ID: 1184313147

View in Genome Browser
Species Human (GRCh38)
Location 22:43661680-43661702
Sequence TGAGCTCTGCCTCCACCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184313142_1184313147 -6 Left 1184313142 22:43661663-43661685 CCTTCATTCACCCCTAGTGAGCT 0: 1
1: 0
2: 2
3: 7
4: 86
Right 1184313147 22:43661680-43661702 TGAGCTCTGCCTCCACCAGGAGG No data
1184313141_1184313147 11 Left 1184313141 22:43661646-43661668 CCATGGAAAGCACATGGCCTTCA 0: 1
1: 0
2: 1
3: 34
4: 222
Right 1184313147 22:43661680-43661702 TGAGCTCTGCCTCCACCAGGAGG No data
1184313140_1184313147 15 Left 1184313140 22:43661642-43661664 CCAACCATGGAAAGCACATGGCC 0: 1
1: 0
2: 4
3: 19
4: 174
Right 1184313147 22:43661680-43661702 TGAGCTCTGCCTCCACCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184313147 Original CRISPR TGAGCTCTGCCTCCACCAGG AGG Intronic
No off target data available for this crispr