ID: 1184307563

View in Genome Browser
Species Human (GRCh38)
Location 22:43616769-43616791
Sequence CAGTAAAGGCTGAGGCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 417
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 386}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184307557_1184307563 -1 Left 1184307557 22:43616747-43616769 CCTGCTAGGCCACAGTAAAGCAC 0: 1
1: 0
2: 2
3: 12
4: 133
Right 1184307563 22:43616769-43616791 CAGTAAAGGCTGAGGCTGGAGGG 0: 1
1: 0
2: 1
3: 29
4: 386
1184307556_1184307563 0 Left 1184307556 22:43616746-43616768 CCCTGCTAGGCCACAGTAAAGCA 0: 1
1: 0
2: 1
3: 14
4: 154
Right 1184307563 22:43616769-43616791 CAGTAAAGGCTGAGGCTGGAGGG 0: 1
1: 0
2: 1
3: 29
4: 386
1184307553_1184307563 16 Left 1184307553 22:43616730-43616752 CCCTTTGCTCACAGGTCCCTGCT 0: 1
1: 0
2: 0
3: 24
4: 270
Right 1184307563 22:43616769-43616791 CAGTAAAGGCTGAGGCTGGAGGG 0: 1
1: 0
2: 1
3: 29
4: 386
1184307554_1184307563 15 Left 1184307554 22:43616731-43616753 CCTTTGCTCACAGGTCCCTGCTA 0: 1
1: 0
2: 1
3: 15
4: 215
Right 1184307563 22:43616769-43616791 CAGTAAAGGCTGAGGCTGGAGGG 0: 1
1: 0
2: 1
3: 29
4: 386
1184307559_1184307563 -10 Left 1184307559 22:43616756-43616778 CCACAGTAAAGCACAGTAAAGGC 0: 1
1: 0
2: 1
3: 8
4: 199
Right 1184307563 22:43616769-43616791 CAGTAAAGGCTGAGGCTGGAGGG 0: 1
1: 0
2: 1
3: 29
4: 386

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184307563 Original CRISPR CAGTAAAGGCTGAGGCTGGA GGG Intronic
900241863 1:1621110-1621132 CAGTCAAAGCTGAAGCTGGTGGG + Intronic
900953599 1:5873493-5873515 CAGAGAAGGCTGAGGCTGCCAGG + Intronic
901135080 1:6987835-6987857 CAGCACAGGCTGGGGATGGAGGG - Intronic
901790020 1:11649089-11649111 CAGTGACGGCGGGGGCTGGATGG - Exonic
901922872 1:12548802-12548824 CAGGTGAGGCTGAGGATGGAGGG - Intergenic
902779086 1:18693021-18693043 TGGAAAGGGCTGAGGCTGGAGGG + Intronic
904369734 1:30040757-30040779 CAGTGAAGTTTGAAGCTGGAAGG - Intergenic
904965153 1:34366528-34366550 CAGTAAATGCTCAGGAGGGAAGG - Intergenic
905593995 1:39189773-39189795 CAGTACAGGCTGTGTCAGGAGGG - Intronic
905655113 1:39682053-39682075 CTCCAAAGGCTGGGGCTGGAAGG + Exonic
906001458 1:42429804-42429826 CAGTAATGGATGAGGCTATAGGG + Intergenic
906144547 1:43552138-43552160 CTGGAAAGGATGAGGCGGGAAGG - Intronic
906147269 1:43567485-43567507 CAGGAAAGGCTGGGGCGGCAAGG + Intronic
907208930 1:52801208-52801230 CAGGGAAGGCTGAGGAGGGAGGG + Intronic
907222084 1:52914506-52914528 CAGGATAAGCTGAGGCAGGAGGG + Intronic
907364954 1:53950347-53950369 CAGGAAAGGGTGAGGCTCTAGGG + Intronic
908918182 1:69157575-69157597 CAGTAAAGGCTGTGGCTTCTGGG - Intergenic
910050848 1:82972955-82972977 CAGTAAACGCTGAGCTAGGATGG - Intergenic
911454669 1:98108283-98108305 CAGTAAAGTGGGAGGATGGAAGG + Intergenic
912253815 1:108038770-108038792 CAGTCACGGCTGATGTTGGAAGG + Intergenic
912879020 1:113390660-113390682 CGGGAAAGGCTGAGGCGGGGGGG - Intergenic
914245317 1:145881428-145881450 CAGTAGAGTCTGAGGGTGGGTGG - Intronic
914870335 1:151468345-151468367 CTGGAGAGGCTGAGGCGGGAAGG + Intergenic
915106783 1:153539826-153539848 GAGGAAGGGCTGAGTCTGGAGGG - Intronic
915626940 1:157119688-157119710 TGGTGAAGGATGAGGCTGGAAGG + Intergenic
916069442 1:161161292-161161314 CAGAAAAGGCAGAGGATGGCAGG - Intronic
916270936 1:162940715-162940737 AAGGAAAGGATTAGGCTGGATGG - Intergenic
916854775 1:168738220-168738242 CAGCAAAAGCTAAGGCTGCATGG - Intergenic
918556307 1:185803592-185803614 CAGAAAAGGATGAGGCAGAAAGG + Intronic
918705203 1:187651958-187651980 CAGTAGAAGCTGAGTGTGGAGGG + Intergenic
919094353 1:193011989-193012011 CCCAAAAGACTGAGGCTGGAAGG - Intergenic
919767611 1:201137254-201137276 TAGGGGAGGCTGAGGCTGGAAGG - Intronic
919777163 1:201201824-201201846 CTGTATAAGGTGAGGCTGGAGGG + Exonic
920507488 1:206526690-206526712 CATTAAAGGCAGAAGTTGGAGGG + Intronic
920652072 1:207845296-207845318 CAGTAAAAGTTCAGGCTGGCTGG - Intergenic
921316935 1:213900821-213900843 CAGCCAGGCCTGAGGCTGGAGGG + Intergenic
921380598 1:214520673-214520695 CAGTAAAAGCGGGGACTGGAGGG - Intronic
923314726 1:232768858-232768880 CAGTAGGAGCTGAGGCTGGAAGG - Intergenic
923401112 1:233615664-233615686 CTGTAAAGGTTGAGGGTGGGGGG - Intronic
923941404 1:238831518-238831540 CAGTCATGGCTGAAGGTGGAGGG - Intergenic
1063353104 10:5374201-5374223 AAGTAGAGGCGGAGGCTGGACGG + Exonic
1065830264 10:29608644-29608666 CAGAAAGGGCTGAGGCAGCAGGG - Intronic
1066078540 10:31906169-31906191 TAATGAAGGCTGGGGCTGGAGGG - Intronic
1066320322 10:34296696-34296718 CAGTACATGCTGATGGTGGATGG + Intronic
1067785506 10:49242719-49242741 CCCTAAAGGCTGGGGCTGGAAGG + Intergenic
1069777052 10:70933348-70933370 CAGTTCATGCTGAGCCTGGAGGG - Intergenic
1069797311 10:71061693-71061715 CAGCAAAGGCTGAGAGAGGAGGG - Intergenic
1069915019 10:71782065-71782087 CACTGCAGCCTGAGGCTGGAAGG + Intronic
1071499435 10:86193050-86193072 TAGGAGATGCTGAGGCTGGATGG - Intronic
1072475631 10:95757376-95757398 TAGTAAGGGCTGAGTGTGGATGG + Intronic
1072542171 10:96406563-96406585 AAGTAAACCCTTAGGCTGGAAGG + Intronic
1073693017 10:105832662-105832684 CAATAAAGGTGTAGGCTGGACGG + Intergenic
1074883650 10:117678005-117678027 CAGTCAAGGGTGAGGGTGGAAGG + Intergenic
1075423405 10:122323310-122323332 CCGTAATGCCTAAGGCTGGAGGG - Intronic
1075544539 10:123345014-123345036 CAGTAAAAGCAGTGGCTGGGAGG - Intergenic
1075554648 10:123421621-123421643 CAGGAGTGGCTGAGGCTGGGGGG - Intergenic
1076365556 10:129919322-129919344 CAGTGGAGGCGGAGGCTGGGAGG + Intronic
1076497478 10:130906326-130906348 CAGCAAAGGCAGAGTCTGGACGG - Intergenic
1076735673 10:132457894-132457916 AGGTAAAGGCTGAGGTTGGCTGG - Intergenic
1077742352 11:4860302-4860324 CAGTAGATGCTGAGCATGGAGGG + Exonic
1078367233 11:10716856-10716878 CAGTGAAGCATGAGGCTGTATGG - Intergenic
1078439330 11:11351149-11351171 CACTAGAGGCTGAGGATGCAGGG + Intronic
1079138018 11:17787278-17787300 CTGTACAGGCTAAGGCTTGAGGG + Intergenic
1079322544 11:19463663-19463685 CAGAAAAAGCTGAGTCTGGAAGG + Intronic
1079917383 11:26386396-26386418 CAATGGAGGCTAAGGCTGGAGGG + Intronic
1079959566 11:26906446-26906468 CTCGAGAGGCTGAGGCTGGAGGG - Intergenic
1080010052 11:27449472-27449494 CTCAAAAGGCTGAGGCAGGAGGG + Intronic
1080664622 11:34324853-34324875 CAGTAGAGGCTGAGCCTGCCGGG - Intronic
1081562416 11:44230032-44230054 AAGAAAAGGATGAGGTTGGAGGG + Intronic
1082632207 11:55556408-55556430 AGGAAAAGGCTGTGGCTGGAGGG - Intergenic
1082804872 11:57441516-57441538 CTGGGAAGGCTGAGGCAGGAGGG + Intergenic
1082837590 11:57663003-57663025 CTGTACAAGATGAGGCTGGAGGG + Intergenic
1083106261 11:60361198-60361220 CAGATAAATCTGAGGCTGGATGG - Intronic
1083585107 11:63851336-63851358 TAGTGGAGGCTGAGGCAGGAGGG + Intronic
1084433720 11:69126032-69126054 CAGCAGAGGCACAGGCTGGAGGG - Intergenic
1084471369 11:69361172-69361194 AAGTAAAGGATGCGGCTGGGTGG - Intronic
1084648483 11:70474396-70474418 CAGTAAAGGTTGGAGCTAGAAGG - Intronic
1084888677 11:72225696-72225718 AAGCAGAGGCTGAGGCTGTATGG + Intronic
1085483412 11:76841621-76841643 CAGGGAAGGATGAGGCTGGAAGG - Intergenic
1086370577 11:86151884-86151906 CAGCCCAGGCTGGGGCTGGAGGG - Intergenic
1086402577 11:86472837-86472859 CAGGAAGGGCCGAGGATGGAGGG + Intronic
1086440024 11:86819584-86819606 CAGTAATGACTGTGGCTGGTGGG + Intronic
1088742899 11:112781266-112781288 CAGTATAGGCTGAGGCAGCCTGG + Intergenic
1088885614 11:114004044-114004066 TGGCAAAGGCAGAGGCTGGAGGG + Intergenic
1089116729 11:116101225-116101247 CAGCAAAGGCTCAGGCAGGTAGG + Intergenic
1089270773 11:117300121-117300143 GGGGAAAGGCTGGGGCTGGAAGG - Intronic
1090405798 11:126475270-126475292 CCATGCAGGCTGAGGCTGGAAGG - Intronic
1090441635 11:126729559-126729581 CTGTAAACAATGAGGCTGGAAGG + Intronic
1091666143 12:2419848-2419870 CAGCCAGTGCTGAGGCTGGATGG + Intronic
1091883281 12:3997236-3997258 CACTAAAACCTCAGGCTGGATGG + Intergenic
1092732373 12:11547014-11547036 CAGCACAGGCGGAGCCTGGAGGG + Intergenic
1093047171 12:14460711-14460733 CTGTAGAAGCTGAGGCTGGGAGG - Exonic
1093241614 12:16683808-16683830 GGGTCAAAGCTGAGGCTGGAAGG - Intergenic
1093598727 12:20995245-20995267 CTGAAAAGGGTGAGGTTGGAAGG - Intergenic
1093955849 12:25217784-25217806 CTCAAAAGGCTGAGGCAGGAGGG + Intronic
1094134779 12:27113239-27113261 AAATCCAGGCTGAGGCTGGAGGG + Intergenic
1096518074 12:52169100-52169122 CAGTAAAGGCGGAAGGTGAAGGG + Exonic
1099622509 12:85022321-85022343 CAGTAAAGAATGAAGTTGGAGGG + Intronic
1101164083 12:102010207-102010229 CAGGAAAGTCTGAGGCGGCAGGG - Intronic
1101928355 12:108991836-108991858 CTCAAAAGGCTGAGGCAGGAGGG + Intronic
1102572012 12:113832545-113832567 CAGGAAAGGCCGAGACTGGGTGG - Intronic
1102671089 12:114619550-114619572 AATTAAAGGCTGAGACTTGATGG - Intergenic
1103092544 12:118107591-118107613 CTTGAAAGGCTGAGGCAGGAGGG + Intronic
1104723297 12:131058692-131058714 CAGAAACTGCTGAGGATGGAAGG - Intronic
1105401262 13:20098051-20098073 CAGGCAAGACTGAGGCTGGCGGG + Intergenic
1108179814 13:47829451-47829473 CAGTCAGGTCTGGGGCTGGAGGG - Intergenic
1111900289 13:94191696-94191718 CAGGAAAGGCTGGGGCTGGGAGG - Intronic
1112307490 13:98288214-98288236 CAATAAAGACTGAGGAGGGATGG + Intronic
1112558197 13:100488528-100488550 CCTTGGAGGCTGAGGCTGGAGGG + Intronic
1113591919 13:111507359-111507381 GGGTGGAGGCTGAGGCTGGAGGG - Intergenic
1114423008 14:22600311-22600333 CTTGAAAAGCTGAGGCTGGAAGG + Intronic
1116065147 14:39972726-39972748 CTGGAAAGTCTGAGGCTTGAGGG + Intergenic
1118296054 14:64570770-64570792 CAGAAAAGGGTGAAGATGGATGG + Intronic
1118474863 14:66107053-66107075 AAGTAATGGCTGAGTCAGGATGG - Intergenic
1118660523 14:68004751-68004773 CAGAAAAGGCAGTGGCTGAAAGG - Intronic
1119499698 14:75114140-75114162 CACCAAACACTGAGGCTGGAAGG + Intronic
1119633970 14:76258749-76258771 CAGGTAAGGCTCAGGCTTGAGGG + Intergenic
1119768205 14:77204002-77204024 CAGTCAGGGGAGAGGCTGGAGGG + Intronic
1119969135 14:78949697-78949719 CAGGGAAGGCTGAGGAGGGATGG + Intronic
1120376458 14:83713942-83713964 CAGTGAAGGCAGAGGATGGTGGG - Intergenic
1120544427 14:85792852-85792874 AGGTAAAGACTGAGGCTGCAGGG + Intergenic
1121150348 14:91627723-91627745 GAGGAAAGCCTGAGGCAGGAGGG + Intronic
1121414526 14:93770054-93770076 CAGTGATGGCTGTGGCTGTAGGG - Intronic
1121682316 14:95803934-95803956 CAGCACATGCTGAGGCTTGAAGG - Intergenic
1122302537 14:100739155-100739177 CTGTGAGGGCTGAGGGTGGAAGG - Intergenic
1123703887 15:22936989-22937011 CAGGAAACGCTGGGGCTGGGTGG - Intronic
1126015199 15:44344015-44344037 CTGGATAGGCTGAGGCGGGAGGG + Intronic
1127297779 15:57624924-57624946 CAGTTAGGACTGAGGGTGGAAGG - Intronic
1127585054 15:60370551-60370573 CAGTACAGGTTGAGGTTGCAAGG + Intronic
1127585702 15:60376050-60376072 CTGTAAAGGCTGAAGCAGGGAGG + Intronic
1128058236 15:64716870-64716892 GAGCACAGGATGAGGCTGGAGGG - Intergenic
1131176046 15:90210459-90210481 GAGCAAAGCCTGAGGCAGGAGGG + Intronic
1131455251 15:92578605-92578627 CAGAGGAGGCTGGGGCTGGAGGG - Intergenic
1132461530 16:57716-57738 CCCTAAAGGCTGAGGCTGGAGGG - Intergenic
1132906494 16:2285255-2285277 GGGTAAAGGCTGAGGGTGCAGGG + Intronic
1133393658 16:5429169-5429191 ATGTAAAGGCTCTGGCTGGAAGG - Intergenic
1133548081 16:6827606-6827628 CAGTGAAGGATGGGGCTGGCAGG - Intronic
1134469004 16:14505403-14505425 AGTTAAAGGCTGAAGCTGGAGGG + Intronic
1134487854 16:14672808-14672830 CAGTAAAGCAAGAGGCAGGACGG + Intronic
1134823671 16:17267099-17267121 CAGCACAGGGTGAGGCAGGAAGG + Intronic
1136016309 16:27403275-27403297 CAGTGGAGGCTGAGCCTTGAAGG + Intronic
1136466192 16:30445538-30445560 CATGAAGGGCTGAGGCTGCAAGG - Exonic
1136608980 16:31354965-31354987 CAGTCAAGGGTGAGCCTGGGAGG + Intergenic
1136719954 16:32311781-32311803 CAGTAAAGTATCAGGCTGTAAGG - Intergenic
1136838328 16:33518060-33518082 CAGTAAAGTATCAGGCTGTAAGG - Intergenic
1138090457 16:54169607-54169629 AAGAAAAGGCTGGGGCAGGAGGG - Intergenic
1139015096 16:62680010-62680032 AAGAAAAGGCTGAGGGTGGATGG + Intergenic
1139170460 16:64625273-64625295 CAGTCAAGCCTGAAACTGGAAGG + Intergenic
1139527175 16:67524291-67524313 GAGTCCAGGCTGGGGCTGGAGGG + Intronic
1139712985 16:68790626-68790648 CTGCAGAGGCGGAGGCTGGAGGG - Intronic
1140065928 16:71611168-71611190 CAGCACAGGCTCAGGCTGGGAGG - Intergenic
1140514492 16:75532253-75532275 CACTAAAGGCTCAGGGTGGTTGG - Intronic
1140789548 16:78378028-78378050 GAGTGAAGGTTGATGCTGGATGG + Intronic
1140894011 16:79309173-79309195 CAGGAAAAACTGAGGCTGAAGGG + Intergenic
1141799457 16:86296993-86297015 CAAGAAAGGCTGGGGCTTGAAGG - Intergenic
1141814939 16:86403436-86403458 TATTAATGGCTGAGGCTGGGTGG + Intergenic
1141965806 16:87442181-87442203 CAGCAGAGTCTGAGGCTGGACGG + Intronic
1142270956 16:89088966-89088988 CGGGAAAGGCTGGGGGTGGACGG + Intronic
1203006477 16_KI270728v1_random:205988-206010 CAGTAAAGTATCAGGCTGTAAGG + Intergenic
1203148497 16_KI270728v1_random:1818345-1818367 CAGTAAAGTATCAGGCTGTAAGG - Intergenic
1145756030 17:27390601-27390623 CAGGAAAGGCCAAGGCAGGATGG - Intergenic
1146083904 17:29809476-29809498 CAGTAAAGTCTGAGACAAGACGG - Intronic
1148068190 17:44889056-44889078 CAGCAAAGGCTGAGAAGGGATGG + Intronic
1148810285 17:50285967-50285989 CTGTAGAGGCAGAGTCTGGAGGG - Intergenic
1149292464 17:55230477-55230499 CAGGAAAACCTGTGGCTGGAGGG - Intergenic
1149446280 17:56715698-56715720 CAGGTAAGGTAGAGGCTGGAAGG + Intergenic
1149544988 17:57496711-57496733 CAGTCAAGTCTGAGGGTGAAGGG + Intronic
1151085178 17:71372201-71372223 CATTAAAGGCACAGGCTAGAGGG + Intergenic
1151186981 17:72371814-72371836 CAGGAATGGCTGTGGGTGGAAGG - Intergenic
1152071062 17:78133785-78133807 GAGCCAAGGCTGAGGCTGGATGG + Intronic
1152635263 17:81428261-81428283 CACAAAAGGCTGAGGCGGGGTGG - Intronic
1153795430 18:8617694-8617716 AACAAAAGGCAGAGGCTGGAAGG - Intronic
1154251554 18:12749241-12749263 GAGCAAGGGCTGGGGCTGGAAGG - Intergenic
1155154222 18:23144614-23144636 CTGAGAAGACTGAGGCTGGATGG + Intronic
1155484160 18:26323464-26323486 CTGGAAAGGCTGAGGTGGGAGGG - Intronic
1156520681 18:37720118-37720140 CAGTAAATGCTGAGGGTGCCTGG - Intergenic
1157746277 18:50138840-50138862 CAGCCCAGGCTGAGGCAGGATGG - Intronic
1158608489 18:58917409-58917431 CAGTAGAGTCTCAGGATGGAAGG + Intronic
1158626788 18:59078510-59078532 CAGGACAGGCTGAAACTGGAGGG + Intergenic
1159978266 18:74742976-74742998 CAGCAAAGGCGGTGGATGGATGG + Intronic
1160878818 19:1310449-1310471 CAGCGAAGGCTGGGGGTGGAAGG + Intergenic
1160956494 19:1694895-1694917 CTCTGAAGGCTGATGCTGGAGGG + Intergenic
1161253843 19:3295488-3295510 CAGGAAGGGCTGAGGTTGGCGGG + Intronic
1161720999 19:5902664-5902686 CATGAAACGCTCAGGCTGGAAGG + Intronic
1161740917 19:6020713-6020735 CAGGAAAGGCAGCAGCTGGACGG + Intronic
1162500225 19:11049179-11049201 CAGTGCATGCAGAGGCTGGAGGG + Intronic
1162811844 19:13168867-13168889 CTCTAGAGGCTGAGGCGGGAGGG + Intergenic
1162972796 19:14191195-14191217 GGGGACAGGCTGAGGCTGGAGGG - Intronic
1163315832 19:16539927-16539949 CTCAAGAGGCTGAGGCTGGAGGG - Intronic
1163687045 19:18717637-18717659 CACTGTAGGCTGAGACTGGAAGG - Intronic
1163758951 19:19122665-19122687 CTGTGAAGGCTGAGGTGGGAAGG + Intronic
1164437914 19:28248059-28248081 CTGGAAAGGCTGAGGTGGGAGGG + Intergenic
1164521342 19:28982460-28982482 CACTAAAGGCTGAGGATACATGG + Intergenic
1165392841 19:35548263-35548285 CAAGGAAGGCTGAGGGTGGAGGG - Intergenic
1165827602 19:38714161-38714183 CAGAGGAGGGTGAGGCTGGACGG - Intronic
1166894103 19:46012957-46012979 CTGGGAAGGCTGAGGCAGGAAGG - Intronic
925071750 2:974533-974555 CAGCAAAGACTGAGGCAGGGAGG - Intronic
927850819 2:26498234-26498256 CAGTAGAGGCGGAGGGTGGAGGG + Intronic
928346051 2:30497137-30497159 CAGAAAATGCTGAGTCTAGAGGG - Intronic
928835970 2:35545439-35545461 CAAGAAAGTCTGAGGCAGGAGGG + Intergenic
929483916 2:42338285-42338307 AAGGAAAGGCAGAGGCTGGATGG - Intronic
929870856 2:45758071-45758093 CAGAGAAGGCTGAGGGTGCAAGG + Intronic
930233373 2:48865307-48865329 CAGTCAAAGGAGAGGCTGGAGGG + Intergenic
932123397 2:69121792-69121814 CAATCAAAGCTGAGGCTTGAAGG + Intronic
932129555 2:69175514-69175536 CTGGGGAGGCTGAGGCTGGAGGG + Intronic
934053530 2:88231711-88231733 CAGTGGAGGCAGAGGCTGGTGGG + Intergenic
934182942 2:89643871-89643893 CACTGAAGGCTGAGGCTGAGAGG + Intergenic
935659718 2:105455805-105455827 CAGGAGAGGCAAAGGCTGGAGGG - Intergenic
936082809 2:109446508-109446530 CAGGGGAGGCTGAGGCTGCAGGG + Intronic
936155046 2:110041871-110041893 CAGTAAAGACAGAGGGTTGACGG - Intergenic
936189636 2:110329543-110329565 CAGTAAAGACAGAGGGTTGACGG + Intergenic
936255094 2:110904440-110904462 CAGGAAAGACAGAGGCAGGAGGG - Intronic
936502109 2:113074639-113074661 AGGTAAAGGCTCAGGCAGGAAGG - Intronic
937937583 2:127258543-127258565 GAGGAAAGCCTTAGGCTGGAGGG + Intronic
938033524 2:128016412-128016434 CAGGAATGGCTGAAGCTTGAGGG + Exonic
938069995 2:128303253-128303275 CAGTAAAGGCAGGGCCAGGAGGG + Intronic
939047050 2:137262028-137262050 CTGTAAAAGCTGAGGATGCAAGG + Intronic
939308351 2:140438122-140438144 CTCTGGAGGCTGAGGCTGGAGGG - Intronic
940042826 2:149378190-149378212 CAGGGAAGGTTGAGGCTGCAAGG - Intronic
942085391 2:172438670-172438692 CAGTAAAGGCTGATGTTGATTGG - Intronic
942133355 2:172902176-172902198 GAGTGGGGGCTGAGGCTGGAGGG + Intronic
942254020 2:174074172-174074194 CAGTAGAGGCAAAGGCTGGCTGG + Exonic
943698828 2:190967002-190967024 CATTAAAGGCAGAGACTGGGGGG + Intronic
944692222 2:202168687-202168709 CACTGAATGCAGAGGCTGGAAGG - Intronic
944707327 2:202304178-202304200 CAGTAAAAGCTGTTGGTGGATGG + Intergenic
946050833 2:216860968-216860990 TGGTACAGGATGAGGCTGGAGGG + Intergenic
946430224 2:219622334-219622356 CAGTAAAGACGGGAGCTGGAAGG + Intergenic
946475778 2:220005209-220005231 CAGGAAAGGCTGAGGCTGAGTGG + Intergenic
946558722 2:220888993-220889015 CAGAAAAGACTGAGGGTGAATGG - Intergenic
946669790 2:222090323-222090345 TAGTAATGGCTGGGGCTGGAGGG - Intergenic
946822752 2:223647263-223647285 CAGGAAAGACAGAGGCTGCAGGG - Intergenic
947747395 2:232515800-232515822 CAAGAGAGGCGGAGGCTGGAGGG - Intergenic
948122791 2:235543549-235543571 CAGCAAGGGCTGTGGCTGGCCGG + Intronic
948433291 2:237934438-237934460 CAGGGAGGGCTGGGGCTGGATGG - Intergenic
1168845303 20:940390-940412 CAGCAAAGGCAGAGGGTGGGAGG + Intergenic
1168911270 20:1449072-1449094 AGGTAAAGGCAGAGACTGGAGGG + Intronic
1169158731 20:3357622-3357644 CAGTAAAAGATAAAGCTGGATGG - Intronic
1169393066 20:5205882-5205904 CAGCAAAGGCAGAGGCAGGGCGG + Intergenic
1170031481 20:11948678-11948700 CAGTAAAGGCATAGGCTGCGTGG - Intergenic
1172270824 20:33654872-33654894 CAGACAAGGCAGAGGCTTGAGGG + Intergenic
1172977439 20:38917654-38917676 CTGAAAAGTCTGAGCCTGGAAGG + Intronic
1173224288 20:41152891-41152913 GTGCAAAGGCTGAGGCAGGAAGG + Intronic
1173421741 20:42907394-42907416 CAGTCAACGTTGAGGTTGGAGGG - Intronic
1173790996 20:45827613-45827635 TAGTAAAGGGTGAGGCAGCATGG + Intronic
1174000020 20:47367760-47367782 CTCTAGAGGCTGAGGCAGGAAGG + Intergenic
1174015674 20:47486192-47486214 CTCAAGAGGCTGAGGCTGGAGGG + Intergenic
1174181831 20:48679870-48679892 CAGTGAAGCCTGATGCTGGTGGG - Intronic
1174755897 20:53158294-53158316 GAGTAATGGATGAGGCTAGAAGG + Intronic
1175309736 20:58003491-58003513 CACCCCAGGCTGAGGCTGGAGGG + Intergenic
1175451461 20:59072344-59072366 CAATGGAGGCAGAGGCTGGAGGG + Intergenic
1175857124 20:62127598-62127620 AAGCAGCGGCTGAGGCTGGAGGG - Intronic
1177232531 21:18341167-18341189 CCGGAGAGGCTGAGGCAGGAGGG - Intronic
1177844993 21:26279005-26279027 CAGTGAGGGCAGATGCTGGAGGG - Intergenic
1180869044 22:19135920-19135942 CACAGGAGGCTGAGGCTGGAAGG + Intronic
1181050259 22:20235000-20235022 GAGACAAGGCTGAGGCTGGCAGG - Intergenic
1181111514 22:20605549-20605571 CAGTTAAGGCTGAGACCGGCTGG - Intergenic
1181408709 22:22703214-22703236 AAGGAAAGGCAGAGGCAGGAGGG - Intergenic
1182070922 22:27463058-27463080 CAGCAGAGGCTGAGGCAGGGAGG + Intergenic
1183245965 22:36693644-36693666 CAGAAAGGGGTGAGGCTGGAAGG - Intronic
1183698671 22:39437666-39437688 AAGTAGGGGCTGAGGCTGGCAGG + Intergenic
1184248870 22:43249152-43249174 CAGGAAAGGCTGAGCATGCAGGG + Intronic
1184307563 22:43616769-43616791 CAGTAAAGGCTGAGGCTGGAGGG + Intronic
1184342825 22:43895487-43895509 CTTGAAAGGCTGAGGCGGGAGGG + Intergenic
1184556572 22:45236438-45236460 CAAGCAGGGCTGAGGCTGGATGG - Intronic
1184634147 22:45812928-45812950 CAGTAGGGGATGGGGCTGGAAGG + Intronic
1185096733 22:48811017-48811039 CTCTAGAGGCTGAGGCAGGAGGG + Intronic
950028536 3:9836717-9836739 AAGATAAGGCTGAGGCAGGAGGG + Intronic
950165977 3:10799199-10799221 TAGTGAAGGCTGGGGCTGAAAGG + Intergenic
950404167 3:12794300-12794322 AAGAAAAGGCTGTGGCTGGCTGG - Intergenic
950678646 3:14569715-14569737 GCGCAGAGGCTGAGGCTGGAAGG - Intergenic
951217255 3:20037168-20037190 CAGTAAAGGCACAGACTGTAAGG - Intergenic
952312024 3:32199019-32199041 CAGCCAGGGCTGAGGCTGGAGGG - Intergenic
953078843 3:39596726-39596748 CACTCAAGGCTGAGGCGAGAAGG + Intergenic
953582896 3:44173180-44173202 CAGTGAATGGTGAAGCTGGATGG - Intergenic
953628818 3:44593737-44593759 GAGTAGAGGATGAGGCAGGAAGG + Intronic
956568622 3:70668807-70668829 TAGTGAACGCTGAGGTTGGAAGG + Intergenic
960727917 3:120689687-120689709 CATTAAAGGGTAAGGCTGAAGGG + Exonic
962380125 3:134891828-134891850 CTGTAAATGCTGAAGCTGTAAGG - Intronic
962485793 3:135841055-135841077 CAGTATGGGGTGAGGGTGGAGGG - Intergenic
968166478 3:196470076-196470098 CAGATGAGGATGAGGCTGGATGG - Exonic
968166491 3:196470151-196470173 CAGATGAGGATGAGGCTGGATGG - Exonic
968166539 3:196470445-196470467 CAGATGAGGATGAGGCTGGATGG - Exonic
968189843 3:196659870-196659892 CAGGAGAGGGTAAGGCTGGAGGG - Exonic
968235157 3:197027072-197027094 CAGTAGAGGCGCAGGGTGGAGGG - Intronic
968330501 3:197865108-197865130 CTGTAGAGGCTGAGGAGGGAGGG - Intronic
968434698 4:578444-578466 CCCTAAAGGGTGAGGGTGGAAGG + Intergenic
968834485 4:2953426-2953448 GAGAAAGGGCTGGGGCTGGACGG - Intronic
969152294 4:5179919-5179941 CAGCAGAGGCTGAGGCTTGTGGG + Intronic
969681622 4:8646345-8646367 CAGCTGAGGCCGAGGCTGGAGGG + Intergenic
969851854 4:9963715-9963737 CAGCAAAGGCAGAGGCTGGGAGG + Intronic
970191500 4:13523177-13523199 CAGCAAAGCCTAAGGCTGTAGGG - Intergenic
970213157 4:13731713-13731735 AAGCAGAGGATGAGGCTGGAAGG + Intergenic
973570241 4:52231405-52231427 CAGTGAAGGTGGAGGATGGATGG + Intergenic
974959192 4:68676996-68677018 ATGAAAAGGCAGAGGCTGGAGGG - Intergenic
976113982 4:81706987-81707009 CAGTTAAGACATAGGCTGGAGGG - Intronic
977773520 4:100889302-100889324 CTGAAAATCCTGAGGCTGGAAGG + Intergenic
978614420 4:110579801-110579823 CAGTGAGGACTGAGGCTGAAGGG - Intergenic
981515589 4:145605500-145605522 GGGTAAAGGCTGAGGCAGGCAGG - Intergenic
982351627 4:154421760-154421782 GAGAAAAGGCTGTGGCTAGAAGG - Intronic
983999772 4:174225805-174225827 CAGTAAAGGCTGAGCCCGGGAGG - Intergenic
984833763 4:184000159-184000181 CAGTAGAAGCAGAGGCTGGGAGG - Intronic
984970818 4:185188261-185188283 CTTTGAAGGCTGAGGCTAGAGGG - Intronic
985104360 4:186486389-186486411 CAGAATTGGCTTAGGCTGGATGG + Intronic
985589130 5:755736-755758 CAGGCAGGGCTGAGACTGGAGGG - Intronic
985603809 5:848252-848274 CAGGCAGGGCTGAGACTGGAGGG - Intronic
985800636 5:2003538-2003560 CAGTGTAGGGTGAGGCTGGGAGG + Intergenic
985965168 5:3333932-3333954 CAGTCAAGGCAGAGGCAGGGTGG + Intergenic
986146089 5:5079190-5079212 CAGGACAGGCTGGGGTTGGATGG - Intergenic
986307271 5:6525043-6525065 CAGACAAGGCTGAGCCAGGAGGG - Intergenic
986831199 5:11580628-11580650 CTGGAAAGGCTGACGCTTGAAGG - Intronic
986848857 5:11786536-11786558 CAGGAAAGGCTGAAGCAAGATGG + Intronic
988217691 5:28296637-28296659 CAGAAATGGCAGAGGCTTGAAGG - Intergenic
989131728 5:38113706-38113728 TAGTAAAGGATTAGGCTGGAAGG + Intergenic
991109177 5:62879357-62879379 CAATAAAGAGTGAGGCTAGAGGG + Intergenic
991292345 5:65045020-65045042 GAGTAAAGGGTGATGGTGGATGG - Intergenic
991359357 5:65803378-65803400 CAGTAGGGGCTGAGGCAGCAAGG + Intronic
991491550 5:67188480-67188502 AAGGAAAGGCAGGGGCTGGAAGG - Intronic
992433036 5:76728352-76728374 TAGTAGAGGCTGGGGTTGGATGG - Intronic
992996671 5:82340629-82340651 CAGTGAAGGCTGCCTCTGGAGGG + Intronic
994300807 5:98144946-98144968 AAGTAAAGGGAGAGGCAGGAAGG + Intergenic
994402648 5:99300875-99300897 CTTCAAAGGCTGAGGCTGGGAGG - Intergenic
996489105 5:124071554-124071576 CAGGAAAGGGCTAGGCTGGAAGG - Intergenic
997255761 5:132426857-132426879 CAGTAAATGCTGTGGCATGAAGG - Intronic
997263492 5:132481225-132481247 CAGGAATGTCTGAGGGTGGAAGG - Intergenic
998079512 5:139262865-139262887 CAGCCAAGGCTGAGTCTGGTGGG + Intronic
998742561 5:145221428-145221450 CTGTGAAGGATGAGGTTGGAAGG + Intergenic
999417719 5:151414394-151414416 AAGTAAAAGATCAGGCTGGAGGG + Intergenic
999536443 5:152522754-152522776 TGGTAAAGTCTGGGGCTGGAAGG - Intergenic
1000313255 5:160064708-160064730 AAGCACAGGCTGAGGGTGGATGG + Intronic
1000793545 5:165636020-165636042 TAGTTAAGGCTGAGGCAGGGAGG + Intergenic
1001334982 5:170789586-170789608 CTGAAAGGGCTCAGGCTGGAGGG - Intronic
1001920787 5:175597762-175597784 TTGTAATGGCTGAGGCAGGAAGG - Intergenic
1002162000 5:177319899-177319921 CAGTAAAGGAGGTGGTTGGAAGG - Intergenic
1003482407 6:6545994-6546016 CAGGAAAGGCTGAGGGAGGAAGG - Intergenic
1003497347 6:6675901-6675923 CTGGAAAGGCTGAGGGAGGAGGG + Intergenic
1005257779 6:24022625-24022647 CAGTTAAGGCTGATGCTGTATGG - Intergenic
1006459676 6:34151073-34151095 CAGGGATGGCTGAGGCTGGGAGG + Intronic
1006878427 6:37318297-37318319 CAGAAAGGGGTGAGTCTGGATGG + Intronic
1007088284 6:39166156-39166178 CAGAGAGGGGTGAGGCTGGAAGG - Intergenic
1007384840 6:41513502-41513524 TAGGGCAGGCTGAGGCTGGAGGG - Intergenic
1007559221 6:42792371-42792393 CAGTAGAGGCTGAGGTGAGAGGG - Intronic
1007987153 6:46218267-46218289 CAGTTTAGGATGAGGTTGGAAGG - Intergenic
1008096285 6:47342861-47342883 CAGTAAAAGCCGAGACTGAAAGG + Intergenic
1008649670 6:53549500-53549522 CAGAAAATGTTTAGGCTGGAAGG - Intronic
1008770288 6:54970458-54970480 CAGTCAAGGCTGAGCCTAGTAGG - Intergenic
1009815987 6:68736118-68736140 CAGGAGAGGCTGAAGCAGGAGGG - Intronic
1012135774 6:95554090-95554112 CAGAATAGGGTGAGGGTGGAGGG - Intergenic
1012221660 6:96657133-96657155 GAGAAAATGCTGAGGGTGGATGG + Intergenic
1013510014 6:110835935-110835957 CCAGAAAGGCTGAGGCTGCAGGG + Intronic
1013616006 6:111843872-111843894 CCCTAAAGGCCCAGGCTGGATGG - Intronic
1014143852 6:117973667-117973689 CTGGGAAGGCTGAGGCAGGAGGG - Intronic
1016453098 6:144203683-144203705 CAGTAAAGGCTGGGGTTAAAGGG + Intergenic
1017047467 6:150360565-150360587 CAATAAAAGCTGTGGCAGGAAGG - Intergenic
1019337018 7:490222-490244 CTCAGAAGGCTGAGGCTGGAAGG + Intergenic
1020008079 7:4792696-4792718 CAGGAAAGGCTGGCGCTGGCAGG + Intronic
1020470317 7:8527263-8527285 AAGCAAAAGCTGAGGCTGCATGG - Intronic
1021510866 7:21430469-21430491 CTGTAAAGGCTGCTGCTGGATGG - Exonic
1021629830 7:22633766-22633788 CAGCCAAGGCAGAGGCTGGGAGG + Intergenic
1022112099 7:27238183-27238205 CAGTAAAGGCTGAGGCTTTGTGG + Intergenic
1022129753 7:27394310-27394332 CATTGAAGGATGAGGCTGAATGG + Intergenic
1023225062 7:37960557-37960579 AAGCAAAGGCTGAGGCTGCAAGG + Intronic
1024056555 7:45663226-45663248 CATCAAACGCTGAGGCTGGCAGG - Intronic
1028595400 7:92543131-92543153 CTCAAAAGGCTGAGGCAGGAGGG + Intergenic
1029187956 7:98753041-98753063 CAGAACAGTCTGTGGCTGGAAGG + Intergenic
1029303921 7:99604883-99604905 CTCAAAAGGCTGAGGTTGGAGGG + Intronic
1029466863 7:100730974-100730996 CAAAGAAGGCTGAGGCGGGAGGG - Intergenic
1030663557 7:112249227-112249249 CAGGATGGGCTGAGGCAGGAGGG + Intronic
1032229198 7:130059730-130059752 CAGGAAACCCTGAGGCTGGATGG - Intergenic
1033076334 7:138253605-138253627 CAGTCAAGGGTTTGGCTGGATGG + Intergenic
1033958682 7:146884638-146884660 CACTACAGGATGGGGCTGGAGGG + Intronic
1036414215 8:8531708-8531730 AAAAACAGGCTGAGGCTGGAAGG + Intergenic
1037645023 8:20785236-20785258 TAGGAAGGGGTGAGGCTGGAGGG + Intergenic
1037806807 8:22062508-22062530 CAGGAAAGACTGAGGCTGCAGGG - Intronic
1037877855 8:22557172-22557194 CTGTAAGGCCTGAGGCTGCAGGG + Intronic
1038341506 8:26689882-26689904 AAGTAATGGCTGAGGTGGGAGGG - Intergenic
1038763946 8:30410280-30410302 CAGGAGAGGCTGAGGTTGCAGGG - Intronic
1038875294 8:31542093-31542115 GAGGAAAGTCTGAGACTGGATGG + Intergenic
1039591714 8:38755594-38755616 CTGAAAAGGCTGAGGCAAGAGGG + Intronic
1040055205 8:43051721-43051743 CAGTAATGGCAGAAGCTGAAGGG - Intronic
1040915274 8:52562557-52562579 CAGGAAACCCTGAGGCAGGAGGG - Intronic
1041148252 8:54902910-54902932 ATGTAAAGCCAGAGGCTGGATGG + Intergenic
1041469204 8:58190287-58190309 CAGAACAGGCTGTGGCTGAAGGG + Intronic
1041547541 8:59062377-59062399 CAGTAAGGGCTGGTGCAGGATGG + Intronic
1044302115 8:90596740-90596762 CACTGCAGGCTGAGGATGGAAGG + Intergenic
1044841024 8:96337147-96337169 CAGTAATGGCTGAGACTGGTGGG + Intergenic
1045014525 8:97988516-97988538 CTCGAAAGGCTGAGGCAGGAGGG + Intronic
1046096157 8:109563738-109563760 CCGGAAAGGCTGAGGTTAGACGG - Intronic
1047713941 8:127578273-127578295 AAGTAAAGGCTGGAGCTGGCTGG + Intergenic
1049023157 8:139971265-139971287 TAGTCCAGGGTGAGGCTGGAGGG - Intronic
1049744689 8:144258305-144258327 CAGTGTCGGCTGAGGCTGGCTGG - Intronic
1050306334 9:4309209-4309231 CAGCAATGGCTTTGGCTGGAGGG - Intronic
1050585277 9:7104341-7104363 CAGTAAAGGAAGAGGTAGGATGG + Intergenic
1050602178 9:7264148-7264170 AAATAAAGACTGAGGCTGGCTGG - Intergenic
1050666216 9:7939359-7939381 CAGTAAATGCTGCAACTGGATGG - Intergenic
1052086490 9:24272946-24272968 CAGTCAATACTGAGGCTGCAGGG - Intergenic
1052399921 9:27987380-27987402 CTCAAAAGGCTGAGCCTGGAGGG - Intronic
1053314686 9:37041351-37041373 CTGGAAAGGGGGAGGCTGGAGGG + Intergenic
1053327644 9:37169953-37169975 CTCAAGAGGCTGAGGCTGGAGGG + Intronic
1053426691 9:38014778-38014800 CAGCAAAGGCAGAGCCTAGAAGG + Intronic
1053929831 9:43107347-43107369 CTCAAAAGGCTGAGGCAGGAGGG - Intergenic
1055776343 9:79770461-79770483 CAGTCAAAGCTGAGGCTAGAAGG + Intergenic
1055795256 9:79968705-79968727 CATTAAAGTCTGAGGTTTGAGGG - Intergenic
1056531561 9:87492765-87492787 CAGTGGAGGGTGAGGGTGGAGGG - Intergenic
1057865577 9:98677786-98677808 CTGTGAAGGTCGAGGCTGGAGGG - Intronic
1060799229 9:126533085-126533107 CTGTAAATGCTGAGTGTGGACGG - Intergenic
1061840913 9:133358127-133358149 CGCTCGAGGCTGAGGCTGGAGGG + Intronic
1062077395 9:134598309-134598331 CAGTAAAGTTTGATGATGGAAGG - Intergenic
1187333688 X:18363553-18363575 CAGGAAAGACACAGGCTGGAAGG - Intergenic
1187419930 X:19125294-19125316 CAGAAAAACCTGTGGCTGGAGGG - Intergenic
1189376677 X:40472100-40472122 CAGTAAATGCTGCAGCTGGGTGG + Intergenic
1191939427 X:66462414-66462436 CAGTAAAGGCTGCAGGTAGAAGG - Intergenic
1195206206 X:102602085-102602107 CAGTCAAGGCTGAGACGGGTGGG + Exonic
1195614847 X:106903960-106903982 CACTTACTGCTGAGGCTGGAGGG - Intronic
1197748951 X:129952140-129952162 CAGAAAAGGCTGACAGTGGAAGG - Intergenic
1199711532 X:150473158-150473180 GAGTAAAGGCTGAGACCAGATGG - Intronic
1200098256 X:153674103-153674125 CGGTGAAGGCAGAGACTGGAAGG - Exonic
1200742385 Y:6868208-6868230 CTGAACAGGCTGGGGCTGGAAGG + Exonic