ID: 1184320930

View in Genome Browser
Species Human (GRCh38)
Location 22:43741740-43741762
Sequence TACCGAATCCTGCCCCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 59}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184320930_1184320933 21 Left 1184320930 22:43741740-43741762 CCACTCTGGGGCAGGATTCGGTA 0: 1
1: 0
2: 1
3: 6
4: 59
Right 1184320933 22:43741784-43741806 ATTATCCCTCCATCCAGCCACGG 0: 1
1: 0
2: 0
3: 13
4: 181
1184320930_1184320934 22 Left 1184320930 22:43741740-43741762 CCACTCTGGGGCAGGATTCGGTA 0: 1
1: 0
2: 1
3: 6
4: 59
Right 1184320934 22:43741785-43741807 TTATCCCTCCATCCAGCCACGGG 0: 1
1: 0
2: 4
3: 26
4: 308
1184320930_1184320931 -10 Left 1184320930 22:43741740-43741762 CCACTCTGGGGCAGGATTCGGTA 0: 1
1: 0
2: 1
3: 6
4: 59
Right 1184320931 22:43741753-43741775 GGATTCGGTATCTTCTCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184320930 Original CRISPR TACCGAATCCTGCCCCAGAG TGG (reversed) Intronic
900679605 1:3909355-3909377 AATTGAATCCTGCCCCAAAGAGG - Intergenic
901735003 1:11306692-11306714 TACTGAATGCTGGCACAGAGGGG + Intergenic
902892440 1:19454041-19454063 TACAGACTCATCCCCCAGAGTGG + Intronic
909289883 1:73868978-73869000 TACTTAAGCCTGCCCCAGGGGGG - Intergenic
917458762 1:175209339-175209361 TACTGACTGCTGCCCCAAAGTGG - Intergenic
919688834 1:200510265-200510287 TACCCATTAGTGCCCCAGAGTGG + Intergenic
1063405218 10:5787934-5787956 TACCTGATCCTTACCCAGAGAGG + Intronic
1067399809 10:45960991-45961013 TACCGAATTGTGCCACATAGAGG - Intergenic
1067868137 10:49930282-49930304 TACCGAATTGTGCCACATAGAGG - Intronic
1073132073 10:101196080-101196102 TTGGGAATCCTCCCCCAGAGTGG + Intergenic
1077310444 11:1886596-1886618 TTCCCAATGCAGCCCCAGAGTGG - Intronic
1083866095 11:65454161-65454183 CACCGCACCCAGCCCCAGAGAGG - Intergenic
1083905218 11:65664670-65664692 TACAGAATTCTGGCCCAGCGTGG - Intergenic
1083921210 11:65782030-65782052 TACCCCATCCTGCTCCAGATGGG + Intergenic
1084368147 11:68717117-68717139 TTGGGAATTCTGCCCCAGAGAGG - Intronic
1085604360 11:77883878-77883900 TCCGGAATCCTGGCCCAGGGCGG - Exonic
1086071378 11:82803432-82803454 TACCAAATTATGCCCCAGTGTGG + Intergenic
1089418849 11:118315941-118315963 TACCCAGTCCATCCCCAGAGAGG - Exonic
1108431534 13:50358628-50358650 TACCCTCTTCTGCCCCAGAGTGG - Intronic
1109455184 13:62578156-62578178 TACCCCCTCCTGCCCAAGAGGGG + Intergenic
1110385322 13:74904196-74904218 GACAGCATCCTGCCCCAGTGAGG + Intergenic
1125321756 15:38496355-38496377 TTCCAAACCCTGCCCCACAGTGG - Intronic
1129702303 15:77774921-77774943 TCCTGCATCCTGCCCCGGAGAGG + Intronic
1131348102 15:91670205-91670227 ATCTGATTCCTGCCCCAGAGAGG + Intergenic
1138355745 16:56379008-56379030 TGCCGAATCATCCTCCAGAGTGG - Intronic
1143939244 17:10522077-10522099 TACCAAAACCTGCCCAAGAGAGG - Intronic
1151277302 17:73045116-73045138 TACCCAAGGCTACCCCAGAGAGG - Intronic
1155062579 18:22241827-22241849 TGCAGAATTCTTCCCCAGAGAGG - Intergenic
1157826747 18:50819445-50819467 TACCAAATCCTACCCCCTAGAGG + Intronic
1158571486 18:58600323-58600345 CACCGCATCCGGCCCCAGTGGGG + Intronic
1160159823 18:76462488-76462510 AACCGAAACCTGCCCCCGTGCGG + Intronic
1163814011 19:19452807-19452829 GTCCAGATCCTGCCCCAGAGTGG + Intronic
1167360555 19:49028287-49028309 AACTGAAGCCTGCCTCAGAGGGG - Intronic
1167363093 19:49040513-49040535 AACTGAAGCCTGCCTCAGAGGGG + Intergenic
1167365474 19:49053073-49053095 AACTGAAGCCTGCCTCAGAGGGG - Intergenic
1167367658 19:49063573-49063595 AACTGAAGCCTGCCTCAGAGGGG - Intronic
928242286 2:29596959-29596981 TACTGAATTCCTCCCCAGAGGGG + Intronic
928606075 2:32946572-32946594 TACCAAATCGGGCCCCAGAAAGG - Intergenic
929960503 2:46492662-46492684 TACCTACTCCTGTCTCAGAGTGG - Intronic
946420115 2:219560233-219560255 TTCCTCCTCCTGCCCCAGAGTGG - Intronic
1174587647 20:51621446-51621468 TACTATATCCTGCCCCAAAGAGG + Intronic
1175432417 20:58915257-58915279 AACAGAATCCTGACCCAGAGTGG + Intergenic
1182635931 22:31727084-31727106 TAGTGGATCCAGCCCCAGAGGGG + Intronic
1184320930 22:43741740-43741762 TACCGAATCCTGCCCCAGAGTGG - Intronic
1184738428 22:46412514-46412536 TACCCAATCCTGGCCCAGAGAGG - Intronic
1185219549 22:49622593-49622615 TACCGGGGCCTGCCCCACAGAGG + Intronic
952566350 3:34663237-34663259 ATCAGAATCCTGCACCAGAGTGG + Intergenic
954440174 3:50517423-50517445 CACCCACTCCTGCCTCAGAGAGG - Intergenic
961057889 3:123804380-123804402 GACAGACTCCTGCCACAGAGAGG - Intronic
962377490 3:134870602-134870624 TATCTAATGCTGCCCCAGATTGG + Intronic
966181641 3:177194061-177194083 TACCGAATCCAATCCCAGAGGGG + Intronic
968614845 4:1572785-1572807 TCCTGACTCCTGCCCCAGAGGGG + Intergenic
970195481 4:13547198-13547220 TACGGAGTCCAGGCCCAGAGTGG + Intergenic
972518119 4:39828728-39828750 TACAGAATCCCACCCCAGAGTGG - Intronic
976133407 4:81909002-81909024 TTCAGCATCCTGCACCAGAGTGG - Intronic
986576919 5:9222054-9222076 CACCAAATCCAGCCCCAGGGGGG - Intronic
996716796 5:126594907-126594929 TACCGCATCCAGCGCCAGCGGGG + Intronic
997715015 5:136036114-136036136 TATCCAAACCTGCCCCCGAGGGG - Intronic
1004269220 6:14179123-14179145 TTCAGAATCCTACTCCAGAGTGG + Intergenic
1007796704 6:44354645-44354667 TATCACATCCTGCACCAGAGTGG + Intronic
1011398976 6:86938964-86938986 TACTTAATCCTGCGCAAGAGAGG + Intronic
1039219630 8:35315307-35315329 GACCCAAGCCTGCCCCATAGGGG - Intronic
1041451736 8:58013219-58013241 TACAGAATCTTTCCCCAAAGTGG + Intronic
1047663794 8:127067410-127067432 TATCAAATCCTGCACCAGAGCGG - Intergenic
1060490880 9:124083320-124083342 GACCACATCCTGCCCCAGCGTGG + Intergenic
1062480025 9:136746821-136746843 CACCGACTCCTGCCCCAGCACGG + Intronic
1197769307 X:130079974-130079996 TACCAAAGCCTGCCCCCTAGTGG - Intronic