACAGAACCAAGTTGG - Intergenic
1132462572 16:62715-62737 CAGGGTGGACACAGGCAGGAAGG + Intronic
1133555745 16:6904937-6904959 CTGGGTAAACAAAAGCAGTGGGG + Intronic
1133887418 16:9843648-9843670 CTGGGTTGACAGAAGCAGAGTGG - Intronic
1134071851 16:11265169-11265191 CAGGGTGAACAGGTGAAGGGAGG - Intronic
1135512026 16:23094017-23094039 GAGGGTGAGCTGAAGCAGAGTGG + Intronic
1135864978 16:26092761-26092783 GAGGGTGAGCTGAAGCAGGGCGG + Intronic
1135960356 16:26989904-26989926 CAGGGTGAGGAAAAGGAGGGCGG - Intergenic
1136731506 16:32417773-32417795 GAGGGTGAGCTGAAGCAAGGTGG - Intergenic
1137046098 16:35663892-35663914 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1137558462 16:49488319-49488341 CAGAGTGCCCAGAAGCAGGCAGG - Exonic
1138151468 16:54661507-54661529 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1138702545 16:58879089-58879111 GAGCGTGAGCCGAAGCAGGGTGG - Intergenic
1138799673 16:60012812-60012834 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
1138843739 16:60539567-60539589 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1138886830 16:61090613-61090635 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1139222146 16:65194541-65194563 GAGGGCGAGCAGAAGAAGGGTGG - Intergenic
1139852857 16:69961399-69961421 CAGGGAGAAGAGAAGCAGACGGG + Intronic
1139881828 16:70184307-70184329 CAGGGAGAAGAGAAGCAGACGGG + Intronic
1140165154 16:72543351-72543373 GAGGGCGAGCGGAAGCAGGGTGG + Intergenic
1140370682 16:74411199-74411221 CAGGGAGAAGAGAAGCAGACGGG - Intronic
1141562274 16:84877417-84877439 CACTGTGAACAGGAGCAAGGGGG - Exonic
1141626928 16:85266336-85266358 TTGGCTCAACAGAAGCAGGGAGG - Intergenic
1141817819 16:86425011-86425033 CAGGATGAACAGCAGCAGGAGGG + Intergenic
1142220389 16:88851530-88851552 GAGGGTGAGCCGAAGCAGGGTGG + Intronic
1142346594 16:89557978-89558000 CAGGGAGGGCAGAAGCAAGGGGG - Intergenic
1202994886 16_KI270728v1_random:99497-99519 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1203021573 16_KI270728v1_random:411839-411861 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1142501412 17:335262-335284 CAGGGTGAACAGTGGGAAGGAGG + Intronic
1142695027 17:1628775-1628797 CCGGGTGAGCTGCAGCAGGGAGG - Intronic
1142899253 17:3002307-3002329 AGGGGTGATGAGAAGCAGGGGGG + Intronic
1143186173 17:5011827-5011849 CAGCCTGGACAGAAGCATGGAGG - Intronic
1143350154 17:6282160-6282182 AAGGCTGAATAGATGCAGGGAGG + Intergenic
1143376868 17:6472172-6472194 CAGGGAGAACAGCAGGAGCGAGG - Intronic
1143427225 17:6849497-6849519 AAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1143964254 17:10745347-10745369 ATGTGTGGACAGAAGCAGGGGGG - Intergenic
1144293984 17:13855635-13855657 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1144371699 17:14597627-14597649 GAGGGTGACCAGAAGTAGAGTGG + Intergenic
1144434202 17:15224397-15224419 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1144658974 17:17056202-17056224 CAGGTAGGACAGAAGCACGGTGG - Intronic
1145278959 17:21454757-21454779 GGTGATGAACAGAAGCAGGGAGG - Intergenic
1145284867 17:21497929-21497951 GAGGGAGAACTGAAGAAGGGTGG + Intergenic
1146285487 17:31571652-31571674 TGGGGTGGACAGAAGGAGGGCGG + Intronic
1146727230 17:35166330-35166352 CAGGGTGAGCAGAAGCCGTGGGG - Intronic
1146746419 17:35334220-35334242 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1146826056 17:36024056-36024078 GAGGGTGAGCAGGAGCAGGGTGG - Intergenic
1146939115 17:36831784-36831806 GAGGGTGCAGAGAAGCAGAGTGG + Intergenic
1147118485 17:38320789-38320811 CAGAGTGAAAAAAAGCTGGGAGG - Intronic
1148466342 17:47867292-47867314 GAGGGTGAAGAGAAGCAATGAGG + Intergenic
1148777460 17:50103751-50103773 CTGTGTGAACAGAAGCGTGGAGG + Intronic
1148858244 17:50590817-50590839 CAAGGTCAACAGGAGCAAGGTGG - Intronic
1148967293 17:51446817-51446839 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1149093914 17:52817520-52817542 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1149168238 17:53779838-53779860 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1149268545 17:54953394-54953416 CAGGTTACACAGAAGAAGGGGGG - Intronic
1149281358 17:55108703-55108725 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1149320089 17:55473472-55473494 CAGATTGAATAGAAGTAGGGGGG - Intergenic
1149365373 17:55938837-55938859 GAGGGTGAGCAGAAGCAGGTTGG + Intergenic
1149509970 17:57232297-57232319 CAGGGTGAGGAGAGGCAGGATGG + Intergenic
1149932094 17:60767167-60767189 GAGGGCGAGCCGAAGCAGGGTGG - Intronic
1150025802 17:61673194-61673216 GAGGGCGAGCCGAAGCAGGGTGG + Intergenic
1150215669 17:63467573-63467595 CAGAGTTAACAGAAGCAGCCGGG + Intergenic
1150545690 17:66155236-66155258 GAGGGCGAGCCGAAGCAGGGTGG + Intronic
1150884543 17:69070438-69070460 GAGGGGGAGCAGAAGCAGGGTGG + Intergenic
1151064277 17:71132289-71132311 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1151095528 17:71493243-71493265 CAGGGTGGGGTGAAGCAGGGGGG - Intergenic
1151512970 17:74572908-74572930 CTGGGTGACAAGAAGCAGTGAGG + Intergenic
1151719735 17:75848164-75848186 GAGGGTGGACAGAGGCCGGGAGG + Intronic
1151908701 17:77066896-77066918 CATGGTGGGCAGAGGCAGGGCGG - Intergenic
1151943356 17:77306209-77306231 CATGGTGATCAGATACAGGGAGG + Intronic
1152103114 17:78314271-78314293 CAGGGTGAGCGGGAGGAGGGAGG + Intergenic
1152496552 17:80676799-80676821 CATGGAGAACAGAGTCAGGGAGG + Intronic
1152704307 17:81834814-81834836 CAGGGTGACCTGGAGCAGGTGGG - Exonic
1153119114 18:1700113-1700135 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1153166093 18:2263488-2263510 CAGGGTTAACTGACGCACGGGGG - Intergenic
1153313495 18:3700418-3700440 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
1153717933 18:7869491-7869513 GAGGGAGAGCAGAAGCAGGGTGG - Intronic
1153743381 18:8151951-8151973 GAGGGCGAGCCGAAGCAGGGTGG - Intronic
1153798378 18:8646574-8646596 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1153941605 18:9983109-9983131 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1154101629 18:11479728-11479750 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
1154288623 18:13084596-13084618 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1154288817 18:13086479-13086501 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
1154401622 18:14043552-14043574 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
1155037768 18:22039635-22039657 TAGGGTGCACAGAAACTGGGGGG - Intergenic
1155161647 18:23201041-23201063 CAGGGAGAGCAGAAGCAGGAAGG + Intronic
1155395227 18:25379923-25379945 GAGGGCGAGTAGAAGCAGGGTGG + Intergenic
1155488573 18:26373788-26373810 CTGGGTGAACAGAGGGAGGGAGG - Intronic
1155659333 18:28228969-28228991 GAGGATGAGCTGAAGCAGGGTGG - Intergenic
1156084482 18:33382533-33382555 GACAGTGAGCAGAAGCAGGGTGG + Intronic
1156332214 18:36132957-36132979 GAGAGTGAGCAGAAGCAGGTGGG + Intronic
1156582282 18:38392416-38392438 GAGGGTGAGCAGAAGCTGGGTGG + Intergenic
1156979368 18:43266070-43266092 CAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1157025274 18:43835640-43835662 GAGGGTGAGCTGAAGCGGGGTGG + Intergenic
1157067380 18:44367246-44367268 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1157068030 18:44374709-44374731 GAAAGTGAGCAGAAGCAGGGTGG + Intergenic
1157178952 18:45478279-45478301 TAGGGCGAGCAGAAGCAGGGTGG - Intronic
1157327352 18:46678687-46678709 CAGGGAGAAAGGAAGGAGGGAGG + Intronic
1157695190 18:49716748-49716770 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1157752177 18:50189095-50189117 AAGGCTGAAAAGAAGCATGGAGG - Intronic
1157780615 18:50435399-50435421 GAGGGTGAGGTGAAGCAGGGTGG + Intergenic
1159570421 18:70105462-70105484 GACTGTGAGCAGAAGCAGGGCGG - Intronic
1159581237 18:70236565-70236587 GAGGGTGAGCAGAAGCAAGGTGG + Intergenic
1159661305 18:71098416-71098438 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1159690673 18:71483304-71483326 GAGGGCGAGCCGAAGCAGGGAGG - Intergenic
1159901685 18:74053098-74053120 GAGGGTGAGCAGAAGCAGCGTGG + Intergenic
1160497243 18:79382839-79382861 AAGGGTGGACAGGAGCAGGGCGG - Intergenic
1161167360 19:2795446-2795468 GAGGATGAACAGCAGCAGGAGGG - Intronic
1161827152 19:6575681-6575703 CAGATTGAATAGAAGCAGGGAGG - Intergenic
1162832163 19:13292136-13292158 CAGGGTGGACAAAATGAGGGTGG - Intronic
1163130728 19:15271203-15271225 CAGTGGGAACTGAAGCAGGGAGG - Intronic
1163192212 19:15685473-15685495 CTGGGAGAACAGAAACAGAGTGG - Intronic
1163207564 19:15814804-15814826 CAGGGTGTAAAGAATCAGGGTGG - Intergenic
1163702130 19:18791231-18791253 CAGGGTGAGCAGAAGAACGCAGG + Exonic
1163989799 19:20988043-20988065 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
1164047622 19:21555931-21555953 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
1164085677 19:21899944-21899966 GTGGGTGAGCCGAAGCAGGGTGG - Intergenic
1164091494 19:21956802-21956824 GAGTGTGAGCCGAAGCAGGGTGG - Intronic
1164133225 19:22384910-22384932 GAGAGTGAGCCGAAGCAGGGCGG - Intergenic
1164152429 19:22566448-22566470 GAGAGTGAGCTGAAGCAGGGTGG - Intergenic
1164165587 19:22671846-22671868 GAGAGTGAGCCGAAGCAGGGCGG + Intergenic
1164441814 19:28284865-28284887 GAGGGTGGAGAGAAGGAGGGTGG + Intergenic
1164517412 19:28948127-28948149 ATGGGTGCACAGAAGCAGTGGGG + Intergenic
1164905191 19:31961378-31961400 CATGGTGCACAGAAGAAGGGAGG - Intergenic
1165003800 19:32787909-32787931 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
1165254669 19:34568511-34568533 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1165269814 19:34696520-34696542 GAAGGTGAGCAGAAGCAGGGTGG + Intergenic
1165554300 19:36616901-36616923 CAGGGTGGACAGAGGGATGGAGG + Intronic
1165970481 19:39624563-39624585 AAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1166163725 19:40971440-40971462 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1166390609 19:42407043-42407065 CTGGGTGAGCAGGAGCTGGGAGG + Intronic
1166730858 19:45058257-45058279 GAGGGTGAACAGATGCCTGGCGG - Intronic
1166750361 19:45161595-45161617 CAGGGCACACAGAGGCAGGGCGG + Intronic
1167819749 19:51916805-51916827 CCAGTTGAACAGAAGTAGGGGGG - Intronic
1168357411 19:55710625-55710647 CAGGAGGAAAGGAAGCAGGGGGG - Intronic
1168457607 19:56526211-56526233 GAGGGTGAGCTGAAGCAGGGTGG + Exonic
1168530937 19:57128061-57128083 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
925132452 2:1503469-1503491 CAGGGGGAGCAGGAGCAGGAGGG + Intronic
925252528 2:2451986-2452008 GAGGGTGAGTGGAAGCAGGGTGG - Intergenic
925304721 2:2840006-2840028 GAGGGGGAACAGAAAGAGGGGGG + Intergenic
925389614 2:3486363-3486385 CAGGGTGACCAGAAGGAGCCAGG - Intergenic
925442167 2:3898045-3898067 CAGGGAGAACAGAACCAAGTTGG - Intergenic
925484581 2:4313653-4313675 TAGGGGGAGCAGAAGCAGGGTGG - Intergenic
925672441 2:6325848-6325870 CACGCTGAAAAGAAGCAGGGCGG - Intergenic
925729249 2:6905451-6905473 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
926074777 2:9933131-9933153 GAGGGTGAGCCGAAGCAGGGCGG - Intronic
926085389 2:10016580-10016602 CAGGGTGAGTAGGAGGAGGGAGG + Intergenic
926483531 2:13428084-13428106 GATGGTGAAAGGAAGCAGGGTGG - Intergenic
926611586 2:14953253-14953275 CATGGTGAACTGTATCAGGGAGG + Intergenic
926970680 2:18464164-18464186 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
927021407 2:19020787-19020809 GAGGGTGAGCTAAAGCAGGGCGG - Intergenic
927027901 2:19089407-19089429 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
927180787 2:20445571-20445593 CAGCCTGAACACAAGCAGGAAGG - Intergenic
927182715 2:20458450-20458472 GAGGGTGAGCAGAAGCAAGATGG + Intergenic
927221182 2:20711558-20711580 GAGGGTGAGCCAAAGCAGGGCGG + Intronic
927293955 2:21431990-21432012 CAGGGAGAACAGAAGCAGTAAGG + Intergenic
928254152 2:29707430-29707452 CAGGGAAAACAGAACAAGGGAGG + Intronic
928488203 2:31754194-31754216 GAGGGTGAGCAGAAACAGGGTGG + Intergenic
928600648 2:32900766-32900788 CAGGGTGAGCCGAGGCATGGAGG + Intergenic
928750564 2:34466362-34466384 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
929025782 2:37600164-37600186 GAGGGTGAGCTGAAGCAGAGTGG - Intergenic
929256220 2:39813973-39813995 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
929333625 2:40713249-40713271 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
929544986 2:42849840-42849862 CAGGGTGCACAGTGGAAGGGAGG - Intergenic
929837934 2:45425661-45425683 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
929873006 2:45774059-45774081 CAAGATGAACAGCAGCAGCGGGG - Intronic
930323253 2:49882036-49882058 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
930476739 2:51891668-51891690 GAGGGTGAGCCAAAGCAGGGAGG - Intergenic
930530480 2:52582425-52582447 CTGGGTGAAAACAAGCTGGGTGG - Intergenic
930860422 2:56065844-56065866 GAGGGAAAACAGAAGCAGAGTGG - Intergenic
930887782 2:56347703-56347725 CAGAGTGAACTGGAGGAGGGTGG + Intronic
930908959 2:56606797-56606819 GAGGATGAGCTGAAGCAGGGCGG - Intergenic
930951248 2:57146391-57146413 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
931004017 2:57827767-57827789 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
931204706 2:60136178-60136200 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
931212171 2:60207609-60207631 GAGGGAGAGCAGAAGCAGGGTGG - Intergenic
931292270 2:60883098-60883120 CAGCGTGAGCAAAGGCAGGGAGG + Intronic
931480301 2:62633132-62633154 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
931594462 2:63926657-63926679 GAGGGTGCGCTGAAGCAGGGCGG + Intronic
931971200 2:67589075-67589097 AAGGGTGAGCTGAAACAGGGTGG + Intergenic
932051613 2:68403847-68403869 GAGGGTGAGCTGAAGCTGGGTGG - Intergenic
932169120 2:69537702-69537724 CAGGGTGAACAGGAGCACTTGGG + Intronic
932327972 2:70876046-70876068 GAGGGCGAGCTGAAGCAGGGCGG + Intergenic
932374603 2:71224680-71224702 CAGGGTGCAGAGAAGCACGATGG - Intronic
932539925 2:72641235-72641257 GAGGGCGAGCTGAAGCAGGGCGG + Intronic
932646868 2:73511463-73511485 GAGGGTGAGCAGCAGCAGGGTGG - Intronic
932662717 2:73670467-73670489 GAGTGTGAGCCGAAGCAGGGTGG - Intergenic
933269321 2:80216226-80216248 CAGTGTGAGCCGAAGCAGGGCGG - Intronic
933413290 2:81951500-81951522 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
933488368 2:82950819-82950841 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
933880387 2:86663829-86663851 GAGGGTGGGCTGAAGCAGGGTGG + Intronic
934141741 2:89053643-89053665 CAGATTGAATAGAAGTAGGGAGG - Intergenic
934227502 2:90146903-90146925 CAGATTGAATAGAAGTAGGGAGG + Intergenic
934314210 2:91901501-91901523 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
934617034 2:95778617-95778639 GAGGGTGAGCCGAAGCAGGGCGG + Intergenic
934643859 2:96045942-96045964 GAGGGTGAGCCGAAGCAGGGCGG - Intergenic
934702656 2:96454572-96454594 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
934837276 2:97602036-97602058 GAGGGTGAGCCGAAGCAGGGCGG - Intergenic
934871732 2:97872591-97872613 GAGGGCGAGCCGAAGCAGGGTGG + Intronic
935064642 2:99636964-99636986 CAGAGTGAGCAGCTGCAGGGTGG + Intronic
935325750 2:101935514-101935536 GAGGGCGAGCTGAAGCAGGGTGG + Intergenic
935982724 2:108643343-108643365 GAGGATGAGCCGAAGCAGGGTGG + Intronic
936181897 2:110274356-110274378 GAGGGTGATTAGAAGCAGGGTGG - Intergenic
936230671 2:110697323-110697345 GAGGGTGATTAGAAGCAGGGTGG + Intergenic
936448409 2:112615193-112615215 GAGGCTGAGCGGAAGCAGGGTGG - Intergenic
936859578 2:117001291-117001313 GAGTGTGAGCTGAAGCAGGGTGG + Intergenic
936900037 2:117472340-117472362 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
937143047 2:119618432-119618454 GAGGGTGAGCCGAAGCAGGGTGG + Intronic
937216425 2:120316361-120316383 CAGGGTGGCCAGAGCCAGGGAGG + Intergenic
937465104 2:122125442-122125464 GAGGATGAGCTGAAGCAGGGTGG - Intergenic
937562644 2:123244619-123244641 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
937689434 2:124738235-124738257 CAGAGTGAAAAGAAAGAGGGAGG - Intronic
938067953 2:128292101-128292123 GAGGGTGAACTGAGGCCGGGGGG + Intronic
938144658 2:128823534-128823556 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
938224357 2:129602877-129602899 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
938708281 2:133953026-133953048 AAGGGAGAACAGAAACAGGAAGG + Intergenic
938952399 2:136267035-136267057 GAGGGTGAGCAGGAGCAGGGTGG - Intergenic
939055510 2:137360385-137360407 GAGGGTGAGCTGAAGCAGAGTGG + Intronic
939174256 2:138731169-138731191 CAGGGTGAACAAAAGAAAAGTGG - Intronic
939180306 2:138795794-138795816 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
939364883 2:141218936-141218958 CAGAGTGAGGAAAAGCAGGGTGG + Intronic
939382119 2:141448692-141448714 GAGGGCGAGCCGAAGCAGGGTGG - Intronic
939640930 2:144638977-144638999 TAGGGCAAGCAGAAGCAGGGTGG - Intergenic
939652721 2:144785121-144785143 GAGAGTGAGCTGAAGCAGGGTGG + Intergenic
939744512 2:145952173-145952195 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
939937848 2:148313935-148313957 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
940030639 2:149257941-149257963 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
940054624 2:149500507-149500529 GAGGGAGAGCAGAAGCAGGGTGG - Intergenic
940400633 2:153244499-153244521 GAGTGTGAGCAGAAGCAGGGTGG + Intergenic
940565240 2:155351827-155351849 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
940644478 2:156376226-156376248 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
940757856 2:157704323-157704345 AAGGGCGAGCCGAAGCAGGGTGG + Intergenic
940904938 2:159160715-159160737 CAGGGTTCTCAGAGGCAGGGAGG - Intronic
940964436 2:159821883-159821905 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
940995800 2:160148620-160148642 GAGGGTGAGCAGAAGCAGGGCGG + Intronic
940998935 2:160180834-160180856 AAGGGTGAGCCGAAGCAGGGTGG + Intronic
941239471 2:163017909-163017931 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
941477963 2:165971643-165971665 GAGGGAGAGCAGAAGCAGGGTGG + Intergenic
941518799 2:166511843-166511865 GAGGGCGAACAGAAGCAGGGTGG - Intergenic
941682420 2:168413339-168413361 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
941896053 2:170630078-170630100 GAGGGCGAGCTGAAGCAGGGCGG + Intronic
942010950 2:171761830-171761852 AAGGGCGAGCCGAAGCAGGGTGG - Intergenic
942410952 2:175708960-175708982 GAGGGTGAACTGAAGCCGGGTGG + Intergenic
942431380 2:175914596-175914618 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
942898673 2:181089066-181089088 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
942958755 2:181804541-181804563 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
943094803 2:183416464-183416486 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
943129887 2:183841720-183841742 CTGGGGAAGCAGAAGCAGGGTGG + Intergenic
943147767 2:184066433-184066455 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
943240465 2:185377314-185377336 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
943300059 2:186186869-186186891 GAGCGTGAGCGGAAGCAGGGAGG - Intergenic
943352438 2:186811911-186811933 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
943552576 2:189358020-189358042 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
943660399 2:190554009-190554031 GAGGGCGAGCTGAAGCAGGGTGG + Intergenic
943702736 2:191004135-191004157 CAGGGTGGAGGGAAGCAGGGAGG - Intronic
943836729 2:192524316-192524338 GAGGGTGAGCCGAAGCAGAGTGG + Intergenic
944094058 2:195946726-195946748 CCGGGTGAAGAGAAGGAGGAAGG - Intronic
944267820 2:197748093-197748115 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
944291952 2:198018077-198018099 GAGGGCGAGCAGAAGCAGGGTGG + Intronic
944635321 2:201670904-201670926 AAGGGTAAACCAAAGCAGGGTGG + Intronic
944764265 2:202848983-202849005 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
944901768 2:204223201-204223223 CAGGGTGACCAACAGCAGAGAGG - Intergenic
945207147 2:207344304-207344326 CAGAGGGAGCTGAAGCAGGGTGG + Intergenic
945210968 2:207381467-207381489 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
945409084 2:209488129-209488151 GAGGTCGAGCAGAAGCAGGGTGG + Intronic
945414800 2:209557727-209557749 CAGGTTGAAGTGATGCAGGGAGG + Intronic
945482287 2:210357986-210358008 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
945768300 2:214007964-214007986 AGGGGTGAAGAGAAGGAGGGAGG - Intronic
945788878 2:214278288-214278310 AAGGGTGAGCCAAAGCAGGGTGG - Intronic
945965751 2:216184881-216184903 CAGGGCATACAGAAGAAGGGAGG - Intronic
946649099 2:221871894-221871916 GAGGGTGTGCAGAAGCAGAGTGG + Intergenic
946794029 2:223330655-223330677 GAGGGCGAGCTGAAGCAGGGCGG + Intergenic
946912904 2:224484978-224485000 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
947033424 2:225824398-225824420 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
947098433 2:226592486-226592508 GAGGGTGAAGAGAAGCAGGGTGG - Intergenic
947364595 2:229381118-229381140 GAGGGCGAGCAGAAGCAGGATGG + Intronic
947492041 2:230603490-230603512 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
947536473 2:230942961-230942983 CTAGGGGAACAGAAGCAGGATGG - Intronic
948281188 2:236749038-236749060 CAGCGTGAGCAGCTGCAGGGAGG - Intergenic
948856079 2:240731287-240731309 CAGACTAAACAGAGGCAGGGAGG + Intronic
948865189 2:240771565-240771587 CAGGGTGGGAAGATGCAGGGAGG - Intronic
949065221 2:241986215-241986237 CCGGGTGGACAGGAGCGGGGGGG + Intergenic
1168938711 20:1690759-1690781 GAGGGTAAGCAGAAGCAGGGTGG + Intergenic
1169397129 20:5242011-5242033 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1169421410 20:5463663-5463685 GAAGGCGAGCAGAAGCAGGGTGG - Intergenic
1169659113 20:7958509-7958531 GAGTGTGAGCCGAAGCAGGGTGG - Intergenic
1169984189 20:11423418-11423440 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1170186143 20:13593378-13593400 GAGGGTGAGCCGAAGCTGGGTGG + Intronic
1170229480 20:14028717-14028739 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
1170294155 20:14806299-14806321 GAGGGCGACCAGAAGCAGGGTGG + Intronic
1170689146 20:18596445-18596467 AAATGTGAACAGAAGAAGGGAGG - Intronic
1170727425 20:18942151-18942173 GAGGGTAAGCTGAAGCAGGGTGG - Intergenic
1171000766 20:21413672-21413694 GAGGGCGAGCCGAAGCAGGGTGG + Intergenic
1171050453 20:21853583-21853605 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1171255959 20:23689184-23689206 CAGGGGGAACTTAGGCAGGGAGG - Intergenic
1171263307 20:23751081-23751103 CAGGGGGAACTTAGGCAGGGAGG - Intronic
1171266599 20:23776403-23776425 CAGGGGGAACTTAGGCAGGGAGG - Intergenic
1171272366 20:23826875-23826897 CAGGGAGAACTTAGGCAGGGAGG - Intergenic
1171514804 20:25720702-25720724 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1171882313 20:30627607-30627629 CTGGGTGAACACCCGCAGGGAGG - Intergenic
1172456334 20:35077229-35077251 GAGTGTGAGCTGAAGCAGGGCGG - Intronic
1173301448 20:41807224-41807246 AAGCGTGAGCCGAAGCAGGGCGG - Intergenic
1173341401 20:42155828-42155850 CAGGGACAACAGAGGCAGGTAGG - Intronic
1173356182 20:42292887-42292909 AAGGGGTAACAGAAGCAGTGGGG + Intronic
1173374037 20:42467054-42467076 CAGGGAGACCAAAAACAGGGAGG + Intronic
1173419321 20:42886934-42886956 CAGGGTGCACAAATGCAGGGAGG + Intronic
1173525775 20:43731485-43731507 CAGGATGAAGATCAGCAGGGAGG - Intergenic
1173771843 20:45666395-45666417 GAGGGTGAGCGGAAGCAGGGTGG - Intronic
1174157809 20:48528106-48528128 CTGGGTGAACGGAAGCTGGCGGG + Intergenic
1174224117 20:48982968-48982990 TAGGGTGAGCTGAAGCAGGGCGG - Intronic
1174469351 20:50744648-50744670 GAGGGTGAAAAGCAGGAGGGAGG - Intronic
1175120122 20:56710701-56710723 AAGGGGGAAGAGAAGCCGGGAGG - Intergenic
1175154539 20:56961198-56961220 CTGGGTGTACAGGAGCAGGGAGG - Intergenic
1175491562 20:59383982-59384004 CAGGGAGAAGATGAGCAGGGGGG + Intergenic
1175531105 20:59674707-59674729 GAGGGGGAACAGGAGAAGGGGGG - Intronic
1175814892 20:61878209-61878231 CAGGGGGAACAGAAGGTGGGAGG - Intronic
1176287296 21:5024849-5024871 CATGGAGAACAGAGGCAGGCAGG + Intronic
1176716617 21:10355679-10355701 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1177042787 21:16133485-16133507 GTGGGTGAGCAGAAGCAGGGTGG - Intergenic
1177111463 21:17034280-17034302 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1177136296 21:17308446-17308468 GAGGGTGAGCCGAAGGAGGGTGG + Intergenic
1177184275 21:17776037-17776059 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1177388016 21:20432871-20432893 CAGAGTGAGGAAAAGCAGGGTGG + Intergenic
1177425809 21:20921925-20921947 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1177521038 21:22226300-22226322 CAGGTTGAATAGAAGTAAGGAGG - Intergenic
1178393482 21:32219322-32219344 GAGGGTGAGCAAAAGCAGGGTGG + Intergenic
1178864534 21:36316971-36316993 GAGGGTGAACAGAAGCAGGGTGG - Intergenic
1179285351 21:39973200-39973222 CAGGGGAGACAGATGCAGGGCGG - Intergenic
1179804296 21:43827094-43827116 CAGGGCGAGCAGAAGCAGCTGGG + Intergenic
1179869885 21:44238626-44238648 CATGGAGAACAGAGGCAGGCAGG - Intronic
1179886238 21:44315362-44315384 CAGGGTGCACTGGGGCAGGGAGG + Intronic
1180036881 21:45254688-45254710 AAGGGTGAACAGAGGCAGGCAGG + Intergenic
1180073534 21:45450403-45450425 TAGGGTGGCCAGAAGCAGGAGGG + Intronic
1180540968 22:16447367-16447389 GAGGGTGAGCTGAAGCAGGATGG + Intergenic
1180575290 22:16767500-16767522 CAGGGAGAACAGAACCAAGTTGG + Intergenic
1180596152 22:16974857-16974879 GAGGGTGAGCCGAAGCAGGGTGG + Intronic
1180601719 22:17024257-17024279 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1180641040 22:17299609-17299631 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1180711574 22:17842731-17842753 CAGGGTGAAAGGACGCAGGCAGG - Intronic
1181008906 22:20028841-20028863 CATGGGGAAAAGAAGCAAGGGGG - Intronic
1182310605 22:29402886-29402908 CAAGGTGGGCAGCAGCAGGGAGG + Intronic
1182485615 22:30636872-30636894 CAGGGTGAACAGAGGTGTGGTGG - Exonic
1182690445 22:32157860-32157882 CAAGGTGGGCAGCAGCAGGGAGG - Intronic
1182892670 22:33832013-33832035 CTGGGTGAAAGGAAGAAGGGAGG - Intronic
1183021574 22:35031241-35031263 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1183182799 22:36272175-36272197 GAGGGCGAGCAGAATCAGGGTGG - Intergenic
1184001164 22:41674670-41674692 CAGAGCAGACAGAAGCAGGGTGG - Exonic
1184145644 22:42608640-42608662 AAGGGTGAGCACAAGCAGCGAGG + Intronic
1184301748 22:43564970-43564992 CAGGGTGAACAGAAGCAGGGGGG - Intronic
1184434925 22:44466291-44466313 AATGTTGAACAGAAGCAGTGAGG + Intergenic
1184467324 22:44676611-44676633 CGGGGTGAAGAGGAGGAGGGGGG + Intronic
1185345161 22:50307715-50307737 CGGGGAGAACAGGAGAAGGGGGG + Intergenic
949226886 3:1705531-1705553 GAGGGTGAACTGAAGCAGGGTGG + Intergenic
949428176 3:3941855-3941877 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
949456671 3:4246232-4246254 GAGGGTGAGCAGAAGCAGGGCGG - Intronic
949507166 3:4738934-4738956 CAGGGGTCACAGAAGCGGGGAGG - Intronic
949594668 3:5531270-5531292 GAGGGTGAGCAGAAGCAGAGTGG - Intergenic
949632613 3:5944545-5944567 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
949801281 3:7906631-7906653 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
949846037 3:8371958-8371980 GAGGGAGAGCCGAAGCAGGGTGG + Intergenic
949954967 3:9259995-9260017 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
950299920 3:11867969-11867991 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
950597554 3:13997585-13997607 AAGGGCGAGCTGAAGCAGGGTGG - Intronic
950991945 3:17449082-17449104 GAGGGTGAGCAGAAGCAGCATGG + Intronic
951006261 3:17618873-17618895 GAGGGTGAGCTGAAGCAAGGCGG - Intronic
951135879 3:19103707-19103729 GAGGATGAGCAGAATCAGGGTGG - Intergenic
951254582 3:20433409-20433431 GAGGACGAGCAGAAGCAGGGTGG - Intergenic
951347322 3:21561441-21561463 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
951368256 3:21812372-21812394 GAGTGTGAGCTGAAGCAGGGCGG + Intronic
951434310 3:22643735-22643757 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
951439560 3:22707351-22707373 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
951566238 3:24014943-24014965 CAGGATGAAAAGAAGCCGGCTGG - Intergenic
951617705 3:24566884-24566906 GAGGGTGAACTGAAGCAGGCGGG + Intergenic
951629196 3:24699764-24699786 GAGGGAGAGCAGAAGCAGGGTGG - Intergenic
951676521 3:25247616-25247638 GAGGATGAGCAGAAGCAGGGTGG - Intronic
951741600 3:25931326-25931348 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
951826584 3:26875657-26875679 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
951832085 3:26942470-26942492 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
952517730 3:34122560-34122582 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
952608152 3:35174102-35174124 AAGAGTGAGCAGAAGCAGGGTGG - Intergenic
953053080 3:39363406-39363428 CAGGGAGAACAGAACCAAGTTGG + Intergenic
953102438 3:39842755-39842777 GAGGGCAGACAGAAGCAGGGGGG - Intronic
953286561 3:41616488-41616510 GAGGGATAGCAGAAGCAGGGTGG + Intronic
953555867 3:43946353-43946375 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
954074064 3:48163943-48163965 CAGGGTGAAAAGAAAAAAGGGGG - Intronic
954436723 3:50500238-50500260 GAGGGTGGGCAGAAGCAGTGAGG - Intronic
954501035 3:51014137-51014159 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
954510577 3:51121287-51121309 GAGGGCGAGCAGAAGCAGAGTGG - Intronic
954571891 3:51647967-51647989 GAGGGCGAGCCGAAGCAGGGTGG + Intronic
954978770 3:54723679-54723701 GAGGGTGAGCCGAAGCAGAGTGG - Intronic
955564244 3:60226623-60226645 CAGGCTGAAAGGAAGCATGGAGG + Intronic
955657918 3:61264111-61264133 GAGGGTGAGATGAAGCAGGGTGG - Intergenic
956048384 3:65220701-65220723 GAGGATGAGCGGAAGCAGGGTGG - Intergenic
956110184 3:65862504-65862526 CAGGGTGAAGAGGAACAGAGTGG - Intronic
956207803 3:66772117-66772139 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
956220001 3:66892872-66892894 GAGGGTGAGCAGAAGCCAGGTGG + Intergenic
956300306 3:67764770-67764792 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
956301989 3:67781911-67781933 GAGGGTGAACTGAAGCAGGGTGG - Intergenic
956355635 3:68389707-68389729 GAGGGTGAGCAGAAGCTGGGTGG + Intronic
956373287 3:68587116-68587138 GAGGGTGAGCTGAAGCAAGGCGG - Intergenic
956642857 3:71431034-71431056 CATGGTGGACAGAACCAGGCAGG + Intronic
956718194 3:72096693-72096715 CTGGGTGAACAGGAGCATGGTGG - Intergenic
957011353 3:75009190-75009212 GAGGGCCAGCAGAAGCAGGGTGG - Intergenic
957249578 3:77756590-77756612 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
957695650 3:83635644-83635666 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
957747757 3:84366595-84366617 GAGGGCCAGCAGAAGCAGGGTGG - Intergenic
957776415 3:84760854-84760876 CAGGGCAAGCAGAAGCAGGGTGG + Intergenic
957850514 3:85800702-85800724 GAGGGCGAGCAGAAGTAGGGTGG - Intronic
958011057 3:87881100-87881122 GAGGGTGAGCCTAAGCAGGGCGG + Intergenic
958092657 3:88896038-88896060 AAGGGTGAACAGTAGAAGGGGGG - Intergenic
958414005 3:93852732-93852754 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
958434615 3:94081204-94081226 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
958479685 3:94630772-94630794 GAGGATGAGCTGAAGCAGGGTGG + Intergenic
958521000 3:95185029-95185051 GAGGGTGATCCGAAGCAGAGTGG - Intergenic
958618442 3:96526811-96526833 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
958694643 3:97511476-97511498 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
958793508 3:98681663-98681685 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
958975959 3:100668079-100668101 GAGGGAGAGCTGAAGCAGGGTGG - Intronic
959059814 3:101605780-101605802 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
959093157 3:101925334-101925356 GAGAGTGAGCTGAAGCAGGGTGG - Intergenic
959120201 3:102223371-102223393 GAGGTTGAGCAAAAGCAGGGTGG - Intronic
959278136 3:104304157-104304179 GAGGGTGAGCAGAAGCAGAGTGG + Intergenic
959291812 3:104484795-104484817 GAGGGTGAGTAAAAGCAGGGTGG + Intergenic
959345664 3:105191471-105191493 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
959453689 3:106533909-106533931 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
959534526 3:107470203-107470225 GAGGGTGAGCAGAAGAAGGGTGG + Intergenic
959736433 3:109664888-109664910 GAGGGTGTGCTGAAGCAGGGCGG + Intergenic
959815753 3:110671581-110671603 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
959881287 3:111447411-111447433 GAAGGGGAGCAGAAGCAGGGTGG - Intronic
959883378 3:111472492-111472514 CAGGGAGAACAGAACCAAGATGG - Intronic
960464017 3:117972908-117972930 CACTGAGAACTGAAGCAGGGAGG + Intergenic
960655890 3:120003917-120003939 GAGGGCGAGCCGAAGCAGGGTGG + Intronic
960760163 3:121064267-121064289 GAGGAGGAGCAGAAGCAGGGTGG - Intronic
960763401 3:121097609-121097631 GAGGGTGATCTGAAGCAGGGTGG - Intronic
960773236 3:121217477-121217499 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
960787732 3:121392375-121392397 GAGAGTGAGCTGAAGCAGGGTGG - Intronic
960836098 3:121908354-121908376 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
960883236 3:122367157-122367179 GAGGGTGAAGAGAAGGAGAGAGG + Intronic
961862368 3:129927091-129927113 GAGGGAGAACAGAAGTAAGGAGG + Intergenic
961977431 3:131041947-131041969 GAGGGCGAGCAGAAGGAGGGTGG + Intronic
961984890 3:131121950-131121972 GAGCGTGAGCTGAAGCAGGGCGG - Intronic
961998324 3:131269524-131269546 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
962156763 3:132956549-132956571 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
962467036 3:135670143-135670165 CACAGTTAACAGAAGCAGTGAGG - Intergenic
962512258 3:136114111-136114133 GAGGGTGACCCGAAGCAGGGTGG + Intronic
962634856 3:137319879-137319901 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
962642438 3:137401115-137401137 GAGGGTGAGCAGAAGCAAGGTGG - Intergenic
962665963 3:137654052-137654074 GAGGGTGAGCCGAAGAAGGGTGG + Intergenic
962675144 3:137750846-137750868 GAGAGTGAGCTGAAGCAGGGCGG + Intergenic
962766932 3:138574113-138574135 AAGGGCGAGCCGAAGCAGGGTGG + Intronic
963306816 3:143662475-143662497 GAGTGTGAGCTGAAGCAGGGCGG + Intronic
963401818 3:144807281-144807303 GAGAGCGAACAGAAGCAGGGTGG - Intergenic
963410933 3:144926793-144926815 GAGGGCGAACAGAAGCAGGGTGG - Intergenic
963629376 3:147713457-147713479 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
963898584 3:150711981-150712003 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
963998639 3:151740288-151740310 GAGGGCGAACAGAAGCAGGGTGG - Intronic
964391325 3:156201110-156201132 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
964904752 3:161706934-161706956 GAGGGTGGACAGAAGCAGGGTGG + Intergenic
965001992 3:162966163-162966185 GACAGTGAGCAGAAGCAGGGTGG + Intergenic
965091161 3:164163727-164163749 GAGGGCTAGCAGAAGCAGGGTGG - Intergenic
965221359 3:165931244-165931266 GAGGGTGAGCCGAAGGAGGGTGG + Intergenic
965511024 3:169568065-169568087 GAGGGTGAGCAGAAGCAGGATGG + Intronic
965880363 3:173381996-173382018 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
966016855 3:175150709-175150731 CAGAGTGAGCAGCAGAAGGGAGG - Intronic
966250997 3:177865570-177865592 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
966309322 3:178576191-178576213 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
966351758 3:179038732-179038754 GAGGACGAACTGAAGCAGGGTGG + Intronic
966879494 3:184342000-184342022 CAGGGAGCACAGGTGCAGGGAGG - Intronic
967007752 3:185400243-185400265 CAGGGTGCGCAGACGCAGGGAGG - Intronic
967419653 3:189259293-189259315 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
967562741 3:190935318-190935340 GAGGATGAACTGAAGCAGGTGGG - Intergenic
967715503 3:192757902-192757924 GAGGGAGAGCAGAAGCAGGGTGG + Intronic
967756823 3:193179532-193179554 GAGGGTGAGCTGAAGCAGAGTGG + Intergenic
967814974 3:193790783-193790805 AAGGGTGAGCAGCAGCAGCGTGG + Intergenic
968312772 3:197697681-197697703 GAGGGAGAACAGTAGCAGGCAGG + Intronic
968376078 4:42519-42541 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
968566575 4:1316619-1316641 CTGGTTAGACAGAAGCAGGGAGG - Intronic
969043582 4:4320327-4320349 CAGAGTGAGCAGAAGCTGTGAGG + Intronic
969157125 4:5220769-5220791 CAGAAAGAACAGAGGCAGGGAGG + Intronic
969164902 4:5299092-5299114 AAGGGCAAGCAGAAGCAGGGTGG - Intronic
969631791 4:8343254-8343276 CTGGATGAGGAGAAGCAGGGAGG + Intergenic
969693869 4:8724105-8724127 CAGGCTGAAAAGAACCATGGGGG + Intergenic
969714819 4:8863382-8863404 CTGGGTGAGCAGCACCAGGGAGG - Intronic
970214605 4:13745665-13745687 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
970322967 4:14893730-14893752 CAGGGTGAAGAGAGACATGGTGG - Intergenic
970496227 4:16628774-16628796 GAGGGTGAGCCGAAGAAGGGTGG + Intronic
970679290 4:18489024-18489046 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
970714643 4:18907607-18907629 GAGGGCTAGCAGAAGCAGGGTGG + Intergenic
970792031 4:19868803-19868825 GAGGGTGAGCCGAAGCAGGTTGG - Intergenic
970864060 4:20738765-20738787 GAGTGTGAGCCGAAGCAGGGTGG + Intronic
970914063 4:21311784-21311806 CAAGATGAACAGATGCAGTGAGG + Intronic
971437204 4:26640577-26640599 GAGGGTGAGCCGAAGCAGGGAGG + Intronic
971749121 4:30623873-30623895 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
971883158 4:32409228-32409250 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
972260945 4:37407878-37407900 GAGGGCGAGCAGAAGCAGGATGG + Intronic
972372531 4:38438493-38438515 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
972685563 4:41349605-41349627 AAGGGTGAGCCGAAGCAGGGTGG + Intergenic
972755477 4:42041904-42041926 GAGGGTGACCCGAAGCAGGGTGG + Intronic
972962661 4:44473557-44473579 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
973272920 4:48279759-48279781 GAGGGTGAGCTGAAGCAAGGTGG + Intergenic
973544966 4:51972323-51972345 CAGGGAGAACAGAACCAAGTTGG - Intergenic
973626118 4:52774128-52774150 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
973629023 4:52801797-52801819 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
973798307 4:54451044-54451066 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
973835718 4:54807218-54807240 GAGGGTGAATTGAAGCAGGGTGG + Intergenic
973837410 4:54824541-54824563 GAAGGTGAGCAGAAGCAGGGTGG + Intergenic
973871381 4:55170081-55170103 GAAGGTGAGCTGAAGCAGGGTGG - Intergenic
973883501 4:55297300-55297322 GAGGGTGAGCCGAAGCAGGGCGG + Intergenic
974279938 4:59779963-59779985 GAGGGTGAGCGGAAGCAGGCTGG + Intergenic
974491717 4:62572211-62572233 GAGGGTAAGCTGAAGCAGGGTGG - Intergenic
974528560 4:63077333-63077355 GAGGGTGAGCCGAAGCAGGTTGG - Intergenic
974560014 4:63505805-63505827 GAGAGTGAGCAGAAGCAGAGTGG + Intergenic
974573241 4:63683010-63683032 GAGGGTGAGCAGTAACAGGGTGG - Intergenic
974871714 4:67652696-67652718 GAGGGCGAGCCGAAGCAGGGCGG + Intronic
974899578 4:67980939-67980961 CAGGGAGAACAGAACCAAGTGGG - Intergenic
975177822 4:71308569-71308591 GAGGGTGAGCAGAAGCAGAGGGG + Intronic
975213047 4:71722968-71722990 GAGAGAGAGCAGAAGCAGGGTGG - Intergenic
975227438 4:71891269-71891291 TAGAGTGAGCAGAAACAGGGTGG + Intergenic
975245778 4:72119624-72119646 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
975305828 4:72847809-72847831 GAGTGTGAGCTGAAGCAGGGAGG + Intergenic
975350503 4:73340340-73340362 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
975367271 4:73544298-73544320 AAGGGCGAGCTGAAGCAGGGTGG + Intergenic
975425050 4:74215491-74215513 GAGGGCGAACTGAAGCAGGGTGG - Intronic
975449274 4:74505471-74505493 AAGAGTGAGCTGAAGCAGGGTGG + Intergenic
975466418 4:74714252-74714274 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
975524168 4:75331146-75331168 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
975528698 4:75378372-75378394 GAGTGTGAACCGAAGCAGGGTGG + Intergenic
975638700 4:76477821-76477843 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
975751144 4:77524692-77524714 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
976061350 4:81131281-81131303 GTGGGTGAGCTGAAGCAGGGTGG - Intronic
976394823 4:84544798-84544820 GAGGGCGAGCTGAAGCAGGGTGG + Intergenic
976438204 4:85043488-85043510 AAGGGCGACCCGAAGCAGGGTGG + Intergenic
976439196 4:85054646-85054668 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
976477980 4:85506717-85506739 GAGGGTGAGTCGAAGCAGGGCGG - Intronic
976506509 4:85853448-85853470 GAGGGTGAGCCGAAGCAGGGCGG - Intronic
976527944 4:86115328-86115350 CAGAGTGAGGAAAAGCAGGGTGG - Intronic
976534412 4:86194042-86194064 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
976585337 4:86791014-86791036 GAGGGTGGGCTGAAGCAGGGTGG + Intronic
977049303 4:92106888-92106910 CTGGGGGCACAGAGGCAGGGTGG + Intergenic
977057382 4:92211006-92211028 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
977084588 4:92576844-92576866 CAGAATGAAAAAAAGCAGGGTGG - Intronic
977185723 4:93933055-93933077 AAGGGTGAGCAGAATCAGGGTGG - Intergenic
977203899 4:94148499-94148521 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
977288696 4:95139901-95139923 CAGTGTGAGCCGAAGCAGGGTGG - Intronic
977425460 4:96862689-96862711 AAAGGTGAGCAGAAGCAGGGTGG + Intergenic
977439048 4:97038387-97038409 GAGGGTGACCAGAAGCAGTGGGG - Intergenic
977671320 4:99698894-99698916 GAGGACGACCAGAAGCAGGGTGG + Intergenic
977764877 4:100785327-100785349 CTGGGTGAACAGGGGCAGGAGGG + Intronic
977767529 4:100817442-100817464 GAGGGTGAACAGAAAAAAGGAGG - Intronic
977771756 4:100868776-100868798 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
977792852 4:101128592-101128614 GAGGGCAAGCAGAAGCAGGGCGG + Intronic
977946429 4:102919579-102919601 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
977986085 4:103385240-103385262 GAGGGCGAGCCGAAGCAGGGTGG + Intergenic
978078964 4:104568444-104568466 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
978108190 4:104930405-104930427 GAGAGTGAGCTGAAGCAGGGTGG + Intergenic
978110780 4:104961745-104961767 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
978138986 4:105296790-105296812 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
978237004 4:106471875-106471897 GAGGGCGAGCAGAAACAGGGTGG - Intergenic
978342009 4:107728923-107728945 CAGGGTGAACAGGATGATGGTGG + Intergenic
978493979 4:109339752-109339774 GAGGGTGGGCCGAAGCAGGGTGG + Intergenic
978601506 4:110432460-110432482 GAGGGTGAGCCGAAGCATGGTGG - Intronic
978906712 4:114013466-114013488 GAGGATGAGCTGAAGCAGGGTGG - Intergenic
979012248 4:115387092-115387114 GAGGGTGAGCAGAAGTAGGGTGG + Intergenic
979023045 4:115526975-115526997 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
979115199 4:116814962-116814984 GAGGGTGATCCGAAGCAGGGTGG + Intergenic
979272911 4:118783076-118783098 GAGGGTGAGCCAAAGCAGGGCGG - Intronic
979421310 4:120508953-120508975 GAGGGAAAGCAGAAGCAGGGTGG + Intergenic
979457511 4:120943915-120943937 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
979628389 4:122872418-122872440 CAGGGAGAACAGAAACAAGCTGG + Intronic
979649463 4:123113993-123114015 CAGGATGACCAGCAGCAGAGAGG - Intronic
979668362 4:123336990-123337012 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
979730192 4:124014379-124014401 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
980100405 4:128536176-128536198 GAGGGTGAACCAAAGCAGGGTGG - Intergenic
980148679 4:129021099-129021121 GAGGATGAACAGAAGTAGGGTGG + Intronic
980151736 4:129056080-129056102 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
980157718 4:129126815-129126837 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
980292691 4:130865304-130865326 CATGGTGAAAAAAAGCAGGTAGG - Intergenic
980306221 4:131064647-131064669 TAGGATGAACAGATGCAGAGAGG - Intergenic
980494243 4:133570584-133570606 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
980583722 4:134786901-134786923 GAGAGTGAGCTGAAGCAGGGTGG - Intergenic
980584005 4:134789394-134789416 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
980587089 4:134831192-134831214 CAGGGAGAATAGAAGCAAGTTGG + Intergenic
980634009 4:135474256-135474278 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
980769254 4:137350722-137350744 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
980875640 4:138659410-138659432 GAGGGAGAAGAGAAGCAGGAGGG + Intergenic
980888224 4:138786034-138786056 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
981254740 4:142648340-142648362 GAGGGTGAGCCAAAGCAGGGTGG + Intronic
981273991 4:142876153-142876175 CAGGGAGAACAGAACCAAGTTGG + Intergenic
981414961 4:144482607-144482629 GAGGGCGAGCCGAAGCAGGGAGG + Intergenic
981501564 4:145457684-145457706 AAGTGTGAGCGGAAGCAGGGCGG + Intergenic
981655885 4:147112100-147112122 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
981671455 4:147292316-147292338 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
981749770 4:148082410-148082432 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
981788065 4:148503165-148503187 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
981789715 4:148522200-148522222 GAGGGTGAGCCTAAGCAGGGTGG - Intergenic
981795031 4:148585892-148585914 GAGGGTAAGCTGAAGCAGGGTGG - Intergenic
981796336 4:148599270-148599292 GAGGGTGAGCTGAAGCAGAGTGG - Intergenic
981859932 4:149341829-149341851 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
982794622 4:159630013-159630035 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
982815468 4:159878220-159878242 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
982825655 4:160001498-160001520 GAGGGTGAGCAGAAGTAGGGTGG + Intergenic
982848079 4:160276409-160276431 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
982853044 4:160342772-160342794 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
982909302 4:161118542-161118564 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
982915498 4:161203793-161203815 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
983044602 4:162970167-162970189 GAGGGCCAGCAGAAGCAGGGTGG - Intergenic
983167776 4:164498017-164498039 GAGGGTGAGCGAAAGCAGGGTGG - Intergenic
983485985 4:168331645-168331667 GAAGGCGAGCAGAAGCAGGGTGG - Intergenic
983543207 4:168935121-168935143 GAGGGCGAGCAGAAGCAGGGTGG + Intronic
983564027 4:169130954-169130976 CAGTGTGAATAGAAGCAATGTGG + Intronic
983594264 4:169448827-169448849 GAGGGTGAGCCGAAGCAGGGTGG + Intronic
983596390 4:169472430-169472452 GAGGGAGAGCAGAAGCAGGGTGG - Intronic
983602834 4:169549253-169549275 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
983787974 4:171758976-171758998 GAGGGTGAGTTGAAGCAGGGTGG + Intergenic
983840777 4:172455059-172455081 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
984224390 4:177017357-177017379 GAGGGTGAACCGAAGCAGGGCGG + Intergenic
984372383 4:178884070-178884092 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
984434069 4:179685648-179685670 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
984526142 4:180861031-180861053 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
985053721 4:186017959-186017981 CAGGGTGAGCAGGCTCAGGGTGG + Intergenic
985218781 4:187680955-187680977 CAGGGTGAAGAGCGGCTGGGAGG - Intergenic
985317328 4:188672336-188672358 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
985473830 5:66099-66121 GAGTGTGAGCCGAAGCAGGGTGG - Intergenic
985794734 5:1953580-1953602 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
985814045 5:2113239-2113261 CAGGGTTGACATAATCAGGGCGG - Intergenic
986127134 5:4893534-4893556 GAGGGTGAGCCGAAACAGGGTGG - Intergenic
986241426 5:5963417-5963439 GAGGGTGAACTGAAGCAGGCAGG + Intergenic
986269226 5:6216897-6216919 CAGGGTGGCCAGAAGCATGTAGG + Intergenic
986289048 5:6383982-6384004 CAGGGCAACTAGAAGCAGGGAGG + Intergenic
986323115 5:6649729-6649751 GAGGGCGAGCCGAAGCAGGGTGG - Intronic
986358458 5:6951964-6951986 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
986378915 5:7163097-7163119 GATGGCCAACAGAAGCAGGGTGG - Intergenic
986418611 5:7553660-7553682 CTGAGGGGACAGAAGCAGGGAGG + Intronic
986512017 5:8517428-8517450 CAGAGCAAGCAGAAGCAGGGTGG - Intergenic
986675110 5:10177546-10177568 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
986676802 5:10192993-10193015 CTGGTTCAACAGAAGAAGGGTGG - Intergenic
986798841 5:11239445-11239467 CTGGGAGAACAGAAGTGGGGAGG - Intronic
986838892 5:11672901-11672923 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
987210890 5:15682092-15682114 CAAGGTGGTCAGAGGCAGGGTGG + Intronic
987287343 5:16469798-16469820 CAGGCTGTACAGAAGCATGGTGG - Intergenic
987837968 5:23186297-23186319 GAGGGCGAACCAAAGCAGGGCGG + Intergenic
988204007 5:28110806-28110828 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
988402023 5:30775282-30775304 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
988502127 5:31792269-31792291 CAAGGTCATCAGAAGCAGGCAGG + Intronic
988618130 5:32794853-32794875 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
988687575 5:33539978-33540000 GAGGGCGAGCGGAAGCAGGGCGG + Intronic
988728537 5:33947241-33947263 CAGGCTGCACAGGACCAGGGTGG + Exonic
988771177 5:34434754-34434776 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
988795152 5:34646674-34646696 GAGGGTGAGCTGAAGCAGAGCGG - Intergenic
988970712 5:36465105-36465127 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
989345331 5:40423184-40423206 GAGGATGAGCCGAAGCAGGGCGG - Intergenic
989349957 5:40474727-40474749 GAGGGTGAGCTGAAGTAGGGTGG - Intergenic
989358114 5:40567359-40567381 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
989451878 5:41596466-41596488 GAGGGTGAGCTGAAGCAGGATGG + Intergenic
989614784 5:43328847-43328869 GAGGGTGAGCCAAAGCAGGGCGG - Intergenic
989619135 5:43367528-43367550 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
989670246 5:43908845-43908867 GAGGGTGAGCCAAAGCAGGGAGG + Intergenic
989671182 5:43918400-43918422 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
989687710 5:44108848-44108870 GAAGGTGACCAGAAGCAGGGTGG - Intergenic
989825260 5:45847646-45847668 GAGGGAGAACAGAAGCAGGGTGG + Intergenic
990009788 5:50983041-50983063 CAGAGGCAACAGAAGCAGAGAGG - Intergenic
990098779 5:52156486-52156508 GAGGGTGAGCAGAAACAGGGTGG + Intergenic
990183851 5:53191630-53191652 GAGGGTGAGCAAAAGCAGAGTGG - Intergenic
990231286 5:53715853-53715875 GAGAGTGAACAGAAGCAAGATGG + Intergenic
990244922 5:53854670-53854692 GAGGATGAGCTGAAGCAGGGCGG - Intergenic
990713065 5:58606070-58606092 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
990803426 5:59631592-59631614 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
991026754 5:62037953-62037975 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
991105411 5:62837237-62837259 GAGGGTGAGCTGAAGCACGGTGG + Intergenic
991151422 5:63375836-63375858 GAGGGGGAGCTGAAGCAGGGTGG + Intergenic
991223496 5:64242934-64242956 GAGGGTGAGCCAAAGCAGGGTGG + Intronic
991283323 5:64940408-64940430 GAGGGTGAGCCGAAACAGGGTGG - Intronic
991387468 5:66106098-66106120 GAAGGTGAGCCGAAGCAGGGTGG + Intergenic
991409588 5:66332936-66332958 AAGGGAGAACAGAAGCAGTGAGG - Intergenic
991575806 5:68102374-68102396 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
991651986 5:68865112-68865134 CAGAGTGGGCAGAAGCAGGGTGG + Intergenic
992077767 5:73206913-73206935 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
992254971 5:74912065-74912087 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
992287207 5:75247990-75248012 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
992297032 5:75336184-75336206 CAAAGAGAACATAAGCAGGGAGG + Intergenic
992383936 5:76265769-76265791 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
992506161 5:77389365-77389387 GAGGGTGAGCCAAAGCAGGGTGG - Intronic
992740702 5:79770583-79770605 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
992908618 5:81373211-81373233 GAGGGTGAGCCGAAGCAAGGTGG + Intronic
993081189 5:83302486-83302508 GAGGGAGAGCTGAAGCAGGGTGG - Intronic
993119058 5:83753414-83753436 GAGGGTGAGGAGAAGCAGGTTGG + Intergenic
993145327 5:84086448-84086470 GAGAGCGAGCAGAAGCAGGGTGG - Intronic
993366755 5:87042993-87043015 GAGGGTGAGCTGAAGCAGGTCGG - Intergenic
993402602 5:87472475-87472497 AAGGGCGAGCAGAAGCAGGGCGG + Intergenic
993460253 5:88173406-88173428 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
993546568 5:89220051-89220073 GAGTGTGAGCTGAAGCAGGGTGG + Intergenic
993757712 5:91751497-91751519 GAGGATGAGCCGAAGCAGGGTGG - Intergenic
993888243 5:93442217-93442239 GAGTGTGAGCTGAAGCAGGGCGG + Intergenic
994005247 5:94829263-94829285 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
994014963 5:94955109-94955131 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
994138039 5:96309748-96309770 GAAGGTGAGCTGAAGCAGGGTGG - Intergenic
994142945 5:96361627-96361649 GAAGGTGAGCTGAAGCAGGGTGG - Intergenic
994377991 5:99037453-99037475 GAGGGTGAGCTGAAGCAAGGTGG + Intergenic
994586568 5:101716247-101716269 GAGGGTGAGCCAAAGCAGGGCGG - Intergenic
994622551 5:102179803-102179825 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
994636533 5:102351462-102351484 GAAGGTGAGCTGAAGCAGGGCGG + Intergenic
994641872 5:102420963-102420985 GAGGCCGAGCAGAAGCAGGGTGG + Intronic
994850901 5:105053683-105053705 GAGGGTCAGCAGAAGCAGAGTGG - Intergenic
995134967 5:108671193-108671215 GAGGGTGAGCAGAAGAAGTGTGG - Intergenic
995263860 5:110136247-110136269 GAGGGTGAGCAGAAGCAGGCTGG - Intergenic
995398788 5:111717506-111717528 GAAGGTGAGCAGAAGCAGGGTGG - Intronic
995459724 5:112390217-112390239 GAGGGTGAGCCAAAGCAGGGCGG + Intronic
995464339 5:112435843-112435865 GAGGGTGAGCAGAAGCAGGCTGG + Intergenic
995474955 5:112538796-112538818 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
995643014 5:114278841-114278863 GAGGGTGAGCTGAAGTAGGGCGG - Intergenic
995785816 5:115826197-115826219 GAGGGTGAGCAGAAGCAGAGTGG - Intergenic
995790742 5:115883499-115883521 AAGGGTGAGCAGAAGCAGGGTGG - Intronic
995808477 5:116080046-116080068 GAAGGTGAGCAGAAGCAGGGTGG + Intergenic
995811232 5:116108991-116109013 GATGGTGAGCAGAAGCAGGGTGG - Intronic
996029868 5:118693066-118693088 CAGAGTGATCAGAAGCGGTGAGG + Intergenic
996280824 5:121727023-121727045 TAGGGCGAGCAGAAGCAGGTTGG - Intergenic
996426701 5:123320609-123320631 GAGGATGAGCAGAAGAAGGGTGG - Intergenic
996428000 5:123335642-123335664 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
996592189 5:125160540-125160562 GAGAGTGAACAGAAGCAGGGTGG + Intergenic
996910963 5:128656268-128656290 GAGGGGGAGCAGAAGCAGGATGG - Intronic
997115642 5:131123147-131123169 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
997220442 5:132157658-132157680 GAGGGCGACCTGAAGCAGGGTGG - Intergenic
997497070 5:134337325-134337347 GAGGGCGAGCCGAAGCAGGGAGG - Intronic
997809608 5:136954339-136954361 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
998054528 5:139063068-139063090 CAGGCAGACAAGAAGCAGGGAGG + Intronic
998691905 5:144596290-144596312 GAGGGTGAACCGAAGCAGGGTGG - Intergenic
998772746 5:145564948-145564970 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
998801907 5:145877733-145877755 GAGGGTGAGCCAAAGCAGGGCGG + Intergenic
998927566 5:147142833-147142855 GAGAGGGAGCAGAAGCAGGGTGG - Intergenic
999030160 5:148281580-148281602 GAGGGTAAACAGAAGCAGAGTGG - Intronic
999488796 5:152027302-152027324 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
999688234 5:154121976-154121998 GAGGGTGAGCCAAAGCAGGGTGG + Intronic
1000068928 5:157721087-157721109 GAGGGAGAGCCGAAGCAGGGTGG + Intergenic
1000121012 5:158197917-158197939 CAGGGTGAGAAGAGGCAGAGCGG + Intergenic
1000194858 5:158947487-158947509 GAGGGCGAGCAGAAGCAGGACGG - Intronic
1000547977 5:162625556-162625578 GAGGGCTAGCAGAAGCAGGGTGG + Intergenic
1000574791 5:162964661-162964683 GAGGGTGAGCTGAAGCAGGATGG - Intergenic
1000591574 5:163165196-163165218 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1000786440 5:165550046-165550068 CAGGGTGAGCTGAAGCAGAGTGG - Intergenic
1001076328 5:168630848-168630870 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1001722871 5:173870807-173870829 GAGGCTGAAGAGCAGCAGGGAGG + Intergenic
1001976850 5:176007178-176007200 CAGGGTGACCAGAGACAGGTGGG - Intronic
1002193455 5:177490443-177490465 CAGGAGGAACAGAAAGAGGGAGG + Intronic
1002240578 5:177836602-177836624 CAGGGTGACCAGAGACAGGTGGG + Intergenic
1002393834 5:178938076-178938098 TTGGGTGAACAGAAGACGGGAGG + Intergenic
1002673456 5:180889543-180889565 GAGGGTGAGTGGAAGCAGGGTGG + Intergenic
1002944713 6:1750428-1750450 GAGGGTGAGCCGAAGCAGGGTGG + Intronic
1003165915 6:3678147-3678169 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1003434444 6:6072715-6072737 GAGGGTGAGCTGAAGTAGGGTGG - Intergenic
1003504095 6:6725546-6725568 CTGGGTCACCAGAGGCAGGGAGG + Intergenic
1003647463 6:7925842-7925864 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1003713590 6:8620090-8620112 GAGGGTTAGCCGAAGCAGGGTGG - Intergenic
1003970973 6:11299010-11299032 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1004554193 6:16679444-16679466 AAGGGGGGACAGAAGTAGGGAGG + Intronic
1005747093 6:28848590-28848612 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1005786117 6:29247617-29247639 CAGATTGAATAGAAGTAGGGAGG + Intergenic
1005801689 6:29431968-29431990 CAGGTTGAGCTCAAGCAGGGAGG - Exonic
1006199875 6:32279056-32279078 GAGGGTGAGCAGAAGTGGGGTGG + Intergenic
1007170608 6:39860642-39860664 CAGGGTGACCTGAAGCAGGAGGG + Intronic
1007382930 6:41502416-41502438 CAGAGTGAACAGGAGCGGGCAGG + Intergenic
1007714743 6:43849283-43849305 CAGGGTTTACAGAAGCCTGGGGG - Intergenic
1008176281 6:48271341-48271363 AAGGGCAAATAGAAGCAGGGTGG - Intergenic
1008366087 6:50682293-50682315 AAGGAGGAAGAGAAGCAGGGAGG - Intergenic
1008407676 6:51136734-51136756 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
1008474647 6:51922912-51922934 GAGTGTGAGCCGAAGCAGGGTGG - Intronic
1008575558 6:52856853-52856875 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
1008865334 6:56203812-56203834 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1008896920 6:56566493-56566515 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
1009290009 6:61869703-61869725 GAGGGTGAGCCGAAGCAGGGTGG + Intronic
1009305982 6:62089522-62089544 GAGGGCGAGCAGAAGGAGGGTGG - Intronic
1009455181 6:63848530-63848552 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
1009457924 6:63878576-63878598 CAGAGTCTACAGAAGCAGGCAGG + Intronic
1009458670 6:63887502-63887524 GAGGGTGGGCAGAATCAGGGAGG + Intronic
1009552032 6:65109812-65109834 GAGGGTGAATAGAAGTAGGCAGG - Intronic
1009570095 6:65374233-65374255 AAGGGTGAGCAGAAGCAGGGTGG + Intronic
1009628622 6:66166650-66166672 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1009718335 6:67428676-67428698 GAGGGCGAACAGAAGCAGGATGG - Intergenic
1009775822 6:68205455-68205477 GAGGGCCAGCAGAAGCAGGGTGG + Intergenic
1009795143 6:68456535-68456557 GAGGGTGAACCAAAGCAGGGTGG - Intergenic
1009880428 6:69560310-69560332 GAGGGCGAGCAGAAGCAGGTTGG + Intergenic
1009959585 6:70501757-70501779 GAGGGTGAGTAGAAGCAGGGTGG - Intronic
1009988155 6:70806476-70806498 GAGGGTGAGCTGAAGGAGGGCGG - Intronic
1010003834 6:70974315-70974337 GAGGGCAAACTGAAGCAGGGTGG + Intergenic
1010006148 6:70997839-70997861 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1010171862 6:72984683-72984705 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1010177915 6:73051215-73051237 CAGTGTGAACATATGCATGGAGG + Intronic
1010422186 6:75688366-75688388 GAGGGTGAGCTGAAGCAGGGCGG - Intronic
1010447080 6:75960165-75960187 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
1010522139 6:76850254-76850276 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1010569760 6:77463101-77463123 CAGGATGGACACAAGCAGGTCGG + Exonic
1010574870 6:77518357-77518379 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1010668392 6:78656100-78656122 GAGGGCGAGCAGAAGCAGCGTGG - Intergenic
1010676938 6:78756269-78756291 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1010747205 6:79577793-79577815 GAGGGTGAGCCGAAGCAGGGCGG + Intergenic
1010755724 6:79664138-79664160 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
1010961486 6:82151063-82151085 GAGGGCGAGCTGAAGCAGGGCGG + Intergenic
1010973191 6:82284485-82284507 GAGGGTGAGCCGAACCAGGGTGG - Intergenic
1011020784 6:82809787-82809809 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
1011086439 6:83546490-83546512 GAAGGCGAACTGAAGCAGGGTGG + Intergenic
1011120005 6:83942319-83942341 GAGGGCGAGCAGAAGCATGGTGG + Intronic
1011204000 6:84872017-84872039 CAGGGTGAGAGGAATCAGGGTGG + Intergenic
1011235656 6:85213452-85213474 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1011245205 6:85314897-85314919 GAGGGTGAGAAGAAGCAGGGCGG - Intergenic
1011288568 6:85751802-85751824 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1011299009 6:85854198-85854220 GAGGGTGAGCAGAAACAGGGTGG - Intergenic
1011340382 6:86307184-86307206 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1011348016 6:86392744-86392766 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1011387776 6:86815927-86815949 GAGGGTGAGCCGAACCAGGGTGG - Intergenic
1011417700 6:87139829-87139851 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1011578107 6:88827235-88827257 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1011831315 6:91374987-91375009 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1012083159 6:94785735-94785757 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1012128011 6:95454542-95454564 GAAGGCGAGCAGAAGCAGGGTGG - Intergenic
1012207548 6:96479190-96479212 GAGGGTGAACTGAAGCAAGGTGG - Intergenic
1012424857 6:99102686-99102708 CAGTGAGAAAAGGAGCAGGGAGG + Intergenic
1012484136 6:99702270-99702292 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1012585289 6:100914105-100914127 GAGGGCGAGCTGAAGCAGGGCGG - Intergenic
1012725908 6:102809418-102809440 GAGGGTGAGCTGAAGCAGAGCGG - Intergenic
1012870803 6:104670927-104670949 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1012940965 6:105415153-105415175 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1013024956 6:106262703-106262725 GAGGGTGACCAGAAGCAGGGTGG + Intronic
1013037910 6:106404727-106404749 GAGGGTGAGCAGAAGCAGTGTGG + Intergenic
1013452903 6:110303008-110303030 GAGGGCGAGCAGAAGTAGGGTGG + Intronic
1013682506 6:112541095-112541117 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1013877800 6:114855524-114855546 CAGGGTGGCCAGATGCTGGGGGG + Intergenic
1013920239 6:115394892-115394914 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1013939506 6:115644994-115645016 GAGTGCGAGCAGAAGCAGGGTGG + Intergenic
1014122798 6:117745870-117745892 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1014223629 6:118823388-118823410 GAAGGTGAGCAGAAGCAGGGTGG - Intronic
1014422906 6:121267294-121267316 GAGTGTGAACCGAAGCAGGGCGG + Intronic
1014523981 6:122479044-122479066 AAGGGCAAGCAGAAGCAGGGTGG - Intronic
1014527905 6:122522706-122522728 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1014584523 6:123182301-123182323 GATGGCGAGCAGAAGCAGGGTGG + Intergenic
1014907078 6:127043393-127043415 CAGGGCAAGCCGAAGCAGGGTGG + Intergenic
1015047952 6:128800817-128800839 GAGGAAGAAGAGAAGCAGGGGGG - Intergenic
1015181238 6:130365296-130365318 CAGAGGGAACTGAAGCACGGGGG - Intronic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1015211231 6:130701458-130701480 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1015386893 6:132634970-132634992 CGGGGTGAGCAGAAGCAGTGTGG + Intergenic
1015433307 6:133155389-133155411 GAGGGTGAGCAGAAGCATGTTGG - Intergenic
1015471788 6:133614456-133614478 GAGGGTGGGCCGAAGCAGGGTGG + Intergenic
1015533532 6:134244610-134244632 GAGGGCGAGCAGAAGCAGGTGGG - Intronic
1015623484 6:135156631-135156653 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1015801994 6:137069979-137070001 GAGGGTGAGCTGAAACAGGGTGG + Intergenic
1016006046 6:139090401-139090423 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
1016334839 6:142993891-142993913 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1016542084 6:145177792-145177814 GAGGGTGAGCTGAAACAGGGTGG + Intergenic
1016584883 6:145673446-145673468 GAGGGTGAGCCAAAGCAGGGCGG + Intronic
1017197505 6:151717152-151717174 GAGGGTGAGCCAAAGCAGGGTGG - Intronic
1017357039 6:153521464-153521486 GAGGGTGAGCTGAAGCAGGAGGG - Intergenic
1018094601 6:160374302-160374324 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
1018108628 6:160513532-160513554 GAGGGTTAGCAGAAGCAGGCTGG + Intergenic
1018114722 6:160572170-160572192 GAGGGTGACCTGAAGCAGGGTGG - Intronic
1018175837 6:161178595-161178617 GAGTGTGAGCTGAAGCAGGGTGG - Intronic
1018184212 6:161251812-161251834 CAGGAGGAACAAAAGCAGAGAGG + Intronic
1018805715 6:167258152-167258174 GAGGGGGAGCAGAAGCAGGGTGG + Intergenic
1019071976 6:169354150-169354172 GAGGGTGAGCTGAAGGAGGGTGG - Intergenic
1019203753 6:170341775-170341797 GAGGGTGACCAGAAGCAGGGTGG - Intronic
1019730654 7:2627628-2627650 GAGGGAGGACAGAAGGAGGGAGG + Intergenic
1020339071 7:7089572-7089594 GAGGGTAAGCAGAAGCAGGGTGG - Intergenic
1020391501 7:7662610-7662632 GAGGGCGAACAGAAACAGGGTGG - Intronic
1020608666 7:10368025-10368047 GAGGGTGAGCAGATGCAGGGTGG - Intergenic
1020629666 7:10625214-10625236 GAGGGCGAGCAGAAGCAGAGGGG + Intergenic
1020639818 7:10741757-10741779 CATGGCGAGCCGAAGCAGGGTGG + Intergenic
1020693960 7:11392240-11392262 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1020795631 7:12675808-12675830 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1020823930 7:13003261-13003283 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1021207772 7:17806802-17806824 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1021301777 7:18982007-18982029 CAGGGAGAAGAGAATCAGGGTGG + Intronic
1021347751 7:19548540-19548562 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1021378180 7:19934755-19934777 CTGGGAGCAAAGAAGCAGGGTGG - Intergenic
1021595700 7:22314233-22314255 CTGGCTGAAGAGAAGCAGGAAGG + Intronic
1022058930 7:26770750-26770772 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1022136069 7:27449518-27449540 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1022499689 7:30874710-30874732 CAGCAAGAACAGAAGCAGAGAGG - Intronic
1022704243 7:32787860-32787882 CAGGGAGACCAGAGGCAGAGGGG + Intergenic
1022908425 7:34877602-34877624 CAGGGAGACCAGAGGCAGAGGGG + Intronic
1023294718 7:38702650-38702672 CAGAGTGAAGAGAAGCAGTGAGG - Intergenic
1023511707 7:40959969-40959991 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1023617160 7:42031113-42031135 TGGGGTGAACAGAAACATGGAGG - Intronic
1023894230 7:44418771-44418793 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1024017643 7:45332692-45332714 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1024236295 7:47401707-47401729 CACGGTCACAAGAAGCAGGGGGG - Intronic
1024290955 7:47803639-47803661 CAGGGAGAACAGACGTGGGGTGG - Intronic
1024372968 7:48607339-48607361 GAGGGTGAGCTGAAGCAGGGTGG - Intronic
1024664993 7:51537073-51537095 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1024817534 7:53288305-53288327 GAGGGTGAGGAAAAGCAGGGTGG - Intergenic
1024946886 7:54817357-54817379 CAGGAAGACGAGAAGCAGGGAGG - Intergenic
1024950590 7:54856321-54856343 GAGGGTGAACAGAAGCAGTGTGG - Intergenic
1024951073 7:54860846-54860868 CAGAGAGAACAGAGGAAGGGAGG + Intergenic
1024998604 7:55295208-55295230 GAGGGTGAACTGAAGCAGGGTGG - Intergenic
1025638006 7:63340408-63340430 GAGGGCGAGCAGAAGCAGGTTGG - Intergenic
1025644690 7:63407691-63407713 GAGGGCGAGCAGAAGCAGGTTGG + Intergenic
1025714316 7:63941108-63941130 GAGGGTTAGCAGAAGCAGAGTGG + Intergenic
1026057276 7:66995613-66995635 CAGGTGGAGCAGAAGCCGGGAGG + Intronic
1026720838 7:72829438-72829460 CAGGTGGAGCAGAAGCCGGGAGG - Intergenic
1027221040 7:76214133-76214155 CAGGGTGAACCACAGCATGGTGG - Intronic
1027701749 7:81478611-81478633 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1027778309 7:82492999-82493021 GAGGGCGAGCCGAAGCAGGGTGG - Intergenic
1027864656 7:83630081-83630103 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
1028013635 7:85679804-85679826 GAGGGTGAGCTGAAACAGGGCGG - Intergenic
1028027810 7:85867982-85868004 CAGGGAGAACAGAACCAAGTTGG + Intergenic
1028142697 7:87290035-87290057 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1028267242 7:88741399-88741421 AAGGGTGAACAAAAGGAGAGTGG - Intergenic
1028340891 7:89718853-89718875 GAGGGTGAGCCAAAGCAGGGAGG + Intergenic
1028476416 7:91258172-91258194 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
1028523557 7:91758886-91758908 AAGGGTGAGCCAAAGCAGGGTGG + Intronic
1028630086 7:92925197-92925219 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
1028648122 7:93120714-93120736 GAGGGTGAGCTGAAGCTGGGTGG + Intergenic
1028791069 7:94853586-94853608 CAGGGAGAAGAGAAGGATGGGGG - Intergenic
1029062237 7:97810513-97810535 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1029324851 7:99797028-99797050 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1029514170 7:101015729-101015751 GAGGGTGAAGAAAGGCAGGGCGG + Intronic
1029899336 7:104022619-104022641 CAGGATGACCAGCTGCAGGGAGG + Intergenic
1029952007 7:104596032-104596054 GAGGGTGAGCCAAAGCAGGGTGG - Intronic
1030181026 7:106709549-106709571 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1030325944 7:108218228-108218250 GAGGGCGAGCCGAAGCAGGGTGG - Intronic
1030482225 7:110119552-110119574 GAGGGTGAGCAGAAGCAGGCTGG + Intergenic
1030500898 7:110357078-110357100 GAGGATGAACAAAAGCAGGGTGG - Intergenic
1030533952 7:110743633-110743655 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1030612720 7:111706489-111706511 GAGGGTGAGCTGAAGCAGGTTGG - Intergenic
1030703166 7:112662857-112662879 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1030771178 7:113476204-113476226 TAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1030958774 7:115889013-115889035 GAGAGTGAGCCGAAGCAGGGTGG + Intergenic
1031323436 7:120362871-120362893 CAGGGTGAACAGAACCAGGAAGG + Intronic
1031613852 7:123857477-123857499 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1031710917 7:125046146-125046168 TACAGTGAACCGAAGCAGGGTGG + Intergenic
1031717379 7:125125515-125125537 GAGGGCGAGCAGAAGCAGGCTGG - Intergenic
1032312668 7:130802820-130802842 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1032591193 7:133193908-133193930 CAGGATGGACTGAAGCATGGGGG - Intergenic
1032659834 7:133970640-133970662 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1032774098 7:135091744-135091766 CAGTATGAGCAGAAGCAAGGAGG - Intronic
1032893225 7:136222315-136222337 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1032957201 7:136984741-136984763 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1033617583 7:143031886-143031908 GAAGGTGAGCAGAAGCAGGGTGG + Intergenic
1033868329 7:145718938-145718960 GAGAGTGAGGAGAAGCAGGGTGG - Intergenic
1033887493 7:145966733-145966755 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1034314402 7:150116928-150116950 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1034715192 7:153235290-153235312 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1034792493 7:153983841-153983863 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1035006271 7:155663458-155663480 GAGGGTGAGCAGAGGCGGGGAGG + Intronic
1035068994 7:156127281-156127303 CAGGAAGAACAGGAGCAGAGAGG + Intergenic
1035636973 8:1155007-1155029 GAGTGGGAACAGAAGCAGGATGG - Intergenic
1035639353 8:1172482-1172504 CAGGGAGAACAGAACCAAGTTGG - Intergenic
1035679733 8:1479098-1479120 CAGGGTGAGCCCAGGCAGGGGGG + Intergenic
1035793982 8:2336757-2336779 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1035798823 8:2384951-2384973 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1035930619 8:3776242-3776264 CAGGGAGGATAGAAGCAGGGAGG - Intronic
1035998403 8:4574419-4574441 GAGGGTAAGCAGAAGAAGGGTGG - Intronic
1036510281 8:9393636-9393658 CAGGGTCTACAGAAACAGTGTGG + Intergenic
1036574454 8:10013236-10013258 CAGAGTGCACAAAAGCAGGCAGG - Intergenic
1037033268 8:14136322-14136344 AAGTGTGAGCCGAAGCAGGGTGG + Intronic
1037109989 8:15154366-15154388 CAGGCTGAGCAAAAGCTGGGTGG - Intronic
1037285559 8:17294725-17294747 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1037421811 8:18710388-18710410 CAGGGGGAACAGAACCAGGTTGG + Intronic
1037557679 8:20041289-20041311 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1037626059 8:20607932-20607954 GAGGATGAGCTGAAGCAGGGTGG - Intergenic
1037719563 8:21431198-21431220 GTGGGTGAGCAGAATCAGGGTGG + Intergenic
1037833966 8:22205372-22205394 CAGGGTGCAGAGGAGCAGGCTGG + Intronic
1039133775 8:34297417-34297439 GAGGGCGAGGAGAAGCAGGGTGG + Intergenic
1039154045 8:34535545-34535567 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1039282892 8:36006258-36006280 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
1039284481 8:36026208-36026230 GAGGGTGAGCCGAAGCAGTGTGG + Intergenic
1039624384 8:39032642-39032664 GAGGGTGAGCCAAAGCAGGGCGG - Intronic
1039680916 8:39735501-39735523 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1040354929 8:46608294-46608316 GAGGGAGAGCTGAAGCAGGGTGG + Intergenic
1040431785 8:47349941-47349963 GAGTGTGAGCCGAAGCAGGGCGG - Intronic
1040451759 8:47554715-47554737 AAGTGTGAGCCGAAGCAGGGTGG - Intronic
1040563992 8:48549662-48549684 CAGGGTGATCAGAGACATGGAGG + Intergenic
1040968890 8:53112787-53112809 GAGGGTGAGCTGAAGCAGGATGG - Intergenic
1041050707 8:53931747-53931769 GAGGGTGAGCAGAAGCAGTGTGG + Intronic
1041263095 8:56038648-56038670 GAGGGTGCAAAGAAACAGGGAGG - Intergenic
1041287222 8:56273386-56273408 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1041419160 8:57647278-57647300 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1041630658 8:60083230-60083252 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1041634793 8:60130635-60130657 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1041836557 8:62223270-62223292 GAGGGCGAGCCGAAGCAGGGTGG + Intergenic
1041900718 8:62979009-62979031 GAGGGCAAGCAGAAGCAGGGTGG - Exonic
1041944273 8:63424215-63424237 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1041997661 8:64083819-64083841 GAGTGTGAGCTGAAGCAGGGCGG + Intergenic
1042308758 8:67358915-67358937 GAGGGCGATCTGAAGCAGGGCGG - Intergenic
1042478731 8:69280045-69280067 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1042533334 8:69835476-69835498 CAGGAAGAACAGAGGCACGGGGG + Intergenic
1042622799 8:70724671-70724693 GAGAGCGAGCAGAAGCAGGGTGG - Intronic
1042627244 8:70771208-70771230 GAGGGTAAGCTGAAGCAGGGTGG - Intronic
1042645326 8:70980233-70980255 GAGGGTGAGCCAAAGCAGGGCGG - Intergenic
1042812987 8:72846241-72846263 GAGGGTGAGCCAAAGCAGGGTGG - Intronic
1042969386 8:74391475-74391497 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1043036749 8:75208635-75208657 GAAGGTGAGCAGAAGCAGGATGG - Intergenic
1043048818 8:75359823-75359845 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
1043080838 8:75763177-75763199 GAGGGTGAGCAAAAGCAGAGTGG + Intergenic
1043244442 8:77979698-77979720 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1043253749 8:78106872-78106894 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1043605180 8:81991078-81991100 GAGGATGAGCTGAAGCAGGGCGG - Intergenic
1044312458 8:90709335-90709357 GAGGATGAACAGAAGCAGAGTGG - Intronic
1044509559 8:93058759-93058781 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1044595354 8:93953565-93953587 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1044940346 8:97335434-97335456 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1044956651 8:97488121-97488143 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1045151873 8:99416713-99416735 GAGGGTGAGCCGAAGCAAGGTGG - Intronic
1045185265 8:99830895-99830917 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1045199581 8:99967069-99967091 GAGCATGAGCAGAAGCAGGGTGG + Intronic
1045390499 8:101710120-101710142 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1045646980 8:104308735-104308757 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1045797655 8:106065101-106065123 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1045802529 8:106117936-106117958 GAGTGTGAACTGAAGCAGGGTGG - Intergenic
1045973258 8:108103627-108103649 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1045975185 8:108123321-108123343 GAGGGAGAGCTGAAGCAGGGTGG - Intergenic
1046014550 8:108589901-108589923 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1046090438 8:109497386-109497408 CAGTGGGAACAAAGGCAGGGAGG - Intronic
1046153560 8:110258200-110258222 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1046220108 8:111202464-111202486 CAGGGAGAACAGAACCAAGTTGG + Intergenic
1046295781 8:112217972-112217994 GAGGGTGAACAGAACCAGGGTGG + Intergenic
1046430113 8:114113597-114113619 CAGGGGGAAGAGTAGCAGAGCGG - Intergenic
1046653188 8:116862930-116862952 CAGGGAGAACAGACGCAAGTAGG + Intronic
1046879257 8:119290291-119290313 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1046880868 8:119306947-119306969 AAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1046947555 8:119988306-119988328 GAGGGCGAGCAGAAGCAGAGTGG - Intronic
1046972629 8:120238902-120238924 GAGGGTGAGCATAAGCAGGGTGG - Intronic
1047121219 8:121907789-121907811 GAGGGTGAGAAGAATCAGGGTGG + Intergenic
1047133600 8:122051216-122051238 GAGGGTGAACTGAAGCACGGTGG + Intergenic
1047355663 8:124119334-124119356 CAGGTTGGACAGATGGAGGGTGG + Intronic
1047410300 8:124619231-124619253 CGGTGTGTACAGAAGCTGGGAGG - Intronic
1047478153 8:125255542-125255564 CAGTGTGATCACAAGCAGAGAGG + Intronic
1049733213 8:144189706-144189728 CAGGGAGAACAATGGCAGGGCGG - Intronic
1049872452 8:144991093-144991115 GAGAGGGAGCAGAAGCAGGGAGG - Intergenic
1049880198 8:145056819-145056841 CAGGGTGAGGAGAAGCAGGGGGG - Intergenic
1050031680 9:1393250-1393272 GAGGGCTAGCAGAAGCAGGGTGG + Intergenic
1050140917 9:2514785-2514807 CAGATTGAATAGAAGAAGGGAGG - Intergenic
1050201420 9:3149279-3149301 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1050234474 9:3563176-3563198 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1050597263 9:7216405-7216427 GAGGGTGAGCCGAAGCAGGGCGG + Intergenic
1050645274 9:7713072-7713094 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1050750698 9:8933163-8933185 AAGGGCGAGCAGAAGCAGGGTGG - Intronic
1050963256 9:11765413-11765435 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1050973990 9:11912724-11912746 CAGTGTGAGCAGAAGCAGGTGGG - Intergenic
1051112165 9:13651411-13651433 GAGGGGGAGCTGAAGCAGGGTGG - Intergenic
1051124767 9:13791687-13791709 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1051160285 9:14199966-14199988 CAGGGAGAACAGGAGCAGAAGGG + Intronic
1051209628 9:14728046-14728068 CAGGGTGAAAAGAAGGACCGTGG - Intergenic
1051308766 9:15746771-15746793 GAGGGTGAGCTGAAGCAGGGCGG + Intronic
1051322025 9:15914941-15914963 GAGGGTGAGCAGAAGCAGAGTGG - Intronic
1051452057 9:17207635-17207657 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1051571568 9:18564306-18564328 GAGGGTGAGCCCAAGCAGGGTGG - Intronic
1051603665 9:18898563-18898585 CAGGGAGAACAGAACCAAGTTGG + Intronic
1051611729 9:18968042-18968064 GAAGGTGAGCAGAAGCAGGGTGG - Intronic
1051695895 9:19767597-19767619 GAGGGTAAGCAGAAGCAGGGTGG - Intronic
1051814241 9:21087068-21087090 GAGGGTAAGCAGAAGGAGGGTGG + Intergenic
1051998378 9:23247577-23247599 AAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1052096678 9:24391776-24391798 GAGGGCGAGCCGAAGCAGGGTGG - Intergenic
1052125219 9:24765701-24765723 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1052144127 9:25026158-25026180 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1052146992 9:25061627-25061649 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1052217288 9:25982668-25982690 CAGGGCAAGCTGAAGCAGGGCGG + Intergenic
1052329287 9:27251328-27251350 GAGGATGAGCTGAAGCAGGGTGG + Intergenic
1052366278 9:27615214-27615236 GAGGGTGAGCAGAAGTAGGGTGG - Intergenic
1052366967 9:27622913-27622935 CAGGGTGAAGAGAATGGGGGAGG + Intergenic
1052382417 9:27785480-27785502 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1052506284 9:29358808-29358830 GAGGGTGAGCAGAAGTAGGGTGG + Intergenic
1052887692 9:33666172-33666194 GAGGGTGAGCTGAACCAGGGCGG + Intergenic
1053387746 9:37707978-37708000 CAGGGTGGAGAGGAGCAGGTGGG + Intronic
1054887304 9:70212592-70212614 GAGTGTGAGCTGAAGCAGGGTGG - Intronic
1054889045 9:70232355-70232377 TTGGGGGAACAGAAGCAGGGTGG + Intergenic
1055013907 9:71595687-71595709 GAGTGTGAGCCGAAGCAGGGCGG + Intergenic
1055061345 9:72072342-72072364 GAGGGCGAGCAGAAGCAGGGTGG + Intronic
1055339053 9:75262234-75262256 GAAGGTGAGCAGAAGCAGGATGG - Intergenic
1055345124 9:75327443-75327465 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1055453499 9:76452594-76452616 CAGGGGGAGGAGAGGCAGGGAGG + Intronic
1055494492 9:76841161-76841183 GAGGGTGAGCCAAAGCAGGGTGG + Intronic
1055614208 9:78054368-78054390 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1055628676 9:78200799-78200821 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1055642881 9:78334481-78334503 GAGGGCGAGCTGAAGCAGGGCGG + Intergenic
1055823970 9:80301562-80301584 GAGGGCGAGCAGAAGCAGGATGG - Intergenic
1056172147 9:83996754-83996776 CAGGCTGTACAGGAGCAGGCTGG + Intronic
1056300063 9:85231445-85231467 TGGGGTGAACAGTAGGAGGGGGG + Intergenic
1056302713 9:85258445-85258467 CATGGCAAACAGAAGCAGGGTGG - Intergenic
1056385227 9:86091052-86091074 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1056997864 9:91479948-91479970 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
1057460233 9:95254424-95254446 GAGGGTGAGCAGAAGCCAGGTGG + Intronic
1057698186 9:97342147-97342169 GAGGGTGAGCCGAAGAAGGGCGG - Intronic
1057752355 9:97803239-97803261 CAGGCGGAAGAGAAGGAGGGAGG + Intergenic
1057882363 9:98802153-98802175 CAGGGTGAAGAGAAACAGCAGGG + Intergenic
1058011957 9:99988702-99988724 GAGGGCGAGCCGAAGCAGGGTGG + Intronic
1058182436 9:101815365-101815387 GAGGGTGAGCAGAAGCAGCGTGG + Intergenic
1058203035 9:102067153-102067175 GAAGGTGAGCTGAAGCAGGGCGG - Intergenic
1058259735 9:102814203-102814225 GAGGGTGAGTAGAAGCAGGGTGG + Intergenic
1058265712 9:102897255-102897277 GAGGGTGAGCAGAAGCAGGGAGG + Intergenic
1058393098 9:104520008-104520030 GAGGGCGAGCCGAAGCAGGGTGG + Intergenic
1058941343 9:109815524-109815546 CAGGGTAGACAGAAACAGGGGGG + Intronic
1059553708 9:115256547-115256569 CAGGAGGAAGAGAAGCAGGGAGG + Intronic
1060414456 9:123420775-123420797 CATGCTGAACAAAAGCAGCGAGG + Intronic
1060549924 9:124480063-124480085 CAGTGTGAGCAGAAGGATGGAGG - Intergenic
1060550564 9:124482926-124482948 CAGGGTGTAGTCAAGCAGGGCGG + Exonic
1060831660 9:126721488-126721510 GAGGGGGCACAGGAGCAGGGAGG + Intergenic
1061552430 9:131345363-131345385 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
1061559146 9:131391718-131391740 GAGGCTGAACAGTAACAGGGTGG - Intergenic
1061798174 9:133100560-133100582 CATGGGGAACAGAAGGACGGAGG - Intronic
1061820249 9:133223433-133223455 CAGGGTAAACAGGCTCAGGGCGG + Intergenic
1062240384 9:135534471-135534493 CAGGGTAAACAGGCTCAGGGCGG - Intergenic
1203573148 Un_KI270744v1:151631-151653 GAGTGTGAGCTGAAGCAGGGTGG + Intergenic
1185911061 X:3981847-3981869 GAGGGCGAGCTGAAGCAGGGTGG + Intergenic
1186181400 X:6976496-6976518 GAGGGTGAGCAGAAACAGGGTGG - Intergenic
1186207698 X:7217223-7217245 GAGGTTGAACAGATGGAGGGGGG + Intergenic
1186332833 X:8554292-8554314 GAGGGCGAGCAGAAGCAGGGTGG + Intronic
1186370094 X:8937687-8937709 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1186599890 X:11025091-11025113 GAAGGTGAGCAGAAGCAGAGTGG - Intergenic
1186740846 X:12516790-12516812 CAGGGGGAACAGAACCAAGTTGG - Intronic
1186773393 X:12839656-12839678 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1186774941 X:12855044-12855066 GAGGGTGAGCAGAAGCAAGGTGG - Intergenic
1186832432 X:13404141-13404163 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1186888441 X:13938055-13938077 TAAGGAGAACAGAAGCACGGCGG + Intronic
1186961034 X:14736533-14736555 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1187248408 X:17574671-17574693 GAGGGTGAGCCGAAGCAGGATGG - Intronic
1187289564 X:17940068-17940090 CAGTGAGAGCAGAAGCAGGAGGG - Intergenic
1187620445 X:21047354-21047376 GAGAGTGAGCAGAAGCAGGGTGG + Intergenic
1187660759 X:21544734-21544756 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1187729486 X:22238280-22238302 GAGGGTGAGCCAAAGCAGGGTGG + Intronic
1187829207 X:23363625-23363647 GAGGGTGAGCCGAAGCAGGGCGG - Intronic
1187840019 X:23477200-23477222 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
1187840496 X:23482177-23482199 GAGGGTGAGCCGAAGCAGAGTGG - Intergenic
1188084078 X:25882385-25882407 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1188123054 X:26334150-26334172 GAGGGTGAGCCGAAGCAGGGCGG + Intergenic
1188130097 X:26420061-26420083 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
1188193129 X:27196830-27196852 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1188211281 X:27428195-27428217 CAATGTCCACAGAAGCAGGGAGG + Intergenic
1188868372 X:35342983-35343005 CAGCATGAACAGAAAAAGGGGGG + Intergenic
1188893380 X:35636658-35636680 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1188915539 X:35905161-35905183 GAGAGTGAGCAGAAGCAGGATGG - Intergenic
1188954610 X:36418835-36418857 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1189017725 X:37301550-37301572 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1189039848 X:37530754-37530776 GAGGGCGAGTAGAAGCAGGGTGG - Intronic
1189243266 X:39542004-39542026 TAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1189382861 X:40514062-40514084 CAGGGTGGAGTGAAGGAGGGAGG + Intergenic
1189558948 X:42172893-42172915 CAGGCTGAACACCAGCAAGGTGG + Intergenic
1189575190 X:42343666-42343688 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1189754051 X:44252977-44252999 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1189937674 X:46086971-46086993 GAGGGCGAGCCGAAGCAGGGTGG + Intergenic
1189939942 X:46111392-46111414 CAGGGAGAACAGAACCAAGTTGG - Intergenic
1189978506 X:46486361-46486383 GAGGGCGAGCTGAAGCAGGGCGG - Intronic
1190397417 X:49999013-49999035 CTGGGTGAAAAAAAGCAAGGGGG - Intronic
1190505792 X:51125074-51125096 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1190648999 X:52550908-52550930 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1190683451 X:52849531-52849553 GAGGGCGAGCTGAAGCAGGGCGG - Intergenic
1190944045 X:55073351-55073373 GAGGGTGAGCAAAAGCAGGGTGG - Intergenic
1190963805 X:55278395-55278417 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1190979483 X:55443382-55443404 GAGGGAGAGCAGAAGCAAGGTGG + Intergenic
1191003836 X:55689100-55689122 GAGGGTAAGCCGAAGCAGGGTGG - Intergenic
1191004996 X:55702268-55702290 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191024202 X:55896238-55896260 GAGGACGAGCAGAAGCAGGGTGG + Intergenic
1191073762 X:56430051-56430073 GAGGGTGAGCTAAAGCAGGGCGG - Intergenic
1191079635 X:56495421-56495443 GAGAGTGAGCTGAAGCAGGGTGG - Intergenic
1191094428 X:56659427-56659449 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1191099750 X:56712515-56712537 CACGGAGAAGAAAAGCAGGGTGG - Intergenic
1191135488 X:57059245-57059267 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1191138820 X:57094483-57094505 GAGGGCGAGCCGAAGCAGGGTGG + Intergenic
1191148181 X:57190691-57190713 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1191153175 X:57242604-57242626 GAGGGTGAGCAGAAACAGGGTGG + Intergenic
1191174241 X:57482534-57482556 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1191237819 X:58150496-58150518 GAGAGTGAGCTGAAGCAGGGTGG + Intergenic
1191591253 X:62887957-62887979 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191606165 X:63065475-63065497 GAGGGGAAGCAGAAGCAGGGTGG + Intergenic
1191645621 X:63478164-63478186 GAGGGTGAGCTGAAGCAGGGAGG + Intergenic
1191657374 X:63613313-63613335 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1191676556 X:63797624-63797646 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191686658 X:63899282-63899304 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1191766804 X:64706345-64706367 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
1191788848 X:64946392-64946414 GAGGGCGAGCAGAATCAGGGTGG - Intronic
1191793699 X:64999287-64999309 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1191802632 X:65098592-65098614 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1191809865 X:65175174-65175196 GAGGGTAAGCAGAAGCAGGGTGG - Intergenic
1191873016 X:65765674-65765696 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1191882455 X:65856630-65856652 GAGGGTGAGCTGAAGCAGGGAGG - Intergenic
1191894682 X:65979589-65979611 CTGGCAGAACAGAAACAGGGAGG - Intergenic
1191907443 X:66108279-66108301 GAGGGTGAGGTGAAGCAGGGTGG - Intergenic
1191941756 X:66489041-66489063 GAGGGTGAGCTGAAGCAGGGAGG + Intergenic
1191984762 X:66968296-66968318 GAGGGTGAACCAAAGCAGGGTGG + Intergenic
1191987306 X:66995435-66995457 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1192009176 X:67250062-67250084 GAAGGTGAACAGAAGCAGGGTGG + Intergenic
1192064360 X:67865046-67865068 AAGGGTGGGCTGAAGCAGGGTGG - Intergenic
1192129063 X:68530761-68530783 GGGGGTGAGCTGAAGCAGGGTGG - Intronic
1192341298 X:70265717-70265739 CCGGGTGTACAGAATGAGGGTGG + Intergenic
1192395851 X:70780478-70780500 GAGGGTGAACCAAAGCAGGGTGG + Intronic
1192449575 X:71235513-71235535 CAGTGTGAACAAAGGCATGGAGG - Intergenic
1192524468 X:71829810-71829832 GAGGGCGAGCTGAAGCAGGGTGG + Intergenic
1192598470 X:72437184-72437206 GAGGGTGAGCTGAAGCAGGGTGG + Intronic
1192674506 X:73182230-73182252 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1192701837 X:73482466-73482488 AAGGGTGAGCAGAAGAAGGGTGG - Intergenic
1192712695 X:73607784-73607806 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
1192718821 X:73670204-73670226 CACAGAGAACAAAAGCAGGGTGG - Intronic
1192727469 X:73768066-73768088 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1192759273 X:74078346-74078368 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1192825879 X:74695860-74695882 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1192916126 X:75652741-75652763 GAGAGTGAGTAGAAGCAGGGTGG - Intergenic
1192953251 X:76039897-76039919 GAGGGTGAACAGAAGCAGTGTGG - Intergenic
1192958257 X:76096140-76096162 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1192971222 X:76233496-76233518 GAAGGTGAGCAGAAGCAGTGTGG + Intergenic
1192973804 X:76261477-76261499 GAGGGTGAACTGAGGCAAGGCGG - Intergenic
1192977364 X:76300314-76300336 GAGGCTGAGCTGAAGCAGGGTGG - Intergenic
1192980292 X:76332183-76332205 GAGGGTGAGCAGAAGCAGGCTGG + Intergenic
1192992048 X:76471073-76471095 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1192993947 X:76492501-76492523 GAGGGTGAGCAGAAACTGGGTGG + Intergenic
1192998102 X:76533692-76533714 GAGAGTGAGCAGAAGCAGGGTGG - Intergenic
1192999691 X:76550719-76550741 GAGGGTGAGATGAAGCAGGGTGG - Intergenic
1193003727 X:76591725-76591747 GAGGGTGACCCAAAGCAGGGTGG - Intergenic
1193010558 X:76670876-76670898 GAGGGTGAGCAGAAGCAGAGTGG + Intergenic
1193019981 X:76781082-76781104 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1193040540 X:76999266-76999288 CAGGGTAAGCAGAAGTAGGGTGG - Intergenic
1193043882 X:77032069-77032091 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1193068517 X:77282672-77282694 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1193081670 X:77412335-77412357 GAGGGGGAGCTGAAGCAGGGTGG - Intergenic
1193254102 X:79325977-79325999 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1193258658 X:79379852-79379874 AAGAGCGAAGAGAAGCAGGGTGG + Intergenic
1193266772 X:79481847-79481869 GAGGGTGAGCTGAAGCAGAGTGG + Intergenic
1193341384 X:80352970-80352992 GAGGGTAAGCAGAAGCAGGGTGG - Intronic
1193356077 X:80521465-80521487 GAGGGTGAGCCGAAGCAGAGTGG - Intergenic
1193394396 X:80967449-80967471 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1193398182 X:81010527-81010549 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1193402567 X:81063841-81063863 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1193404398 X:81083781-81083803 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1193514314 X:82445443-82445465 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1193525366 X:82581628-82581650 GAGGGTGAGCAAAATCAGGGTGG - Intergenic
1193562581 X:83037636-83037658 GAGGGTGAGCAGTAGCAGGGTGG + Intergenic
1193571597 X:83151536-83151558 GAGGACGAGCAGAAGCAGGGTGG + Intergenic
1193645627 X:84065963-84065985 GAGGGTGAGCAGAAGTAGGGTGG + Intronic
1193780119 X:85691112-85691134 CAGACTGAACACAAGCATGGAGG - Intergenic
1193897181 X:87128461-87128483 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1194021176 X:88694343-88694365 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1194203193 X:90979359-90979381 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1194208586 X:91040470-91040492 GAGGGTGAGCTGAAGAAGGGTGG - Intergenic
1194242484 X:91469628-91469650 GAGGGCGAACAGAAGCAGGTGGG + Intergenic
1194254791 X:91622625-91622647 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
1194315371 X:92369793-92369815 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1194355702 X:92881812-92881834 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1194391082 X:93319272-93319294 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1194445071 X:93976526-93976548 GAGAGTGAAGAAAAGCAGGGTGG - Intergenic
1194631539 X:96291548-96291570 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1194643487 X:96429882-96429904 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1194652527 X:96533113-96533135 GAGGGCGAAGCGAAGCAGGGTGG + Intergenic
1194772363 X:97921190-97921212 GAGGGCGAGCCGAAGCAGGGCGG + Intergenic
1194783209 X:98049651-98049673 AAGGGCGAGCAGAAGCAGAGTGG - Intergenic
1194798481 X:98241138-98241160 CAGGGCAAGCCGAAGCAGGGTGG - Intergenic
1194810246 X:98380257-98380279 CAGGGTGCCCAGCAGCAGGCTGG - Intergenic
1194837558 X:98699409-98699431 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1194959146 X:100215080-100215102 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1195097981 X:101524483-101524505 GAGGGTGAGCTGAAGCAGGGCGG + Intronic
1195127516 X:101822807-101822829 GAGGGCGAGCGGAAGCAGGGTGG - Intergenic
1195140021 X:101950016-101950038 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1195179045 X:102339338-102339360 CAGGCTGAACAGCTGCAGAGAGG - Intergenic
1195345041 X:103941006-103941028 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
1195434774 X:104829425-104829447 GAGAGCGAGCAGAAGCAGGGTGG - Intronic
1195508228 X:105684203-105684225 GAGGGCGAGCTGAAGCAGGGCGG + Intronic
1195519333 X:105812748-105812770 GAGGGTGAGCCAAAGCAGGGAGG - Intergenic
1195547297 X:106126817-106126839 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1195810708 X:108825504-108825526 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1195820952 X:108944660-108944682 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1195826146 X:109003513-109003535 GAGGGTGAGCAGAAGCTGGGTGG + Intergenic
1195832803 X:109078024-109078046 CAGGGTGAACCAAAGCAGGGTGG - Intergenic
1195842670 X:109191853-109191875 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1195844358 X:109209872-109209894 GAGGGTGAGCAGAAGCAGAGTGG - Intergenic
1195947368 X:110229677-110229699 GAGGGCGAGCTGAAGCAGGGCGG + Intronic
1195985490 X:110626155-110626177 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1196133315 X:112181025-112181047 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1196139639 X:112246691-112246713 GAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1196167513 X:112551732-112551754 GAGGGAGAACTGAAGCAGAGTGG - Intergenic
1196230236 X:113212507-113212529 GAGGGTGAGCCAAAGCAGGGTGG - Intergenic
1196273246 X:113736317-113736339 AAGGGTGAGCCGAAGCAGGGTGG - Intergenic
1196367891 X:114943465-114943487 AAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1196476518 X:116092469-116092491 GAGGGTGAGCAGACGCAGGGTGG - Intergenic
1196587126 X:117443292-117443314 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1196603049 X:117623388-117623410 GAGGGTCAGCAGAAGCAGGGTGG - Intergenic
1196861380 X:120031644-120031666 CAAGGTTTACAGAAGGAGGGAGG + Intergenic
1196944627 X:120811680-120811702 GAGTGTGAGCCGAAGCAGGGTGG + Intergenic
1196946678 X:120833355-120833377 CAGGGCAAGCTGAAGCAGGGTGG - Intergenic
1197004166 X:121475185-121475207 GAGGGTGAGCTGAAGCATGGTGG - Intergenic
1197023284 X:121716808-121716830 GAAGGTGAAGAGAAGCAGAGTGG - Intergenic
1197051097 X:122060879-122060901 GAGGGCCAGCAGAAGCAGGGTGG + Intergenic
1197184665 X:123573356-123573378 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1197395676 X:125923625-125923647 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
1197505917 X:127305663-127305685 GAGGGCGAACAGAAGCAGGGTGG + Intergenic
1197614400 X:128675351-128675373 GAGGGTGAGCAGAAGCAGGGAGG - Intergenic
1197771182 X:130090475-130090497 CAGTGTGAACACAGGCACGGAGG - Intronic
1197926853 X:131656071-131656093 TAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1197959591 X:131989631-131989653 AGAGGTGAACTGAAGCAGGGAGG + Intergenic
1198060648 X:133042490-133042512 GAGAGTGAGCAGAAGCAGGGTGG - Intronic
1198062520 X:133061646-133061668 GAGGGCGAGCAGAAGCAGGGTGG + Intronic
1198085549 X:133278837-133278859 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1198293737 X:135263788-135263810 GAGGGCGAGCTGAAGCAGGGCGG - Intronic
1198295482 X:135282783-135282805 GAGGGTGAGCAGAAGCAAGGTGG - Intronic
1198366138 X:135941703-135941725 GAGTGTGAGCCGAAGCAGGGCGG - Intergenic
1198549982 X:137735186-137735208 CAGGGAGAACAGATGCATGAAGG - Intergenic
1198571251 X:137959825-137959847 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1198645577 X:138802388-138802410 AAGGGTGAGCAGAAGCAGGATGG - Intronic
1198680632 X:139178007-139178029 CAGGGCGAGCTGAAGCAGGGTGG - Intronic
1198687240 X:139239399-139239421 CAGGGAGAATAGAACCAGGTTGG + Intergenic
1198725866 X:139676295-139676317 GAGGGTGAACTGAAGCAGGGTGG - Intronic
1198753460 X:139958778-139958800 GAGGGCGAGCAGAAGCAGAGTGG + Intronic
1198944624 X:141996603-141996625 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1199035914 X:143050792-143050814 GAGAGTGAACATAAGCAGGGTGG - Intergenic
1199180952 X:144853792-144853814 GAGGGTGAGCTGAAGCAGGGCGG + Intergenic
1199292304 X:146119007-146119029 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1199360001 X:146907027-146907049 CAGGATGACCAGCAGCAGAGAGG - Intergenic
1199383738 X:147200442-147200464 GAGGGTGAGCTGAAGCAGGGTGG + Intergenic
1199436528 X:147819213-147819235 GAGGGCGAGCTGAAGCAGGGTGG + Intergenic
1199436775 X:147820929-147820951 CAGGGAGAATGGAAGCAGGTTGG + Intergenic
1199452282 X:147990283-147990305 GAGGGTGAGTAGAAGCAGGGTGG - Intronic
1199911876 X:152295669-152295691 GAGGGTGACCCGAAACAGGGCGG - Intronic
1199939653 X:152612568-152612590 GAGGGTGAGCTGAAGCAGGGCGG - Intergenic
1199974220 X:152883119-152883141 CAGGGTCAACAGGAGCAGCCAGG + Intergenic
1200007361 X:153096387-153096409 CAGATTGCACAGAAGTAGGGAGG + Intergenic
1200136805 X:153879205-153879227 CAGAGTGAGAAGAGGCAGGGGGG + Intronic
1200333139 X:155319403-155319425 GAGGGTGAGCCAAAGCAGGGTGG + Intronic
1200365497 X:155657899-155657921 GAGGGTGAGCAGAACCAGGGTGG - Intronic
1200378434 X:155808939-155808961 GAGGGTGAGCAAAAGCAGGGCGG + Intergenic
1200388337 X:155916954-155916976 CAGGGAGAACAGAACCAAGTTGG - Intronic
1200388581 X:155918603-155918625 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
1200405949 Y:2811580-2811602 GAGGGTAAGCTGAAGCAGGGTGG - Intergenic
1200549026 Y:4554785-4554807 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1200573577 Y:4862228-4862250 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
1200623420 Y:5481328-5481350 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1200664047 Y:5998794-5998816 GAGGATGAGCTGAAGCAGGGTGG + Intergenic
1200940071 Y:8771877-8771899 CAGGGTGAAGAGAGGCAGTGAGG - Intergenic
1200940373 Y:8774252-8774274 CAGGGTAAAGAGAGGCAGTGAGG - Intergenic
1201065770 Y:10092792-10092814 AAGGGGGAGCAGAGGCAGGGCGG + Intergenic
1201353420 Y:13071772-13071794 GAGGGTGAGATGAAGCAGGGTGG + Intergenic
1201376662 Y:13330374-13330396 GAGGGCAAACAGAAGCAGGGTGG + Intronic
1201390732 Y:13494450-13494472 GAGGGAGAGCACAAGCAGGGTGG + Intergenic
1201394840 Y:13537107-13537129 CAGGGAGAGCCAAAGCAGGGTGG - Intergenic
1201409082 Y:13680669-13680691 GAGGGTGAGAAGAAGTAGGGTGG + Intergenic
1201498739 Y:14618362-14618384 GAGGGTGAGCAGAAGTAGGATGG - Intronic
1201529770 Y:14979043-14979065 CAGGGTGAAGAGTATCATGGTGG - Intergenic
1201543145 Y:15131532-15131554 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1201563660 Y:15344161-15344183 AAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1201590552 Y:15610496-15610518 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1201913569 Y:19158197-19158219 GAGGGTGAGCCAAAGCAGGGTGG + Intergenic
1201922123 Y:19245213-19245235 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1202130628 Y:21605559-21605581 CAGGATGAACGGAGGCAGTGAGG - Intergenic
1202335109 Y:23800819-23800841 CAGCATGAGCTGAAGCAGGGTGG + Intergenic
1202535658 Y:25869240-25869262 CAGCATGAGCTGAAGCAGGGTGG - Intergenic