ID: 1184307661

View in Genome Browser
Species Human (GRCh38)
Location 22:43617534-43617556
Sequence CCAAGTATGTAAAATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184307661_1184307664 -5 Left 1184307661 22:43617534-43617556 CCTTCCTCATTTTACATACTTGG No data
Right 1184307664 22:43617552-43617574 CTTGGCCCTCTTGAGAGATCAGG 0: 1
1: 0
2: 1
3: 11
4: 89
1184307661_1184307665 -2 Left 1184307661 22:43617534-43617556 CCTTCCTCATTTTACATACTTGG No data
Right 1184307665 22:43617555-43617577 GGCCCTCTTGAGAGATCAGGAGG 0: 1
1: 0
2: 1
3: 8
4: 112
1184307661_1184307668 6 Left 1184307661 22:43617534-43617556 CCTTCCTCATTTTACATACTTGG No data
Right 1184307668 22:43617563-43617585 TGAGAGATCAGGAGGTTTTCTGG No data
1184307661_1184307669 9 Left 1184307661 22:43617534-43617556 CCTTCCTCATTTTACATACTTGG No data
Right 1184307669 22:43617566-43617588 GAGATCAGGAGGTTTTCTGGTGG 0: 1
1: 0
2: 1
3: 23
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184307661 Original CRISPR CCAAGTATGTAAAATGAGGA AGG (reversed) Intronic
No off target data available for this crispr