ID: 1184313013

View in Genome Browser
Species Human (GRCh38)
Location 22:43660608-43660630
Sequence TTGACCAGGACTGTGTTATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 210}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184313013_1184313018 4 Left 1184313013 22:43660608-43660630 CCACATAACACAGTCCTGGTCAA 0: 1
1: 0
2: 1
3: 24
4: 210
Right 1184313018 22:43660635-43660657 ATGTGAGTGGAAACTTGTTGGGG 0: 1
1: 0
2: 1
3: 27
4: 240
1184313013_1184313017 3 Left 1184313013 22:43660608-43660630 CCACATAACACAGTCCTGGTCAA 0: 1
1: 0
2: 1
3: 24
4: 210
Right 1184313017 22:43660634-43660656 AATGTGAGTGGAAACTTGTTGGG 0: 1
1: 0
2: 1
3: 18
4: 288
1184313013_1184313015 -9 Left 1184313013 22:43660608-43660630 CCACATAACACAGTCCTGGTCAA 0: 1
1: 0
2: 1
3: 24
4: 210
Right 1184313015 22:43660622-43660644 CCTGGTCAATAAAATGTGAGTGG 0: 1
1: 0
2: 9
3: 76
4: 364
1184313013_1184313016 2 Left 1184313013 22:43660608-43660630 CCACATAACACAGTCCTGGTCAA 0: 1
1: 0
2: 1
3: 24
4: 210
Right 1184313016 22:43660633-43660655 AAATGTGAGTGGAAACTTGTTGG 0: 1
1: 0
2: 1
3: 11
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184313013 Original CRISPR TTGACCAGGACTGTGTTATG TGG (reversed) Intronic
901257560 1:7843714-7843736 TTGAACAGGGCAGTGTTGTGGGG + Exonic
903287076 1:22284057-22284079 TTGACCAAGTCTGGGTCATGTGG + Intergenic
904923898 1:34030753-34030775 TCGACCAGGACTGAGAAATGAGG + Intronic
907786199 1:57615262-57615284 TTGACCAGAACTTAGTCATGTGG - Intronic
907964918 1:59319723-59319745 ATGAGCAGGACTGTATTAGGCGG + Intronic
908405309 1:63808663-63808685 TTGGCCAGAAATGTGTCATGTGG + Intronic
908927383 1:69272272-69272294 TTGATCATGACTGGGTTATCAGG + Intergenic
909428526 1:75557033-75557055 TTGGCCAGAACTGTGTTACATGG + Intronic
909516281 1:76511013-76511035 TTTACCAGGCTTGGGTTATGAGG - Intronic
911118500 1:94271539-94271561 TTGCCCAGGAATCTGTTTTGTGG - Intronic
911158012 1:94655489-94655511 TTGACTAGGACTGAGGGATGAGG + Intergenic
912618538 1:111132171-111132193 TTGATCATGCCTGTGTAATGAGG + Intronic
912740897 1:112196321-112196343 TTGACCAAAACGTTGTTATGTGG - Intergenic
913129535 1:115827273-115827295 TTGTCCAGGTCTGGGTTATATGG - Intergenic
915542441 1:156576529-156576551 TTGACCAAAACGTTGTTATGAGG - Intergenic
916223727 1:162469039-162469061 TTGACCAGACCTGTGTAGTGTGG - Intergenic
917123850 1:171668427-171668449 TTGGCCAGAACTGTGTTACCTGG + Intergenic
917441368 1:175071913-175071935 TTTGGCAGGACTGTGCTATGAGG + Intronic
917604296 1:176610578-176610600 CTGACCAGGACTGTGTCTAGGGG - Intronic
918029740 1:180794358-180794380 TTGACCAGAACGTTGTTCTGTGG + Intronic
923323178 1:232856724-232856746 TTAAACCAGACTGTGTTATGAGG - Intergenic
1062985074 10:1761063-1761085 TTGGTCAGGCCTGGGTTATGGGG + Intergenic
1063995340 10:11613141-11613163 TTGACCAAAACGATGTTATGTGG + Intergenic
1065783054 10:29188588-29188610 TTGACCAAAACATTGTTATGTGG - Intergenic
1066491423 10:35898641-35898663 AGGACCAGGACTGTGTTTAGGGG + Intergenic
1069286775 10:66724465-66724487 TGGCCCTGGAATGTGTTATGTGG + Intronic
1070432899 10:76359079-76359101 GTGACCTGCACTGTGTTCTGTGG - Intronic
1070607957 10:77912624-77912646 TTAACCAGGACAGTGATGTGGGG - Intronic
1071007205 10:80896480-80896502 TTGACCAGGATTTTATAATGTGG + Intergenic
1071540900 10:86482951-86482973 TTGACCAAAACCTTGTTATGTGG - Intronic
1072217651 10:93301386-93301408 TTGACCAAAACGTTGTTATGTGG + Intergenic
1072505206 10:96059297-96059319 TAGAGCAGCACTTTGTTATGTGG + Exonic
1072594621 10:96859908-96859930 TTGGCCAGGCCTGGGTCATGTGG + Intronic
1072775198 10:98184294-98184316 TTGACCAAAACATTGTTATGTGG - Intronic
1074004025 10:109401074-109401096 TTCACCAGGACTCTGTGAGGTGG - Intergenic
1074259979 10:111843025-111843047 TTGACCAAAACTGTTATATGAGG + Intergenic
1074437220 10:113444471-113444493 TTGACCAGAACTATGTCATGTGG + Intergenic
1075216922 10:120544467-120544489 TTGACCAGGGCTCTGTGTTGCGG - Intronic
1075311428 10:121417155-121417177 TTGGCCAGGACTGGGTTATAGGG + Intergenic
1075636127 10:124031600-124031622 TTGACCAAAACTTGGTTATGTGG + Intronic
1075752864 10:124787817-124787839 TTGACCAGGTGATTGTTATGTGG + Intronic
1081476893 11:43442245-43442267 TTGACCAGAACTTCATTATGTGG + Intronic
1081592750 11:44436247-44436269 TTGGCCAGAACTTTGTCATGTGG + Intergenic
1083245877 11:61427929-61427951 TTGACCCTGACTTTGATATGAGG - Intronic
1085942042 11:81216304-81216326 CTGACCAGGCTTTTGTTATGTGG + Intergenic
1087540418 11:99510575-99510597 TTGACCAAAACATTGTTATGGGG - Intronic
1087704036 11:101468484-101468506 TTGACCAGAACTATGATATATGG - Intronic
1088066922 11:105730948-105730970 TTGCCCAGGCCTGTGTTCTGAGG - Intronic
1090815485 11:130290449-130290471 GTGACCAGGTCTGTGTTAGGAGG - Intronic
1090934682 11:131330812-131330834 TTGACCAGGAGTGTGATTTCAGG - Intergenic
1095161904 12:38927850-38927872 TTGCACAGGATTGTGGTATGAGG - Intergenic
1096443724 12:51669213-51669235 TTGACCAAAACATTGTTATGTGG + Intronic
1097789544 12:63800003-63800025 GGGACCAGGACTATGTTTTGAGG - Intronic
1098507530 12:71271445-71271467 TTGACCAAAACATTGTTATGTGG + Intronic
1099384121 12:81993619-81993641 TTGACCAGGAATATGACATGAGG + Intergenic
1099731284 12:86506958-86506980 TTGACCAGGATTGTGAAATGTGG + Intronic
1099909407 12:88811353-88811375 TTGACCAGGTTTGGGTCATGTGG - Intergenic
1100862810 12:98824606-98824628 GTGACCTGGACCGAGTTATGTGG - Intronic
1107285590 13:38787134-38787156 TTTACCAGCCCTGTGTTCTGGGG - Intronic
1111591885 13:90358324-90358346 TTGACCAAAACTTTGTTATGTGG - Intergenic
1111855737 13:93634795-93634817 TTGTGCAGAACAGTGTTATGTGG + Intronic
1113159785 13:107366937-107366959 TTGGCCAGAACTTTCTTATGTGG + Intronic
1116798260 14:49414693-49414715 TTGACCAAAACATTGTTATGGGG - Intergenic
1118711877 14:68526275-68526297 TTGACCAAAACATTGTTATGTGG - Intronic
1120983103 14:90308592-90308614 TTGACCAGCACTGTCATGTGAGG - Intronic
1121287467 14:92747756-92747778 TTGACTAGCCCTGTGGTATGTGG - Intronic
1123082590 14:105702847-105702869 TGGACCAGGACTGAGTGATCAGG + Intergenic
1123082610 14:105702947-105702969 TGGACCAGGACTGAGTGATCAGG + Intergenic
1123855908 15:24411512-24411534 TTTATCAGGACTTTGTTAGGTGG - Intergenic
1123860829 15:24465082-24465104 TTTATCAGGACTTTGTTAGGTGG - Intergenic
1131204915 15:90435943-90435965 TTGAACATGGCTGTGTTTTGTGG - Intronic
1132017710 15:98333399-98333421 ATCACCAGGACTGGGTAATGAGG + Intergenic
1132643030 16:986449-986471 TTGCCCATGACTGTGCCATGTGG + Exonic
1133705996 16:8355165-8355187 TTCACTATGACTGTGGTATGTGG + Intergenic
1134402378 16:13921210-13921232 TTCACCAAGGCTGTGTTAAGAGG + Intronic
1135207293 16:20494076-20494098 TTCACCAGGCATGTGTTATGGGG - Intergenic
1135211592 16:20529556-20529578 TTCACCAGGCATGTGTTATGGGG + Intergenic
1135530722 16:23251070-23251092 TTCACCAGAACTGTGTCATATGG - Intergenic
1135832573 16:25789062-25789084 TTGATCAGGCCTGGGTCATGTGG + Intronic
1139228057 16:65252376-65252398 TCATCCAGAACTGTGTTATGTGG - Intergenic
1139781934 16:69359141-69359163 TTAACCAAAACTTTGTTATGTGG + Intronic
1140263951 16:73404204-73404226 TTGTCCAGGACTGAGCTAAGTGG - Intergenic
1143331907 17:6143632-6143654 TTGACCAGAACTGAGACATGTGG - Intergenic
1144153070 17:12469800-12469822 CTCACCAGGACTGTGTTAGCAGG + Intergenic
1146862151 17:36312355-36312377 TTGTCTAGGACTGTCTTGTGTGG + Intronic
1147092479 17:38116458-38116480 TTGTCTAGGACTGTCTTGTGTGG + Intergenic
1147104729 17:38204041-38204063 TTGTCTAGGACTGTCTTGTGTGG - Intergenic
1147504772 17:41004769-41004791 TGGACCAGGACAATGTTTTGTGG + Intergenic
1148424768 17:47584422-47584444 TTGTCTAGGACTGTCTTGTGTGG + Intronic
1148535993 17:48439606-48439628 TTTTCCAGGACAGTGCTATGGGG + Intergenic
1148537676 17:48454379-48454401 TTGGCCAGAACTGTGTCATGTGG - Intergenic
1150186657 17:63188940-63188962 TTGCCTAGGACTGGGTTGTGTGG - Intronic
1152447916 17:80356521-80356543 TTCACCACCACTGTGTTCTGGGG + Intronic
1152701954 17:81823728-81823750 ATGACCAGGACTGTGGTCAGAGG + Intronic
1153497329 18:5712832-5712854 TTGATGAGGTCTGCGTTATGTGG - Intergenic
1154173384 18:12067039-12067061 ATGACCATGAGTGTGTGATGGGG - Intergenic
1154345222 18:13537705-13537727 TTGACCAATACATTGTTATGAGG + Intronic
1157645814 18:49269605-49269627 TTGACCAAAACATTGTTATGTGG - Intronic
1158756139 18:60327892-60327914 TTAACCAGGACAGTTTTCTGTGG - Intergenic
1158827913 18:61244379-61244401 TTGACCAAAACATTGTTATGTGG - Intergenic
1163051567 19:14688696-14688718 TTGACCAAAACCTTGTTATGTGG + Intronic
1165284542 19:34830757-34830779 TTGACCAAAACCTTGTTATGAGG - Intergenic
1165379697 19:35469834-35469856 ATGACCAGAACGTTGTTATGTGG + Intergenic
1166274342 19:41741861-41741883 TAGACTGGGGCTGTGTTATGGGG + Intronic
1166279291 19:41780136-41780158 TAGACTGGGGCTGTGTTATGGGG + Intergenic
1168491981 19:56818632-56818654 TTGTCCTGGATTGTGTTGTGAGG + Exonic
926319869 2:11742189-11742211 TTGACCAGAACATTGGTATGCGG - Intronic
927859062 2:26548571-26548593 TTGACCAAAACGGTGTTATGTGG - Intronic
929047395 2:37803383-37803405 TTGACCAAAATGGTGTTATGTGG + Intergenic
930966027 2:57327646-57327668 TGGGCCATGACTGTGTTAGGGGG + Intergenic
931637327 2:64352222-64352244 GTGAGAAGGACTGTGTTTTGGGG + Intergenic
931802114 2:65768651-65768673 TTGACCACAACTGTGTGCTGTGG + Intergenic
932273023 2:70427686-70427708 TTGACCAGAACTGGGTTACATGG - Intergenic
932882175 2:75512976-75512998 TTGGCCAGGACTGTGTCACATGG - Intronic
933683997 2:85128693-85128715 TTGACCAAAACTTTGTTATATGG - Intergenic
935178004 2:100665999-100666021 TTGACCAAAACCTTGTTATGTGG - Intergenic
936234031 2:110728180-110728202 TTGACCAAAACATTGTTATGTGG + Intergenic
936692625 2:114910608-114910630 GTGCCTAGAACTGTGTTATGTGG + Intronic
937519545 2:122695148-122695170 ATGACCAGGACTGTTTATTGGGG - Intergenic
937880446 2:126860389-126860411 TTGACCAGAACTTGGTTATATGG - Intergenic
937903650 2:127041092-127041114 TTGGCCAGGACTATGTCATAAGG + Intergenic
938629640 2:133152725-133152747 TTGACCAAAACTTTGTTATATGG - Intronic
939184771 2:138847369-138847391 TTGGCCAGGACTATGTTATATGG + Intergenic
940804806 2:158174884-158174906 TTGACCAAAACACTGTTATGGGG + Intronic
941783123 2:169470376-169470398 TTGACCAAAACATTGTTATGTGG + Intergenic
942491720 2:176495994-176496016 ATGACCAGGACAGTGCTGTGTGG + Intergenic
943485403 2:188473483-188473505 TTGAGAAGGACTGTGTCTTGTGG - Intronic
944951460 2:204754774-204754796 TTGACCAGAACTTAATTATGAGG + Intronic
945954482 2:216073270-216073292 TTGACCAAAACATTGTTATGGGG - Intronic
946123133 2:217534134-217534156 TTGACCAAAACAGCGTTATGTGG + Intronic
947586739 2:231361164-231361186 TTGTCCAGGGCTGGGTGATGGGG + Intronic
947713824 2:232330192-232330214 TTCACCAGGACTGTGCCAAGCGG + Intronic
948737410 2:240017958-240017980 GTGACTAGGACTGTGTTGGGCGG - Intronic
1168845074 20:938901-938923 TTGACCAGAACTGTGTCCTGTGG - Intergenic
1171039904 20:21752465-21752487 TTGACCAAAACATTGTTATGTGG + Intergenic
1172293626 20:33792916-33792938 TTGTCCTGGACTGTTTTCTGTGG - Intergenic
1173264492 20:41466858-41466880 TTGTCTAGGACTGTGTTACCTGG - Intronic
1174918518 20:54677755-54677777 TTAACCAGGACAGAGGTATGTGG - Intergenic
1175973131 20:62697180-62697202 GTAACCAGGACTGTCTTATCAGG - Intergenic
1179793302 21:43768069-43768091 TTGCCCAGGAGTGTGTCGTGAGG - Intergenic
1180977505 22:19856415-19856437 TTGACCAAAACGTTGTTATGCGG - Intergenic
1182294035 22:29302728-29302750 TTGCCCAGGCCTGTGCCATGTGG - Intergenic
1182974581 22:34611036-34611058 TTGACCAGAACCTAGTTATGTGG + Intergenic
1184224732 22:43122922-43122944 TTGACCAGAACTGGGTTACATGG + Intronic
1184313013 22:43660608-43660630 TTGACCAGGACTGTGTTATGTGG - Intronic
1184884932 22:47337545-47337567 TTGACAAGCACTGTGTGGTGAGG - Intergenic
950180426 3:10909202-10909224 TTGGCCAGGTCTGGGTCATGTGG + Intronic
950235459 3:11316127-11316149 GTGTCCAGGAGTGTGATATGAGG - Intronic
951647147 3:24905503-24905525 CTGGCCAGAACTGTGTCATGTGG - Intergenic
953079050 3:39598316-39598338 TGCACGAGGACTGTATTATGTGG - Intergenic
954932885 3:54299280-54299302 TGGACCAGGAGTGTGGTGTGGGG - Intronic
956802696 3:72776228-72776250 TTGACCACAACGTTGTTATGTGG - Intronic
958085485 3:88800528-88800550 TTGACTGGGATAGTGTTATGTGG - Intergenic
964430574 3:156601984-156602006 TTGACCAGGATGTTGTTATGTGG + Intergenic
965095055 3:164215731-164215753 GTGAGCAGGGCTGGGTTATGGGG - Intergenic
965350517 3:167606754-167606776 TTTACCTGGATTGTGTTATAAGG + Intronic
966553731 3:181234325-181234347 TTGACCAAAACGTTGTTATGAGG + Intergenic
967483832 3:190006876-190006898 TGGAACAGGACTGGATTATGGGG + Intronic
967805101 3:193708735-193708757 TGTGCCAGGACTGTGTTATGGGG - Intergenic
968881865 4:3304952-3304974 TTGGCCAGGGCTGTGCGATGAGG + Intronic
969327250 4:6451173-6451195 TTGACAAGGTCTGTGTCCTGAGG - Intronic
969634072 4:8355532-8355554 TTGACCAGGAATGTATTTCGAGG - Intergenic
971204518 4:24551017-24551039 TTGACCAAAACGTTGTTATGTGG + Intronic
973232304 4:47855440-47855462 TTGACCAGAACTCAGTTATATGG - Intronic
973833844 4:54789536-54789558 TTGACCAGGTTTTTGTTCTGTGG - Intergenic
973963611 4:56137350-56137372 TTGACCAAAACATTGTTATGCGG + Intergenic
975128844 4:70812207-70812229 ATGACCATGACAGTGTTAAGGGG - Intergenic
975323498 4:73034905-73034927 TTGACCAAAACATTGTTATGTGG - Intergenic
975542567 4:75530016-75530038 TTATCCAGTAATGTGTTATGTGG + Exonic
976005307 4:80423152-80423174 TTGACAAGAACCTTGTTATGTGG + Intronic
978737044 4:112095307-112095329 TTCAGCAGCACAGTGTTATGAGG + Intergenic
979423615 4:120537137-120537159 TTGACAGGGACTGCGGTATGGGG - Intergenic
979782769 4:124675262-124675284 TTCACCAGTACTGCGTAATGCGG - Intronic
980961632 4:139481563-139481585 TTGGCCAGAACTGTGATATGTGG - Intergenic
985771622 5:1815346-1815368 TTAACCAGGACTCTGCTTTGGGG - Intronic
987767724 5:22256246-22256268 TTGACCAGAACACTGTTATGTGG - Intronic
987824183 5:23007095-23007117 TTGACCAAAACATTGTTATGAGG - Intergenic
988322530 5:29717738-29717760 TTGACCAGGGCTGGGTCAGGGGG + Intergenic
990006507 5:50950485-50950507 TTGACCAAAACAATGTTATGTGG + Intergenic
991452697 5:66769733-66769755 TTGACCAAGACATTATTATGCGG + Intronic
991958058 5:72015251-72015273 TTGGCCAGGGCTGGGTCATGTGG + Intergenic
998323950 5:141261973-141261995 TTGTGCTGGACTGTGTTATATGG + Intergenic
1002546993 5:179955437-179955459 TTAACCAGACCTGTGTTTTGAGG - Exonic
1002840917 6:905814-905836 TTGACCAGAACTGTATCATGTGG + Intergenic
1003637395 6:7845248-7845270 TCTACAAGGACTGTGTTATGGGG + Exonic
1004173181 6:13315117-13315139 GTGACCAGGACTGTGTCACTTGG - Intronic
1004351850 6:14897063-14897085 TTGACTAGGAGTGTGATTTGGGG + Intergenic
1005506047 6:26469839-26469861 TTAACCAGAACTGTTTTAAGGGG - Intronic
1006705062 6:36012830-36012852 TTGACAAGGACAGTGTTTTGAGG + Intronic
1009687745 6:66986202-66986224 GTGATAAGGACTGTGTTTTGTGG - Intergenic
1010155237 6:72784779-72784801 TTGGCCAGAACTGAGTCATGTGG + Intronic
1012855772 6:104499397-104499419 TTGACCTGGAGTGTGTGCTGGGG - Intergenic
1013969300 6:115997723-115997745 TGAACCAGGACAGAGTTATGAGG - Intronic
1014903958 6:127003693-127003715 TTTACCAGGAGTATGTCATGAGG + Intergenic
1015041744 6:128728825-128728847 TTGACCAGCTCTGTGACATGAGG - Intergenic
1016686433 6:146887518-146887540 TTTACCACCACTGTTTTATGAGG + Intergenic
1018328259 6:162698325-162698347 TTAACAAGGACTGTGTCATGTGG - Intronic
1019481409 7:1268574-1268596 TAGACCAGGAGGGTGTTCTGAGG - Intergenic
1019825872 7:3283808-3283830 TTTTCCAGGACTCTGTGATGTGG - Intergenic
1023083285 7:36545503-36545525 TTGACCAGCACTGAATTAAGAGG - Intronic
1023285252 7:38612480-38612502 TAGAAAAGGACTGTGTTATGTGG - Intronic
1023329808 7:39102984-39103006 TTGACCAAAACTTTGTTCTGTGG + Intronic
1025112203 7:56227561-56227583 TAGAGCAGCACTTTGTTATGTGG - Intergenic
1028977214 7:96927227-96927249 TTGACCAAAACATTGTTATGCGG - Intergenic
1030643562 7:112033739-112033761 TTTCCAAGGACTGTGTTATTTGG - Intronic
1031846583 7:126812535-126812557 TTGACCAAAACATTGTTATGTGG + Intronic
1033793501 7:144820111-144820133 TTGGCCAGAACTAGGTTATGTGG - Intronic
1038108848 8:24470549-24470571 TTGACCAAAACATTGTTATGTGG - Intronic
1041610904 8:59847509-59847531 TTGACTAAGACGTTGTTATGCGG - Intergenic
1044670289 8:94673535-94673557 TTGAGCACGAATGTTTTATGGGG - Intronic
1045040558 8:98219816-98219838 TAGAACAGCACTGCGTTATGTGG - Intronic
1045731495 8:105247119-105247141 TTGTTCAGGACTATGTTATATGG - Intronic
1046113361 8:109753911-109753933 TTGATCATAACTGTTTTATGAGG + Intergenic
1047118100 8:121868228-121868250 TTGACCAAAACATTGTTATGAGG - Intergenic
1048623238 8:136157986-136158008 TTGGCCAGGCCTGTCTTCTGGGG - Intergenic
1048724854 8:137371981-137372003 TTTACCAAGACTGTGTTATGTGG - Intergenic
1048789474 8:138086231-138086253 TTGTCCAGGACTGTGACATGAGG + Intergenic
1050100497 9:2114074-2114096 ATGACAAGGTCTGTGTCATGAGG - Intronic
1050382930 9:5049995-5050017 TTGACCAAAACATTGTTATGGGG + Intronic
1050759950 9:9056408-9056430 CTGATCAGGTCTGTGCTATGCGG - Intronic
1053723154 9:40969928-40969950 TTGGCCAGGCCTGTGTCACGAGG - Intergenic
1056272411 9:84959316-84959338 CTGACCAGGGCTATCTTATGTGG + Intronic
1057070057 9:92089893-92089915 ATGGCCTGGCCTGTGTTATGGGG - Intronic
1058849296 9:108994988-108995010 TTGACCAGGCCTCTGTTACCTGG - Intronic
1059179749 9:112200633-112200655 TGGGCCAGGACTGTGTTATATGG - Intergenic
1059216730 9:112571478-112571500 TTGGCCATGACTGTGTCATAGGG + Intronic
1059280314 9:113127294-113127316 TTGGCCAGAACTGTGTCATGTGG + Intergenic
1061829111 9:133279426-133279448 CTGTCCAGGGCTGTGTTATTGGG + Intergenic
1187225049 X:17367700-17367722 TTGTCCAGAACTGTGTCATCTGG + Intergenic
1187846321 X:23541393-23541415 GTGACAAGGACTGTGTCTTGTGG + Intergenic
1189171593 X:38914828-38914850 TTGACCAAAACATTGTTATGCGG + Intergenic
1193016246 X:76737432-76737454 TTAACCAGGGCTGTGGTAGGTGG - Intergenic
1193488264 X:82115108-82115130 GTGACTAGGACTGTGTCTTGTGG - Intergenic
1195773600 X:108378591-108378613 TTGTCCAGAACTGAGTCATGTGG - Intronic
1200738231 Y:6824319-6824341 TGGACCTGGACTGTTTTTTGTGG + Intergenic
1201461834 Y:14233889-14233911 TTGACCAGGGATGTTTTGTGGGG - Intergenic