ID: 1184306757

View in Genome Browser
Species Human (GRCh38)
Location 22:43608284-43608306
Sequence TAGCAAGCAGCCTTGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 216}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184306757_1184306760 -4 Left 1184306757 22:43608284-43608306 CCATCCACCAAGGCTGCTTGCTA 0: 1
1: 0
2: 3
3: 20
4: 216
Right 1184306760 22:43608303-43608325 GCTATGAGCACCAAGCAGCAAGG 0: 1
1: 0
2: 0
3: 13
4: 167
1184306757_1184306761 3 Left 1184306757 22:43608284-43608306 CCATCCACCAAGGCTGCTTGCTA 0: 1
1: 0
2: 3
3: 20
4: 216
Right 1184306761 22:43608310-43608332 GCACCAAGCAGCAAGGAACAAGG 0: 1
1: 0
2: 2
3: 17
4: 348
1184306757_1184306763 14 Left 1184306757 22:43608284-43608306 CCATCCACCAAGGCTGCTTGCTA 0: 1
1: 0
2: 3
3: 20
4: 216
Right 1184306763 22:43608321-43608343 CAAGGAACAAGGAAAGACACAGG 0: 1
1: 0
2: 2
3: 52
4: 438

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184306757 Original CRISPR TAGCAAGCAGCCTTGGTGGA TGG (reversed) Intronic
903352651 1:22727294-22727316 TAGCCCACATCCTTGGTGGATGG + Intronic
907602967 1:55788546-55788568 CAGCAAAAAGCCATGGTGGACGG + Intergenic
907677412 1:56531434-56531456 TAGCAAGCAGGCTTTGTGGTAGG - Intronic
907992283 1:59594604-59594626 GAGCACTCAGCCTTGGTGGGAGG - Intronic
910116685 1:83739210-83739232 TGGCAAACAGCAATGGTGGACGG + Intergenic
914941151 1:152023896-152023918 GAGAAAGCAGCCTTGTTGCAGGG + Intergenic
915680042 1:157572584-157572606 AATGAAGCGGCCTTGGTGGAAGG + Intergenic
916344202 1:163769801-163769823 TAGCCAGCAGCCTTTCTGCATGG + Intergenic
917215567 1:172674856-172674878 TGGCAAGCAGCACTGGAGGAGGG - Intergenic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
920096107 1:203487620-203487642 TAGGAAGCAGCCATGGGAGAGGG + Exonic
920967817 1:210715830-210715852 TAGGAGGCAACCTCGGTGGAAGG + Intronic
922414659 1:225410165-225410187 TCTCAAGCAGCCTTGGAGGCAGG + Intronic
923566173 1:235077524-235077546 TGGCAAGCAGCCTTTGTGCCTGG - Intergenic
1063455529 10:6179808-6179830 GAGCCAGCAGCCTTTGGGGAAGG - Intronic
1064123345 10:12638292-12638314 TAGCAAGCAGGCTTAGAGTATGG - Intronic
1064949763 10:20835298-20835320 TATCAAGAAAGCTTGGTGGAAGG - Intronic
1065819831 10:29515613-29515635 TAGCTGCCAGCCTGGGTGGAAGG - Intronic
1066780654 10:38942257-38942279 GAGCAAGAAGCCTCGGTGGCGGG - Intergenic
1068572780 10:58649396-58649418 TAGCAGGCAGGCTTCGTGGGTGG - Intronic
1068859326 10:61830685-61830707 TCGCAAGCAGCCTTTGTTCAGGG - Intergenic
1068988851 10:63131015-63131037 CAGCAAACAGCGGTGGTGGACGG + Intergenic
1069028530 10:63570810-63570832 TCTCTAGCAGCCTTGATGGAAGG - Intronic
1069041926 10:63704558-63704580 TAGCTCACAGCCTTGGTTGAAGG + Intergenic
1069589942 10:69635409-69635431 TAGCAGGCAGAGTTGGTGGTGGG - Intergenic
1069798684 10:71069208-71069230 CAGCAGGCAGCCTTTCTGGAGGG - Intergenic
1071556992 10:86612081-86612103 CGGCAAACAGCCGTGGTGGACGG - Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072801795 10:98397391-98397413 CAGCAAGGAGCCATGCTGGAAGG + Exonic
1073254075 10:102139907-102139929 CAGCCAGCAGCCTGTGTGGAAGG + Exonic
1074416921 10:113274559-113274581 TATCAACCAGCCTTGGGGGAAGG - Intergenic
1075649467 10:124118255-124118277 TATCATGCAGCCAGGGTGGAGGG - Intergenic
1078326987 11:10388988-10389010 TAGGAAGCAACCTTGGGGTAAGG - Intronic
1078780591 11:14435411-14435433 TAGCAAACAGCCTTGGAAGATGG + Intergenic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1080881486 11:36325361-36325383 TAGCAAACGGCAGTGGTGGACGG + Intronic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1083969120 11:66061905-66061927 TGGCAATCAGCCATGGGGGAGGG - Exonic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1086175342 11:83884667-83884689 TACCAAGCAGCCTAACTGGAAGG + Intronic
1087574544 11:99974069-99974091 TAGCAAGCTGCCTAAGTGGAAGG + Intronic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088834523 11:113566754-113566776 CAGCAGGCAGCCTGGGTGGGAGG - Intergenic
1089076575 11:115743314-115743336 TAGCAGACAGCCTGGGTGGAGGG + Intergenic
1091698148 12:2641821-2641843 TAGAAAACAGCCTTTGTGGGGGG - Intronic
1091955410 12:4637376-4637398 TGGGAAGCAGCTTTGGTTGAGGG + Intronic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1094798272 12:34001062-34001084 TAGCAAGCATCCTTGGCAGGGGG - Intergenic
1097786393 12:63764915-63764937 TAGCAAAGAGCCTTGGAAGATGG - Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1101430638 12:104624037-104624059 AAGCCTGCAGCCTTGATGGAGGG + Intronic
1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG + Intergenic
1106159195 13:27185341-27185363 TAGGTAGCAGCAATGGTGGAGGG - Intergenic
1106619290 13:31358000-31358022 TAGCTAGCAGCAGTGGTGGGAGG - Intergenic
1107202202 13:37734869-37734891 TAGCAAGGAACCATGGAGGATGG + Intronic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1110846140 13:80192428-80192450 TGGCAACCAGCAGTGGTGGATGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111721598 13:91953180-91953202 TAGCAAGCACACTTGGGGTAAGG + Intronic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1112234779 13:97625406-97625428 TGGGAAGCAGCACTGGTGGATGG - Intergenic
1113120712 13:106921248-106921270 CAGCAAGCAGCCTGGATGGGAGG + Intergenic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1118730701 14:68664284-68664306 TAGGAATCATCCTTGGTGGTTGG - Intronic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120694078 14:87624573-87624595 TAGCAACCAGCCTTGGTGACTGG + Intergenic
1121055329 14:90847104-90847126 TCGGAAGCAGCCTAGCTGGATGG - Intergenic
1121582250 14:95039813-95039835 TGCCAAGCAGCCATGGGGGAGGG - Intergenic
1122548013 14:102535476-102535498 CAGCAAGTAGCCTTGCAGGAAGG - Intergenic
1124994671 15:34711720-34711742 GAGCCAGCAGCCTGGGTGCAAGG - Intergenic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1127007579 15:54587663-54587685 TGGCAATCAGACTTGGAGGAAGG + Intronic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1128786419 15:70400697-70400719 TAGCGATGAGTCTTGGTGGAAGG - Intergenic
1130413014 15:83663026-83663048 TAGCAGGCAGCCTTATTGGATGG + Intronic
1130803118 15:87287622-87287644 TTGCAAGCACATTTGGTGGAAGG + Intergenic
1131046912 15:89322276-89322298 TAGGAAGAGGCATTGGTGGAAGG - Intronic
1131804090 15:96103889-96103911 CATTGAGCAGCCTTGGTGGATGG + Intergenic
1132213608 15:100046167-100046189 TAGAAAGCAGCCTAGGTGAGGGG - Intronic
1132405485 15:101539767-101539789 CAGCAAGCAGCCTTCGTGGAAGG + Intergenic
1132664524 16:1075595-1075617 TAGCAAGGAGGCCAGGTGGAGGG - Intergenic
1133254603 16:4508972-4508994 CAGCAAGCAGCACTGGTGGGCGG - Intronic
1133979441 16:10622435-10622457 TCCCAAGCAGCCTTGCTGGGTGG + Intergenic
1136069984 16:27781986-27782008 GAGCAAGCAGGATTGGTGAACGG - Intergenic
1137586231 16:49665360-49665382 GAGCTCGCAGCCTAGGTGGAGGG + Intronic
1139344577 16:66294225-66294247 TACCAAGGAGCCTTGGGGCAGGG + Intergenic
1140032723 16:71351212-71351234 CAGCACGGAGCCTTGGTGCATGG + Intergenic
1140112250 16:72014110-72014132 TATCAACTAGCCTTGGTGGGAGG - Intronic
1140250099 16:73287957-73287979 CAGCAAGAAGGCTTGGAGGAGGG - Intergenic
1140689827 16:77471123-77471145 TTGCTAGCAGCCTTTGTGCATGG + Intergenic
1140709923 16:77667912-77667934 TAGGAAGCAGTCTTGAAGGAAGG - Intergenic
1142226508 16:88880295-88880317 TGGGAATCAGCCTTGGGGGAGGG - Intronic
1142278320 16:89134499-89134521 CGGCAAGCAGCAGTGGTGGACGG + Intronic
1143497032 17:7318268-7318290 GAGAAAGCAGACATGGTGGACGG - Exonic
1143684063 17:8499829-8499851 GAGCAGGCACCCTTGGTGCAGGG + Intronic
1150211493 17:63444346-63444368 TAGGAAGCAGGCTTGGAGAAGGG - Intronic
1150792136 17:68207318-68207340 TACAAAGCAGCCTTTGTGGGGGG - Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1152884374 17:82840757-82840779 AAGCAAGCAGTTTTGGTGGGGGG - Intronic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1159652974 18:70999556-70999578 TGGGAAGCAGCCTTGGGGAAAGG + Intergenic
1160145640 18:76361898-76361920 TGGGAAGCAGGCTTGGCGGAGGG - Exonic
1161013962 19:1974293-1974315 TGGCAAGAAGGCATGGTGGAAGG + Intronic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
925100736 2:1243306-1243328 GAGCAAGCAGCCCTGGGGAAGGG + Intronic
926264536 2:11303041-11303063 TAGCACTCAGCCTTGGTACATGG - Intronic
928202051 2:29253737-29253759 CAGCAAGCAGCCTGGGTGTGGGG + Intronic
932572215 2:72944066-72944088 GGGCAGGCAGCCTTGGTGGCTGG + Exonic
935502377 2:103857165-103857187 TGACTGGCAGCCTTGGTGGAGGG + Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
936029690 2:109061462-109061484 TTGCAAGCAGCCTGTGTGCATGG + Intergenic
937892931 2:126953566-126953588 TAGCAAACAGCCTTTGAAGATGG + Intergenic
940382885 2:153036225-153036247 AAGAAAGCTGCCATGGTGGATGG + Intergenic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
947247404 2:228064939-228064961 AAGCAAGTAGCCTTGAAGGATGG + Intronic
948083365 2:235226002-235226024 TACCAAATAGCCTTGGTGGCAGG - Intergenic
1170272644 20:14545367-14545389 TAGCTAGCAGCCTTGGTCTCAGG + Intronic
1175536474 20:59718188-59718210 GAGCAAGCAGCCTGGGAGGTGGG - Intronic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1183596655 22:38816751-38816773 TTGCAGGCAGACTTGGTGGTGGG + Intergenic
1184306757 22:43608284-43608306 TAGCAAGCAGCCTTGGTGGATGG - Intronic
949606896 3:5662996-5663018 GAGAAAGCAGCCTTGGGGGTAGG - Intergenic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
949974298 3:9440966-9440988 TGGCAAGAAGCCAAGGTGGAAGG + Intronic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951019435 3:17766543-17766565 TAACAAACAGCCTTGGAAGATGG - Intronic
952808694 3:37381870-37381892 TAGGAAGCATCCCTGGTGGGAGG - Intergenic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
956061743 3:65355370-65355392 AGGCAATGAGCCTTGGTGGAAGG - Intronic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957501313 3:81061179-81061201 TTGCAAATAGCCTTTGTGGAAGG - Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
958990581 3:100839535-100839557 GTGAAAGCAGCCGTGGTGGAGGG + Intronic
959565598 3:107829653-107829675 TAGCATGCAGCCTTGGTGTCAGG + Intergenic
961122615 3:124385626-124385648 CAGCCAGCTTCCTTGGTGGAGGG - Intronic
961823118 3:129585392-129585414 TGGCAGGCAGCCTTGGCGGTGGG - Intronic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963525128 3:146407283-146407305 TAGCAGGCAGCCTATGTCGAGGG + Intronic
963837128 3:150068735-150068757 TAGCTCACAGCCTAGGTGGAGGG - Intergenic
965342138 3:167503710-167503732 TGGCCAGCAGCAGTGGTGGAGGG + Intronic
965368486 3:167829523-167829545 CATCAAGCATCCTTGGGGGAGGG - Intergenic
966629035 3:182051381-182051403 GAGCCAGAAGCCTTGGAGGAGGG - Intergenic
966787003 3:183631062-183631084 AAGCAAGCAGCCTTGGAGACCGG - Intergenic
967462452 3:189762208-189762230 TAACAGGCAGCCTTTGTGGGGGG - Intronic
968236243 3:197031390-197031412 TAGCAGGCAGCCTTGCTAGAGGG + Intergenic
968819331 4:2837780-2837802 CAGCAGGCAGTCTAGGTGGAGGG - Exonic
969015329 4:4100026-4100048 GAGAACCCAGCCTTGGTGGAGGG - Intergenic
969100684 4:4766058-4766080 TTGCAAGCGGTCTTGGTGGAGGG - Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
974514631 4:62893664-62893686 TAGAAAGCAGCCCTGATGGTTGG - Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
976190167 4:82479711-82479733 CAGCAATCAGCAGTGGTGGATGG - Intergenic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
978909017 4:114044497-114044519 TAGCCAGCAGCAGTGGTGGACGG - Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980125232 4:128767876-128767898 GAGTGAGCAGCCCTGGTGGAGGG + Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
987290699 5:16505677-16505699 CAGCAAGCAGCCTGGGCTGAGGG - Intronic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988298718 5:29395120-29395142 TAGCAAGCACCCTAGGAGCATGG + Intergenic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
994965268 5:106661957-106661979 TAGAGAGCTGCCTTGGGGGATGG - Intergenic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
996838516 5:127821129-127821151 TAACAACCAGCTTTGGTGGAAGG + Intergenic
998078910 5:139258587-139258609 CAGGAACCAGCCTTGGTGGAGGG + Intronic
1001439964 5:171735190-171735212 GAGCCAGCAGCCTTGGTGGATGG + Intergenic
1001454749 5:171852181-171852203 TAGCAAGGAGCTGGGGTGGATGG + Intergenic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1011426420 6:87236421-87236443 TAGCAGCTAGCCTTGGTAGATGG + Intronic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1018620714 6:165727050-165727072 GAGGAAGCAGCCTGGGTGCAGGG - Intronic
1019417225 7:933411-933433 TAACAGGCAGCCTTGGTGCATGG - Intronic
1020399514 7:7759654-7759676 TAGGAAGGAGTCTTGGAGGAAGG + Intronic
1021570164 7:22057029-22057051 TAACATGCAGCCTGGCTGGAGGG + Intergenic
1023169592 7:37377751-37377773 TAGCAAACAGCCTTGGAGGAGGG - Intronic
1024109994 7:46134866-46134888 TTGCAAGTAGCCTCAGTGGAGGG - Intergenic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1025082402 7:55995226-55995248 AAGCAAGCAGCCATGGAAGAAGG + Intronic
1025942939 7:66087013-66087035 TTGCCAGGAGCCTTGCTGGAGGG - Intronic
1026453486 7:70550595-70550617 TAGCAAGAAGCCTGGCTAGATGG - Intronic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028841682 7:95435321-95435343 TAGAAAGCAGCTTTTGGGGATGG + Intergenic
1029261163 7:99303831-99303853 AAGCAAACAGCCTTGAGGGAAGG + Intergenic
1029603640 7:101584940-101584962 AATCAAGCAGTCCTGGTGGAAGG + Intergenic
1029699491 7:102236983-102237005 TAGGGAGCAGCCTTTGTGGCCGG - Intronic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031920297 7:127595428-127595450 TAGAAAGCACCCATGGTGGCTGG - Exonic
1032335551 7:131021470-131021492 TTGCATGCAGACTTGGTGAAGGG - Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1035242457 7:157541151-157541173 CAGCCACCCGCCTTGGTGGACGG + Intronic
1037908321 8:22728359-22728381 TAGGAACCAGCCTTGGAAGAGGG - Intronic
1039458995 8:37727625-37727647 TACCCAGCTTCCTTGGTGGATGG - Intergenic
1039749593 8:40464897-40464919 TAGCAAACAGCCTTTGAAGATGG + Intergenic
1041231415 8:55756843-55756865 CAGCAAGCAGCCTGGCAGGAGGG + Intronic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1042256532 8:66809918-66809940 AAGCCAGCTGCCTTGGTGTAAGG - Intronic
1043233922 8:77836846-77836868 TAGCAAGCAACCTTGGAAGATGG + Intergenic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1050593498 9:7183541-7183563 TAGCAAACAGCAATGGTAGACGG - Intergenic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1061805326 9:133134556-133134578 AAGCAAGCAGCCTTGGGGGCCGG - Intronic
1186422784 X:9439618-9439640 AAGCAAGCAGCCATGGGGCAAGG - Intergenic
1187501177 X:19839993-19840015 TAGCAAGCTCCCTTAGTGCACGG - Intronic
1189239930 X:39517140-39517162 TGGCAAGCAGCCCAGGTGGAAGG + Intergenic
1191779428 X:64849770-64849792 TAGCAAGCACCCTAGGAGCATGG + Intergenic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192724005 X:73728695-73728717 CAGCCACCAGGCTTGGTGGATGG + Intergenic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1195948110 X:110237349-110237371 TAGTAAGCAGTCTAGGGGGATGG + Intronic
1196384157 X:115129784-115129806 TAGCATGCAGAATTTGTGGAAGG + Intronic
1197248017 X:124186365-124186387 TAGCAAGCAGCTTTTATGAAAGG - Intronic
1198605383 X:138331690-138331712 CAGCAATCAGCCTTGGTGAATGG + Intergenic
1200162678 X:154017447-154017469 TTGCAAGCAGCGTAGCTGGAGGG - Intronic
1201556985 Y:15273280-15273302 TAGCCAGCAGACTTGGTGTCTGG + Intergenic
1201724349 Y:17136736-17136758 TAGCATTCAGCAGTGGTGGATGG + Intergenic