ID: 1184308071

View in Genome Browser
Species Human (GRCh38)
Location 22:43622182-43622204
Sequence AGTGCCATGATACCAAAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 0, 3: 48, 4: 329}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184308069_1184308071 1 Left 1184308069 22:43622158-43622180 CCCAGTTCATTTTATGAAGCTAG 0: 6
1: 26
2: 134
3: 1543
4: 11391
Right 1184308071 22:43622182-43622204 AGTGCCATGATACCAAAATCAGG 0: 1
1: 0
2: 0
3: 48
4: 329
1184308070_1184308071 0 Left 1184308070 22:43622159-43622181 CCAGTTCATTTTATGAAGCTAGC 0: 1
1: 4
2: 47
3: 196
4: 637
Right 1184308071 22:43622182-43622204 AGTGCCATGATACCAAAATCAGG 0: 1
1: 0
2: 0
3: 48
4: 329
1184308068_1184308071 28 Left 1184308068 22:43622131-43622153 CCAGAAAATAGAATAGAAAGGAA 0: 1
1: 3
2: 28
3: 296
4: 1991
Right 1184308071 22:43622182-43622204 AGTGCCATGATACCAAAATCAGG 0: 1
1: 0
2: 0
3: 48
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184308071 Original CRISPR AGTGCCATGATACCAAAATC AGG Intronic
900872403 1:5313297-5313319 AGAGTGATGATAGCAAAATCCGG - Intergenic
902660574 1:17899022-17899044 ATTGTCCTGATACCAAAATCTGG + Intergenic
904408248 1:30308003-30308025 AGTGCCATGAAATCAGGATCTGG + Intergenic
908614347 1:65901426-65901448 ATAACCCTGATACCAAAATCTGG - Intronic
908867282 1:68563267-68563289 ATCACCCTGATACCAAAATCAGG - Intergenic
909285359 1:73809649-73809671 ATCACCCTGATACCAAAATCTGG - Intergenic
910126445 1:83847968-83847990 CGTGCCATGGTTCCCAAATCTGG + Intergenic
911222479 1:95263513-95263535 AGGGCCATAAGACCAAATTCTGG + Intergenic
911272607 1:95821497-95821519 ATTGCCCTGATACTAAAACCTGG - Intergenic
911924179 1:103806708-103806730 ATTGCCCTGATATCAAAACCAGG + Intergenic
912608905 1:111022660-111022682 ATCACCCTGATACCAAAATCTGG + Intergenic
913068337 1:115277758-115277780 AGAGCCAGAAGACCAAAATCTGG - Intergenic
915799264 1:158771466-158771488 AGAGCCCTGATTCCAATATCAGG - Intergenic
917221356 1:172732136-172732158 ATCACCCTGATACCAAAATCAGG + Intergenic
917467211 1:175290947-175290969 ATCACCCTGATACCAAAATCTGG + Intergenic
917577745 1:176341930-176341952 ACTGCCATCAGAACAAAATCAGG - Intergenic
917583505 1:176400338-176400360 ATTACCCTGATACCAAAACCAGG - Intergenic
917707710 1:177651014-177651036 AGTTTAATGATGCCAAAATCTGG - Intergenic
918747593 1:188225113-188225135 ATTACCCTGATACCAAAACCAGG - Intergenic
920973437 1:210762883-210762905 ATCATCATGATACCAAAATCTGG + Intronic
921401048 1:214724174-214724196 ATTGTCCTGATACCAAAACCTGG - Intergenic
921870259 1:220132166-220132188 ATTACCCTGATACCAAAACCAGG - Intronic
923345617 1:233049147-233049169 ATCACCCTGATACCAAAATCTGG + Intronic
924883013 1:248183656-248183678 ATCACCATAATACCAAAATCAGG - Intergenic
1063993304 10:11590815-11590837 AGTACCATGATTCCAAATGCAGG - Intronic
1064833609 10:19500092-19500114 ATTACCCTGATACTAAAATCTGG - Intronic
1064859219 10:19808609-19808631 ATTACCCTGATACCAAAACCTGG + Intergenic
1064917448 10:20476147-20476169 AGTGCCATTTTTCCAACATCAGG + Intergenic
1066160009 10:32718042-32718064 AGCATCCTGATACCAAAATCTGG + Intronic
1067101612 10:43338557-43338579 GGTGCCAAGATACCAAAAGGAGG + Intergenic
1068353908 10:55885432-55885454 ATTACCCTGATACCAAAATCTGG + Intergenic
1068984190 10:63091922-63091944 ATTGCTATGATAACAAAATAAGG + Intergenic
1071257562 10:83885725-83885747 AGCACCTTGATTCCAAAATCAGG - Intergenic
1071975522 10:90951792-90951814 AGCATCATGATACCAAAACCTGG - Intergenic
1072744131 10:97928164-97928186 AATGCCAAGATGCCAGAATCAGG - Intronic
1072768976 10:98120781-98120803 ATCGCCCTGATACCAAAACCAGG - Intergenic
1072807315 10:98431941-98431963 TGTGCTAAGTTACCAAAATCTGG + Intronic
1074349223 10:112718359-112718381 AGTTCCTTGAGCCCAAAATCTGG - Intronic
1075899002 10:126023244-126023266 AGTTCCATGATACCTACATTAGG - Intronic
1077757672 11:5051867-5051889 ACAGCCATGATACCAACATTGGG - Intergenic
1077801121 11:5538665-5538687 ATTTCCTTGATACCAAAACCTGG - Intronic
1079271957 11:18995984-18996006 ATTACCTTGATACCAAAACCAGG - Intergenic
1079687243 11:23375016-23375038 ATTACCTTGATACCAAAACCAGG + Intergenic
1080543069 11:33287994-33288016 AGTGCAAATATTCCAAAATCCGG - Intronic
1080982220 11:37422575-37422597 ATGACCATGATACCAAAACCAGG + Intergenic
1081299447 11:41432771-41432793 GGTGTAATGAGACCAAAATCAGG + Intronic
1082900426 11:58243924-58243946 ATTGCCCTGATAGCAAAACCAGG - Intergenic
1085060496 11:73441499-73441521 ATTACCTTGATACCAAAACCAGG - Intronic
1087326881 11:96735128-96735150 ATTGTCCTGATACCAAAATCTGG - Intergenic
1087568982 11:99899710-99899732 ATCACCATGATACCAAAATCAGG - Intronic
1088854721 11:113737796-113737818 AGTGGCATTATGCCAAAATGAGG + Intronic
1089463629 11:118668257-118668279 ATTACCCTGATACCAAAACCAGG + Intronic
1090303188 11:125665461-125665483 ATTACCATAATACCAAAATCAGG - Intronic
1090483766 11:127092925-127092947 ATCACCCTGATACCAAAATCTGG + Intergenic
1091015257 11:132045038-132045060 ATTAGCCTGATACCAAAATCTGG + Intronic
1091199843 11:133768366-133768388 ATTACTCTGATACCAAAATCTGG + Intergenic
1092034203 12:5316755-5316777 AGTCCCATGAAAGAAAAATCAGG - Intergenic
1093533637 12:20197482-20197504 ATTCTCCTGATACCAAAATCAGG - Intergenic
1095634517 12:44417192-44417214 ATTGCTCTGATACCAAAACCTGG - Intergenic
1097192175 12:57224884-57224906 AGTGCCCAGATACCAGAGTCCGG + Exonic
1097374577 12:58826054-58826076 ATTACCATGATACCAAAACCAGG + Intergenic
1098243274 12:68489216-68489238 AGCTCTTTGATACCAAAATCAGG + Intergenic
1098319549 12:69228164-69228186 ATTACCTTGATACCAAAACCAGG + Intergenic
1098458829 12:70708984-70709006 ATTGTCCTGATACCAAAACCTGG + Intronic
1098982371 12:76971031-76971053 ATTGCCCTAATACCAAAACCAGG - Intergenic
1099753473 12:86808287-86808309 ATTATCTTGATACCAAAATCTGG + Intronic
1099900577 12:88706298-88706320 ATCTCCCTGATACCAAAATCAGG - Intergenic
1101309949 12:103568279-103568301 ATTATCCTGATACCAAAATCTGG + Intergenic
1104102789 12:125630118-125630140 ATTTCCCTGATACCAAAACCAGG - Intronic
1106309473 13:28541418-28541440 AGTGAAATGGTACCAAAAACGGG - Intergenic
1106648306 13:31661078-31661100 ATCACCATGATACCAAAATCTGG - Intergenic
1107070958 13:36268663-36268685 AGATCAATGATACAAAAATCTGG + Intronic
1107083593 13:36401496-36401518 ATTACCCTGATACCAAAACCAGG - Intergenic
1107284462 13:38774923-38774945 ATTTCCATGATACCAAAATATGG + Intronic
1108230199 13:48330810-48330832 ATTACCTTGATACCAAAGTCAGG + Intronic
1108364055 13:49692464-49692486 AGTGCCCATATACCAAAGTCTGG + Intergenic
1109483839 13:62992896-62992918 ATGACCCTGATACCAAAATCAGG - Intergenic
1109567783 13:64140792-64140814 ATTACCCTGATACCAAAAACAGG + Intergenic
1109737575 13:66506657-66506679 AGCGCCATAATGCCATAATCAGG - Intronic
1110800697 13:79690930-79690952 ATTACCCTGATACCAAAACCAGG - Intergenic
1116177757 14:41494755-41494777 ATTATCCTGATACCAAAATCTGG + Intergenic
1117360625 14:54969711-54969733 ATTATCCTGATACCAAAATCTGG + Intronic
1117553835 14:56863915-56863937 AGTGCCATAAAATCATAATCTGG - Intergenic
1117930179 14:60833659-60833681 AGTATCCTGACACCAAAATCTGG - Intronic
1118030542 14:61813392-61813414 GGTGCCAAGATGCCAAAAGCAGG - Intergenic
1118522961 14:66607476-66607498 ATTATCCTGATACCAAAATCTGG - Intronic
1118543854 14:66862494-66862516 GTTACCCTGATACCAAAATCAGG + Intronic
1121479188 14:94247575-94247597 ATCACCCTGATACCAAAATCTGG + Intronic
1124704075 15:31946660-31946682 ATCACCCTGATACCAAAATCTGG + Intergenic
1125002117 15:34782611-34782633 ACCACCCTGATACCAAAATCTGG - Intergenic
1125055107 15:35349937-35349959 ATTACCCTGATACCAAAATCAGG - Intronic
1125135701 15:36339137-36339159 ATTACCCTGATACCAAAACCAGG - Intergenic
1125289974 15:38135542-38135564 ATTGCCCTGATACCAAAATGAGG + Intergenic
1126227356 15:46286651-46286673 ATTACCCTGATACCAAAACCTGG - Intergenic
1130291950 15:82610370-82610392 ATTTCCCTGATACCAAAATCAGG + Intronic
1131140933 15:89976670-89976692 AGTGCCCTCAAACCAAAATTGGG + Intergenic
1136715085 16:32273391-32273413 AGTAGCATGATATGAAAATCTGG + Intergenic
1136752830 16:32656340-32656362 AGTAGCATGATATGAAAATCTGG - Intergenic
1136815284 16:33214025-33214047 AGTAGCATGATATGAAAATCTGG + Intronic
1136821760 16:33324105-33324127 AGTAGCATGATATGAAAATCTGG + Intergenic
1136828323 16:33380644-33380666 AGTAGCATGATATGAAAATCTGG + Intergenic
1136833389 16:33479416-33479438 AGTAGCATGATATGAAAATCTGG + Intergenic
1138637784 16:58356093-58356115 ATTACCCTGATACCAAAACCAGG - Intronic
1141211307 16:81982584-81982606 AGCACCCTGATACCAAAACCTGG + Intergenic
1202993861 16_KI270728v1_random:37000-37022 AGTAGCATGATATGAAAATCTGG + Intergenic
1203011527 16_KI270728v1_random:245105-245127 AGTAGCATGATATGAAAATCTGG - Intergenic
1203054967 16_KI270728v1_random:916378-916400 AGTAGCATGATATGAAAATCTGG - Intergenic
1148013112 17:44501515-44501537 ACTACCATGAAACCAAAATCGGG + Intronic
1149090017 17:52766777-52766799 ATCACCCTGATACCAAAATCAGG + Intergenic
1149404482 17:56333659-56333681 ACTGCCTTGATACTAAAACCAGG - Intronic
1149678912 17:58490488-58490510 AAAGCCTTGATACCAAAATTGGG - Exonic
1150670194 17:67188546-67188568 ATTGCAATGATACTAAAATGAGG + Exonic
1151108411 17:71646438-71646460 ATTATCATGATAGCAAAATCTGG + Intergenic
1152209710 17:78996558-78996580 AGTAACATGAAACCAAAGTCTGG + Intronic
1153531137 18:6047412-6047434 ATCACCCTGATACCAAAATCTGG + Intronic
1156999373 18:43506407-43506429 GTTGTCATGATACCAAAATCTGG - Intergenic
1157071154 18:44410257-44410279 AATACCCTGATACCAAAATCAGG + Intergenic
1157249780 18:46084701-46084723 AATGCCATGTTACCAAGGTCAGG + Intronic
1157758230 18:50237657-50237679 GTGGCCATGATACCTAAATCAGG - Intronic
1159922263 18:74237049-74237071 AGTGCCATAAGAACAAAATAGGG - Intergenic
1165100521 19:33436037-33436059 AGTGCCCTGAAACCAAGATGGGG - Intronic
926164200 2:10508279-10508301 ATTACCCTGATACCAAAACCAGG + Intergenic
926235242 2:11037086-11037108 ATTACCCTGATACCAAAACCAGG - Intergenic
926514863 2:13830692-13830714 ATCGCCCTGATACCAAAACCTGG + Intergenic
927401127 2:22711673-22711695 ATTACCCTGATACCAAAATCTGG - Intergenic
930720186 2:54630935-54630957 AGTGCAATGAAACCAAATCCTGG + Exonic
930954223 2:57185306-57185328 ATTACCTTGATACCAAAATCTGG + Intergenic
931634204 2:64327213-64327235 AATGACATGATTCTAAAATCTGG - Intergenic
931896846 2:66741547-66741569 ATTACCCTGATACCAAAACCAGG - Intergenic
932470971 2:71956954-71956976 ATTACTCTGATACCAAAATCTGG + Intergenic
932806511 2:74788838-74788860 ATTACCCTGATACAAAAATCTGG - Intergenic
933771833 2:85749541-85749563 AGTGCCTGGATACCAAGATCTGG + Intergenic
934549385 2:95246026-95246048 ATTGTCCTGATACCAAAACCTGG + Intronic
936026693 2:109036349-109036371 ATTACCCTGATACCAAAATCAGG + Intergenic
936635426 2:114250815-114250837 AGTGCCCTGATTTCAAATTCTGG + Intergenic
936847680 2:116856191-116856213 ATTGTCCTGATACCAAAACCTGG + Intergenic
936884793 2:117297376-117297398 ATTGCCCTGATACCAAAGCCAGG - Intergenic
940469322 2:154074597-154074619 ATTCTCTTGATACCAAAATCTGG + Intronic
940471081 2:154101186-154101208 ATCACCATGATGCCAAAATCAGG - Intronic
940579258 2:155556829-155556851 ATTGCTTTGATACCAAAACCAGG + Intergenic
941874689 2:170420731-170420753 AGTGCCATGAGACCAGAAACTGG + Intronic
942835470 2:180291487-180291509 AGTGAGATTATACGAAAATCAGG + Intergenic
942922005 2:181385687-181385709 TTTGCCCTGATACCAAAACCAGG + Intergenic
943140376 2:183974963-183974985 ATCGTCCTGATACCAAAATCGGG - Intergenic
943207875 2:184924055-184924077 ATTGCCCTGATACCAAAACCAGG - Intronic
943660692 2:190555987-190556009 ATCGCCCTGATACCAAAACCTGG + Intergenic
944027783 2:195192740-195192762 ATCACCTTGATACCAAAATCAGG + Intergenic
945346875 2:208728921-208728943 ATTACCCTGATTCCAAAATCTGG - Intronic
945383558 2:209169611-209169633 AGTGTCACCATACTAAAATCAGG - Intergenic
1169003569 20:2187565-2187587 ATTACCCTGATACTAAAATCAGG - Intergenic
1170537127 20:17351359-17351381 ATCACCATGATACCAAAATCTGG + Intronic
1170741336 20:19060091-19060113 TATACCCTGATACCAAAATCAGG + Intergenic
1172472414 20:35209660-35209682 TGTGCAATGATGCCAAAGTCAGG + Intergenic
1173991962 20:47310438-47310460 GTTGCCAAGATACAAAAATCAGG + Intronic
1177260813 21:18726973-18726995 ATTGCCCTGATACCAAATCCAGG + Intergenic
1177884069 21:26727620-26727642 ATTGCCCTGATACAAAAGTCAGG - Intergenic
1177975740 21:27848215-27848237 ATTACCATGATACCAAAACCTGG + Intergenic
1181133239 22:20746785-20746807 AGTGCCCTGATAGCAAAATGAGG + Intronic
1181794707 22:25297807-25297829 ATTACCCTGATACCAAAACCTGG + Intergenic
1182000809 22:26918100-26918122 GGTGCCCTGATCTCAAAATCGGG + Intergenic
1183223741 22:36534614-36534636 TGTGCTAAGTTACCAAAATCTGG + Intergenic
1183226871 22:36556456-36556478 AGGGCTATGATACCATGATCTGG + Intergenic
1184308071 22:43622182-43622204 AGTGCCATGATACCAAAATCAGG + Intronic
1185133805 22:49056951-49056973 AGGGCCATGATGCCATAGTCAGG - Intergenic
949809298 3:7988843-7988865 GGTGCCATGATAGAAAAGTCTGG - Intergenic
951261087 3:20509865-20509887 ATTACCCTGATAGCAAAATCTGG - Intergenic
951300451 3:20989953-20989975 AGTTCCATGATACAAAAAAATGG - Intergenic
951828943 3:26902008-26902030 ATTATCCTGATACCAAAATCAGG + Intergenic
951922083 3:27866401-27866423 ATTACCCTGATACCAAAATCAGG - Intergenic
954495981 3:50962362-50962384 ATTACTATAATACCAAAATCAGG - Intronic
955602713 3:60664471-60664493 ATTACCCTGATACCAAAACCAGG - Intronic
956559788 3:70562464-70562486 ATTACCCTGATACCAAAATCAGG - Intergenic
957433527 3:80145336-80145358 ATTGCCCTGATATCAAAACCAGG - Intergenic
957849255 3:85784767-85784789 ATTACCCTGATACCAAAACCAGG - Intronic
958264112 3:91417734-91417756 ATCACCCTGATACCAAAATCTGG + Intergenic
958487233 3:94728165-94728187 AGTCCCATAATGCCAAAGTCTGG + Intergenic
959293585 3:104505831-104505853 AGTATCCTGATACCAAAACCAGG + Intergenic
959694820 3:109238009-109238031 ACTATCCTGATACCAAAATCTGG + Intergenic
959987455 3:112590905-112590927 ATTACCATGATACCAAAGCCAGG - Intergenic
962333446 3:134502305-134502327 ATCACCCTGATACCAAAATCTGG - Intronic
962987156 3:140546291-140546313 AATGCCAGGATTCCTAAATCTGG + Intronic
963701721 3:148634844-148634866 ATTACCCTGATACCAAAACCTGG + Intergenic
964038299 3:152225777-152225799 AGAAACATGATACTAAAATCTGG + Intergenic
964053484 3:152423593-152423615 ATCGTCCTGATACCAAAATCTGG + Intronic
964166466 3:153712570-153712592 ATTACCCTGATACCAAAAGCAGG - Intergenic
964775578 3:160273002-160273024 ACCCCCAGGATACCAAAATCTGG - Intronic
965394491 3:168145357-168145379 ATTGCCATGATACCAAAGCTGGG - Intergenic
965860936 3:173149312-173149334 ATTACCCTGATACCAAAAGCAGG + Intergenic
966292063 3:178371132-178371154 ATTGCCCTAATACCAAAACCAGG - Intergenic
966519705 3:180859876-180859898 ATTGCCCTGATACCAAAGCCAGG + Intronic
966573491 3:181473862-181473884 ATTGTCCTGATACCAAAACCTGG - Intergenic
966991834 3:185240249-185240271 ACCACCTTGATACCAAAATCAGG - Intronic
967196862 3:187034415-187034437 ATTACCCTGATACCAAAACCTGG + Intronic
967944567 3:194792991-194793013 ATTACCCTGATACCAAAACCAGG - Intergenic
970173974 4:13318830-13318852 ATTACCTTGATACCAAAACCAGG - Intergenic
971429385 4:26548729-26548751 ATTATCCTGATACCAAAATCTGG - Intergenic
971680221 4:29689563-29689585 ATTGCCCTGATACCAAAACCAGG + Intergenic
971819460 4:31532343-31532365 ATTACCATTATAACAAAATCAGG - Intergenic
973203349 4:47530979-47531001 ATCACCATGATACCCAAATCTGG - Intronic
973675756 4:53260709-53260731 ATTACCCTGATATCAAAATCAGG - Intronic
974133183 4:57781677-57781699 ATTGCCCTAATACCAAAACCAGG - Intergenic
974243093 4:59277630-59277652 ACTACCTTGATACCAAAACCAGG + Intergenic
974966300 4:68764593-68764615 ATTGCTCTGATACCAAAACCTGG + Intergenic
975275962 4:72502095-72502117 ATTACCCTGATACCAAAACCTGG - Intronic
975923453 4:79420797-79420819 ATTACCCTGATACCAAAATCTGG - Intergenic
976563282 4:86526049-86526071 ATCACCCTGATACCAAAATCTGG - Intronic
977185874 4:93935359-93935381 ATTACCCTGATACCAAAACCAGG + Intergenic
977829009 4:101568159-101568181 ATTGCCCTGATACCAATACCAGG + Intronic
978010139 4:103671269-103671291 ATTACCCTGATACCAAAACCAGG - Intronic
978055242 4:104255576-104255598 ATCACCATGATACCAAAACCTGG + Intergenic
978263459 4:106792395-106792417 ATTACCCTGATACCAAAACCTGG - Intergenic
978683423 4:111411269-111411291 ATTGTCTTGATACCAAAACCTGG - Intergenic
978762123 4:112364716-112364738 ATTGCCCTAATACCAAAACCAGG + Intronic
978763553 4:112380997-112381019 AGTGCCTTGTGACCAAATTCAGG - Intronic
979180717 4:117722568-117722590 ATTACCCTGATACCAAAATCAGG + Intergenic
979460661 4:120979000-120979022 AGTTACTTGATACTAAAATCTGG + Intergenic
979976147 4:127198206-127198228 ATCACCTTGATACCAAAATCAGG + Intergenic
980258379 4:130413360-130413382 ATCACCTTGATACCAAAATCTGG + Intergenic
980531854 4:134067016-134067038 ATTGTCCTGATACCAAAACCTGG - Intergenic
981257165 4:142675506-142675528 ATTATCCTGATACCAAAATCTGG + Intronic
981780613 4:148425475-148425497 AGAGGCAGGAAACCAAAATCAGG + Intronic
983303805 4:165960473-165960495 ATTATCCTGATACCAAAATCTGG + Intronic
983776932 4:171619844-171619866 ATTACCCTGATACCAAAATCAGG + Intergenic
984079850 4:175233602-175233624 AGTGCAATAATACCAAGATGTGG + Intergenic
984231302 4:177103069-177103091 ATTAACATGATACCAAAGTCAGG + Intergenic
986003882 5:3651435-3651457 AGTCTCTTGATACCAACATCAGG + Intergenic
986675526 5:10181300-10181322 ATTGCCCTGATACAAAAACCTGG + Intergenic
987610994 5:20202454-20202476 AGTGACAAGATAACAAAATATGG - Intronic
987756347 5:22101973-22101995 AGTGCCATATTTACAAAATCAGG + Intronic
987826691 5:23039006-23039028 AATGCCTTCATACCAACATCTGG + Intergenic
988036429 5:25833049-25833071 ATTACCATGATACCAAAGCCAGG - Intergenic
988091705 5:26550245-26550267 ATTACCATGATACCAAAACTTGG + Intergenic
988140997 5:27240033-27240055 AGCACCCTGATACCAAAAGCTGG - Intergenic
988355448 5:30168039-30168061 ATTACCCTAATACCAAAATCAGG + Intergenic
988651355 5:33155171-33155193 ATTGCTTTGATACCAAAATATGG + Intergenic
989819848 5:45783972-45783994 ACTGCCCTGATACCACAACCAGG - Intergenic
990090133 5:52034577-52034599 ATATCCTTGATACCAAAATCTGG + Intronic
990931146 5:61093743-61093765 ATCACCATGATACCAAAACCTGG - Intronic
991326770 5:65442557-65442579 ATTACCCTAATACCAAAATCAGG + Intronic
991510803 5:67374791-67374813 AATGCTATGATACAAAGATCTGG - Intergenic
992355668 5:75980374-75980396 ATTGTCCTGATACCAAAACCTGG + Intergenic
993205788 5:84876670-84876692 ATTACCCTGATACCAAAACCAGG + Intergenic
993208396 5:84916827-84916849 ATTATCATGATACCAAAACCTGG - Intergenic
993948276 5:94141025-94141047 ATTGCCCTAATACCAAAACCAGG - Intergenic
994229300 5:97295542-97295564 AGTGTGATGATACCAAAGTCGGG + Intergenic
995030138 5:107471182-107471204 GGTTCCATGCTACCAAAATATGG - Intronic
995536968 5:113146315-113146337 AGTGCCTTGATGGCAAAAACAGG - Intronic
995818124 5:116194824-116194846 ATTACCCTAATACCAAAATCAGG + Intronic
996492974 5:124120420-124120442 ATTACCCTGATACCAAAACCTGG - Intergenic
996503908 5:124247273-124247295 ATTACCCTGATACCAAAACCAGG + Intergenic
996945282 5:129059295-129059317 ATTAGCCTGATACCAAAATCAGG + Intergenic
998720277 5:144938316-144938338 AAAATCATGATACCAAAATCAGG + Intergenic
1001414408 5:171534561-171534583 GGTGCCATGATCCCCAAATCGGG + Intergenic
1002768873 6:270587-270609 ATTGCTCTGATACCAAAACCAGG - Intergenic
1007412130 6:41671032-41671054 AATTCCATGTTACCAAAAGCTGG + Intergenic
1008122918 6:47638108-47638130 AGTATCCTGATACCAAAACCTGG - Intergenic
1008263062 6:49390401-49390423 ATTGTCCTGATACCAAAACCTGG + Intergenic
1008540516 6:52542586-52542608 ACTGCCTTGATACAAAAATCAGG + Intronic
1008741355 6:54613043-54613065 ATTGCCCTCATACCAAAGTCAGG - Intergenic
1009045617 6:58234132-58234154 ATCACCTTGATACCAAAATCTGG - Intergenic
1009162178 6:60296682-60296704 ATTGCCCTAATACCAAAACCAGG - Intergenic
1010639445 6:78305703-78305725 ATTACCCTGATACCAAAACCTGG - Intergenic
1010961367 6:82149512-82149534 ATTACCCTGATACCAAAATCAGG + Intergenic
1012013850 6:93829662-93829684 AGTATCCTGATACCAAAACCTGG - Intergenic
1012289719 6:97437798-97437820 AGTGCAATGTTACCAAAAAAAGG - Intergenic
1012410565 6:98951662-98951684 ATTACCCTGATAGCAAAATCAGG - Intergenic
1012415358 6:99006896-99006918 AGTTTCAGGATACAAAAATCAGG - Intergenic
1012615443 6:101272463-101272485 ATTGCCCTGATACCAAAACCGGG + Intergenic
1012810658 6:103953098-103953120 ATTAGCCTGATACCAAAATCTGG + Intergenic
1013947560 6:115739655-115739677 AGTGTCATCATATCAAATTCAGG + Intergenic
1014826647 6:126054695-126054717 AGTGTCATGATTTTAAAATCTGG + Intergenic
1015281337 6:131437493-131437515 ATTATCCTGATACCAAAATCTGG + Intergenic
1016059331 6:139612819-139612841 ATTACCTTGATACCAAAACCAGG - Intergenic
1017318607 6:153062190-153062212 AGTGACATGATATTAAAACCAGG - Intronic
1019113193 6:169734769-169734791 ATCGCCCTGATACCAAAACCTGG - Intergenic
1019945215 7:4323051-4323073 ATTACCCTGATACCAAAATGAGG - Intergenic
1020497949 7:8879456-8879478 ATTATCCTGATACCAAAATCTGG + Intergenic
1020592137 7:10153262-10153284 ATCACCCTGATACCAAAATCAGG + Intergenic
1021641303 7:22739661-22739683 ATTACCCTGATACCAAAACCAGG + Intergenic
1023441233 7:40186931-40186953 GCTGCCATGATTTCAAAATCTGG - Intronic
1024227839 7:47341221-47341243 ATTACCCTGATACCAAAACCAGG - Intronic
1027456533 7:78398829-78398851 AGTGCCCTGAAACAAAAAGCAGG - Intronic
1027602125 7:80252211-80252233 ATCGACCTGATACCAAAATCTGG + Intergenic
1028004352 7:85543741-85543763 AATGCCCTGCTACCAAAACCGGG - Intergenic
1028083288 7:86603231-86603253 ATCACCATGATACCAAAACCTGG + Intergenic
1028346965 7:89795094-89795116 ATTATCATGATACCAACATCTGG - Intergenic
1028644786 7:93083436-93083458 ATTACCCTGATACCAAAATCAGG + Intergenic
1028652291 7:93162859-93162881 ACTGACATCATACCACAATCGGG + Intergenic
1028868739 7:95742140-95742162 ATTGCCCTGATACCAAAACCTGG + Intergenic
1029043689 7:97604256-97604278 TGCCCCAGGATACCAAAATCTGG - Intergenic
1030159843 7:106495985-106496007 ATCGCCCTGATACCAAAACCTGG + Intergenic
1030387880 7:108888204-108888226 ATCACCTTGATACCAAAATCTGG + Intergenic
1030748011 7:113192016-113192038 ATTACCCTCATACCAAAATCAGG + Intergenic
1030897331 7:115076927-115076949 ATTGGCCTGATACCAAATTCTGG - Intergenic
1031509658 7:122634154-122634176 ATTATCCTGATACCAAAATCTGG - Intronic
1031912103 7:127528495-127528517 ATCACCCTGATACCAAAATCTGG + Intergenic
1032520853 7:132543824-132543846 AGGGGCATGAGACCAAAATCAGG + Intronic
1033709077 7:143920004-143920026 ATTATCCTGATACCAAAATCTGG - Intergenic
1034205870 7:149314674-149314696 ATCACCCTGATACCAAAATCTGG - Intergenic
1034708233 7:153166691-153166713 ATCACCCTGATACCAAAATCAGG - Intergenic
1036178075 8:6558137-6558159 AGTGGCATTATAGCATAATCAGG - Intronic
1041826951 8:62106316-62106338 ATTAGCCTGATACCAAAATCTGG + Intergenic
1041832722 8:62174168-62174190 ATTATCCTGATACCAAAATCTGG - Intergenic
1041887928 8:62833835-62833857 ATTACCCTGATACCAAAATATGG + Intronic
1042687211 8:71455418-71455440 ATTACCCTGATACCAAAGTCTGG + Intronic
1043233650 8:77833379-77833401 ATTATCCTGATACCAAAATCTGG + Intergenic
1044892248 8:96849770-96849792 AGTGCCAAGCCACCAAAAACTGG - Intronic
1045256742 8:100531432-100531454 AGAGCCATTGTCCCAAAATCTGG + Intronic
1045698985 8:104844191-104844213 ATCGCCTTGATACCAAAATCTGG - Intronic
1046394204 8:113618754-113618776 ATTGCCTTGATATCAAAATCAGG + Intergenic
1046495102 8:115003955-115003977 AATACCATGATACCACAATGTGG - Intergenic
1047058468 8:121194380-121194402 ATTGCCATGATACCATAATTGGG + Intergenic
1048464005 8:134648094-134648116 TGTGAAATGATACCACAATCAGG - Intronic
1048647025 8:136433140-136433162 ATTACCCTGATACTAAAATCGGG + Intergenic
1050185098 9:2965007-2965029 AGTGACATGTTAGTAAAATCTGG + Intergenic
1050383018 9:5050995-5051017 AATGCCAATATTCCAAAATCTGG - Intronic
1052250469 9:26391651-26391673 ATTATCTTGATACCAAAATCTGG - Intergenic
1052450520 9:28624653-28624675 ACTACCCTGATACCAAAAACAGG - Intronic
1052903136 9:33812116-33812138 AGTACCCTGATAGCAAAACCAGG + Intergenic
1054753859 9:68937091-68937113 ATCACCCTGATACCAAAATCTGG - Intronic
1055227663 9:74019313-74019335 ATTACCCTGATACCAAAATCAGG + Intergenic
1055562951 9:77539488-77539510 ATTACCCTGATACCAAAACCAGG - Intronic
1055675859 9:78659965-78659987 ATTACCCTGATACCAAAATCTGG - Intergenic
1055846819 9:80575278-80575300 ATTGCCTTAATACCAAAACCAGG + Intergenic
1057238346 9:93385569-93385591 ATTGCCCTGAAACCAAAACCAGG + Intergenic
1060164725 9:121401681-121401703 ATCACCCTGATACCAAAATCTGG + Intergenic
1186774512 X:12851271-12851293 ATTGTCCTGATACCAAAACCTGG - Intergenic
1186971441 X:14849107-14849129 ATAGCCTTGATACTAAAATCAGG + Intronic
1187115164 X:16342026-16342048 AGTTCCAGGATACCAAATTAAGG - Intergenic
1187695857 X:21919233-21919255 ATTGCCCTAATACCAAAACCAGG - Intergenic
1188119769 X:26289963-26289985 AATACCCTGATACCAAAATCAGG - Intergenic
1188507467 X:30897994-30898016 ACTGCCATGAGACCAACATGGGG + Intronic
1188644677 X:32551143-32551165 ATTGTCCTGATACCAAAACCTGG + Intronic
1188896707 X:35677938-35677960 AGTGCCATGATATCAAAGGGTGG - Intergenic
1189230529 X:39449019-39449041 ATTACCATGCTACCAAAAGCAGG + Intergenic
1189441853 X:41043745-41043767 AGATCAATGATACCAAAACCTGG + Intergenic
1189894253 X:45637376-45637398 ATCACCCTGATACCAAAATCTGG + Intergenic
1190531426 X:51381909-51381931 CATACCATGATACCAAAACCTGG + Intergenic
1190561695 X:51692666-51692688 AGTAGCCTGATACCAAAATCTGG + Intergenic
1190562594 X:51700639-51700661 AGTAGCCTGATACCAAAATCTGG - Intergenic
1191135059 X:57055232-57055254 GGCATCATGATACCAAAATCTGG - Intergenic
1191137952 X:57086319-57086341 ATTATCCTGATACCAAAATCTGG + Intergenic
1191179853 X:57550062-57550084 ATTACCCTAATACCAAAATCTGG + Intergenic
1191611402 X:63118293-63118315 ATCACCCTGATACCAAAATCAGG + Intergenic
1191703998 X:64073900-64073922 AGTACGCTGATACCAAAACCAGG + Intergenic
1192703385 X:73500638-73500660 GCTGCTATGATACTAAAATCAGG - Intergenic
1192724601 X:73735398-73735420 ATCACCCTGATACCAAAATCTGG - Intergenic
1192762647 X:74109908-74109930 ATTACCCTGAAACCAAAATCTGG + Intergenic
1192778531 X:74270091-74270113 AGTTCCATGATATCACAAGCTGG - Intergenic
1192790276 X:74375199-74375221 ATTACCCTGATATCAAAATCAGG - Intergenic
1193192558 X:78589054-78589076 ATTACCATGATACCAAAACCAGG - Intergenic
1193374960 X:80748369-80748391 ATTACCCTGATACCAAATTCAGG - Intronic
1193609933 X:83619160-83619182 AATACCTTGATACCAAAACCAGG - Intergenic
1193747035 X:85294697-85294719 ATTATCCTGATACCAAAATCTGG - Intronic
1193915760 X:87361357-87361379 ATTACCATGATACCAAAAGCAGG + Intergenic
1193987504 X:88262995-88263017 AATACTATGACACCAAAATCTGG - Intergenic
1194102436 X:89722871-89722893 ATTACCCTGATACCAAAACCAGG - Intergenic
1194110066 X:89823089-89823111 ATCACCCTGATACCAAAATCTGG - Intergenic
1194118652 X:89934284-89934306 ATTGTCCTGATACCAAAACCTGG - Intergenic
1194242806 X:91472233-91472255 ATTACCCTGATACCAAAACCAGG + Intergenic
1194319264 X:92423148-92423170 ATTGCCATAATAAAAAAATCAGG - Intronic
1195724913 X:107904524-107904546 AATGGGATGATACCAAAGTCAGG + Intronic
1195774477 X:108388197-108388219 ATTGTCCTGATACCAAAACCTGG - Intronic
1196272831 X:113732475-113732497 AGTATCCTGATACCAAAACCTGG - Intergenic
1197564467 X:128064784-128064806 ATTACCACGAAACCAAAATCAGG + Intergenic
1197600922 X:128528610-128528632 ATTATCATGACACCAAAATCTGG + Intergenic
1198220372 X:134594374-134594396 ATTACCCTGATACTAAAATCAGG - Intronic
1198544970 X:137681796-137681818 AATGCTATGTTTCCAAAATCTGG + Intergenic
1200359378 X:155587025-155587047 ATTACCTTCATACCAAAATCTGG + Intronic
1200405283 Y:2804225-2804247 ATTACTCTGATACCAAAATCTGG - Intergenic
1200455022 Y:3380148-3380170 ATTACCCTGATACCAAAACCAGG - Intergenic
1200462727 Y:3477825-3477847 ATCACCCTGATACCAAAATCTGG - Intergenic
1200471529 Y:3591850-3591872 ATTGTCCTGATACCAAAACCTGG - Intergenic
1200523316 Y:4239561-4239583 ATTGCCCTGACACCAAAACCAGG - Intergenic
1200627394 Y:5536224-5536246 ATTGCCATAATAAAAAAATCAGG - Intronic
1200963164 Y:9013401-9013423 AGTGCCATGATCCCAAAAGAAGG - Intergenic
1201395491 Y:13543393-13543415 ATTATCTTGATACCAAAATCTGG + Intergenic
1201967159 Y:19750649-19750671 ATCACCCTGATACCAAAATCAGG - Intergenic