ID: 1184311055

View in Genome Browser
Species Human (GRCh38)
Location 22:43643124-43643146
Sequence ATTTGATTGAGGAGCTACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184311050_1184311055 0 Left 1184311050 22:43643101-43643123 CCCAAGGATCGCCACGAAAGAGC 0: 1
1: 0
2: 0
3: 3
4: 26
Right 1184311055 22:43643124-43643146 ATTTGATTGAGGAGCTACCAGGG No data
1184311046_1184311055 30 Left 1184311046 22:43643071-43643093 CCTTCTGGCTCCAGACAGGAACG 0: 1
1: 0
2: 0
3: 16
4: 145
Right 1184311055 22:43643124-43643146 ATTTGATTGAGGAGCTACCAGGG No data
1184311051_1184311055 -1 Left 1184311051 22:43643102-43643124 CCAAGGATCGCCACGAAAGAGCA 0: 1
1: 0
2: 0
3: 1
4: 52
Right 1184311055 22:43643124-43643146 ATTTGATTGAGGAGCTACCAGGG No data
1184311048_1184311055 20 Left 1184311048 22:43643081-43643103 CCAGACAGGAACGGAAGCTTCCC 0: 1
1: 0
2: 1
3: 6
4: 103
Right 1184311055 22:43643124-43643146 ATTTGATTGAGGAGCTACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184311055 Original CRISPR ATTTGATTGAGGAGCTACCA GGG Intronic
No off target data available for this crispr